ID: 998016390

View in Genome Browser
Species Human (GRCh38)
Location 5:138735499-138735521
Sequence GCAAAGGCACACAGGCAGCT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 403
Summary {0: 1, 1: 0, 2: 4, 3: 40, 4: 358}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
998016390_998016394 -2 Left 998016390 5:138735499-138735521 CCCAGCTGCCTGTGTGCCTTTGC 0: 1
1: 0
2: 4
3: 40
4: 358
Right 998016394 5:138735520-138735542 GCACAAGCTATCTGCTGCTCTGG 0: 1
1: 0
2: 0
3: 8
4: 136

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
998016390 Original CRISPR GCAAAGGCACACAGGCAGCT GGG (reversed) Intronic
900374162 1:2345722-2345744 GCATGGGCACCCAGGCACCTGGG - Intronic
900602677 1:3509755-3509777 GCAAAGGACCCCAGGCAGGTGGG + Intronic
900651403 1:3731803-3731825 TCAAAGGCACACTGGCTGCTGGG - Intronic
900902732 1:5527818-5527840 TGAAAGCCACACAGGCAGGTGGG + Intergenic
901123018 1:6910379-6910401 GCATAGGCACAGAGTCACCTGGG + Intronic
901684939 1:10938670-10938692 GCAAAGACCCTCAAGCAGCTGGG + Intergenic
901781883 1:11599557-11599579 CCAAGGTCACACAGGGAGCTAGG - Intergenic
902693491 1:18125167-18125189 GCAAAGGCCCTGGGGCAGCTGGG - Intronic
903047401 1:20575149-20575171 GCAAAGGCCCCGAGGCAGCAAGG + Intergenic
904556109 1:31365633-31365655 CCAAAGGCAAAAAGGCAACTGGG + Exonic
904951407 1:34242568-34242590 GCATTGGCACACAGGCAAATAGG - Intergenic
905172444 1:36117080-36117102 GCAGAGGCAAGCAAGCAGCTGGG - Intronic
905471599 1:38196314-38196336 GTAGAGACACACAGGCACCTGGG + Intergenic
905888894 1:41507653-41507675 TCACAGGCAAACAGGAAGCTTGG + Exonic
911085439 1:93973685-93973707 ACAAAGGCACACAGACAGCTGGG - Intergenic
911182605 1:94874565-94874587 ATAAGGGCACTCAGGCAGCTAGG + Intronic
912437412 1:109671530-109671552 GGGAAGGCATCCAGGCAGCTGGG - Exonic
913153723 1:116073147-116073169 GTAAAAGCACACAGTCAACTTGG + Intergenic
913205952 1:116538953-116538975 GGATATGCACTCAGGCAGCTGGG - Intronic
915113088 1:153577143-153577165 GAGAAGGCAAACAGGCAGGTAGG + Intergenic
916512848 1:165488390-165488412 GCTGAGTCTCACAGGCAGCTTGG - Intergenic
916809375 1:168292121-168292143 GGAAAGCCAAACAGGCAGGTGGG - Intronic
917368678 1:174263164-174263186 GCAAAGGCTGGCAGGCAGGTGGG - Intronic
918986052 1:191628108-191628130 CCTAAGGCTCTCAGGCAGCTGGG - Intergenic
919907538 1:202088239-202088261 GCAGAGGGAAAGAGGCAGCTAGG + Intergenic
920053010 1:203174835-203174857 GCAAAGTCACACAGCAAGGTAGG + Intronic
920297741 1:204969335-204969357 GCATAGGTACACAGACAGCACGG - Intronic
922445421 1:225692887-225692909 GCCAAGGAATATAGGCAGCTAGG + Intergenic
922703976 1:227779286-227779308 GCAGTGGGACACATGCAGCTTGG - Intronic
922717193 1:227883894-227883916 GGATGGGCACACAGGGAGCTAGG - Intergenic
922755343 1:228093505-228093527 ACATCGGCACACAGACAGCTTGG - Intronic
923275037 1:232388194-232388216 GCAAAGTAACACAAGCAGCAGGG - Intergenic
923442843 1:234037872-234037894 GTAAAGGCACAGAGCCATCTCGG + Intronic
1063230083 10:4057218-4057240 GCAAAGGTGCACAGGCTGCTGGG - Intergenic
1063787173 10:9398721-9398743 GCTAAAGAACACTGGCAGCTGGG - Intergenic
1064008448 10:11715940-11715962 GCAAAGGCAGAGAGGGAGGTGGG + Intergenic
1066457508 10:35585071-35585093 GCCCAGGCACCCAGGCAGATGGG - Intergenic
1067461982 10:46465085-46465107 GCAAAGGCACAGAGGCAGGAAGG + Intronic
1067625213 10:47919513-47919535 GCAAAGGCACAGAGGCAGGAAGG - Intergenic
1067683304 10:48453520-48453542 GCAAAAGCCCACAGGCAGCAGGG - Intronic
1067709402 10:48636316-48636338 ACACAGGCACACAGACAGCATGG - Intronic
1067918178 10:50423168-50423190 GGAAAGCCACAGGGGCAGCTGGG + Intronic
1069761416 10:70814226-70814248 CCAAAGACACACAGGCAGGATGG - Intergenic
1069885266 10:71619663-71619685 CCAGAGGCACACAGGAAGATTGG + Intronic
1070300202 10:75198086-75198108 GGAAAGTCACACAGGCAATTTGG - Intergenic
1072309889 10:94144712-94144734 GCAAAGGCCCAGTGGCAGCAGGG + Intronic
1073104447 10:101024167-101024189 GCACAGTCACACAGGCACGTAGG + Intronic
1073366462 10:102946281-102946303 GGAAAGGCACAGAGGCAGAAAGG + Intronic
1074696434 10:116053820-116053842 GCAAAGTCACACAGCCAGGGTGG - Intergenic
1075945633 10:126430707-126430729 GCAGAAGCAGACAGGCAACTTGG + Intronic
1076183990 10:128432267-128432289 CCACATGCACACAGGCAGCTGGG + Intergenic
1078597918 11:12704423-12704445 GCAAAGGCACAGAGGCAAAAAGG - Intronic
1078752806 11:14180990-14181012 TCTAGGGCACACAGCCAGCTGGG - Intronic
1079078571 11:17398265-17398287 GCAAGAGCACACAGGTACCTGGG - Intronic
1079420191 11:20278819-20278841 GCTGAGGCACACAGCCAGCGGGG + Intergenic
1080174504 11:29345700-29345722 GCCAAGCTACATAGGCAGCTAGG - Intergenic
1080610393 11:33899173-33899195 TCAAAGGCACACAGTGAGCAGGG - Intergenic
1081230030 11:40574768-40574790 GCATAGGCATACAGACACCTAGG + Intronic
1081662738 11:44897913-44897935 ACAGAGGCAAACAGGCAGATTGG - Intronic
1081963226 11:47153539-47153561 CCAAAGTCACACACACAGCTGGG - Intronic
1083391471 11:62354269-62354291 GCAAAGGCACAGAGACACGTGGG + Intronic
1083899238 11:65635754-65635776 GCAATGGCACCCAGGCTGATGGG - Exonic
1083989464 11:66237987-66238009 GCCTAGGCAAAGAGGCAGCTGGG - Intronic
1084062971 11:66687744-66687766 GCAGAGGCTCACAGGCAGCTTGG - Intronic
1084166322 11:67376325-67376347 GCAGAGGGGCACTGGCAGCTTGG - Intronic
1085731431 11:79002248-79002270 GCAAATGCACACAGGAATGTTGG + Intronic
1085827350 11:79861687-79861709 TCAAAGGCACACAGCCAGTTGGG - Intergenic
1087248340 11:95867402-95867424 GCAAAGGCACACAGAAACATGGG + Intronic
1089027376 11:115285721-115285743 CTAAGAGCACACAGGCAGCTGGG + Intronic
1089362983 11:117903475-117903497 GGAAAGAAACACAGACAGCTGGG + Intronic
1089376371 11:117997952-117997974 GCAAAGGCCCTGAGGCAGCACGG + Intronic
1089871011 11:121672715-121672737 GCTAATGCAGACAGGCAGCTGGG + Intergenic
1090240705 11:125179543-125179565 GCAAGAGCTGACAGGCAGCTGGG + Intronic
1090332100 11:125940307-125940329 GCACAGGCCCACAGAAAGCTTGG - Intergenic
1090718748 11:129453696-129453718 GCAACCTCGCACAGGCAGCTAGG - Intergenic
1091957236 12:4656634-4656656 CCAAGGGCACACAGTCAGGTGGG - Intronic
1092131166 12:6114249-6114271 TCAGAGGCAGCCAGGCAGCTTGG + Intronic
1092385768 12:8034419-8034441 GCAGAGGCATACATCCAGCTAGG - Intronic
1092950741 12:13500683-13500705 CCAAAGGCACAGAGTCAGCAGGG - Intergenic
1095969168 12:47889879-47889901 ACACAGGCACACTGGAAGCTGGG - Intronic
1096823919 12:54259605-54259627 GCAGTGGCGCCCAGGCAGCTGGG - Intronic
1097385778 12:58948758-58948780 ACAAAAGTACACAGGCAGCAAGG - Intergenic
1098448354 12:70590813-70590835 GCAAAGGCCCAGAGGCAGAAGGG - Intronic
1102041819 12:109805820-109805842 GCACAGACACACATGCATCTGGG + Intronic
1102189567 12:110976777-110976799 GCAAAGGCTCAGAGGCAGGGTGG + Intergenic
1102569577 12:113819301-113819323 CCAAAGGGACACAGGGAGGTGGG - Intronic
1102717819 12:114989360-114989382 CCAAAGGCACACAGTCAGGGGGG - Intergenic
1103567936 12:121826487-121826509 GCAAAGGCCCTGAGGCAGCAGGG + Intronic
1103842878 12:123879636-123879658 ACAACAGCACATAGGCAGCTTGG + Exonic
1103863117 12:124029969-124029991 AAAAAGGGACACAGGCAGGTGGG - Intronic
1103947268 12:124533308-124533330 GCCAAAGCACTGAGGCAGCTTGG - Intronic
1104010885 12:124929233-124929255 GCAAAGTCACCCCGGCTGCTGGG + Intergenic
1104297619 12:127531756-127531778 GCAAAGGAACCCAGGCAGGTGGG - Intergenic
1104976923 12:132556342-132556364 GCAAAGCCACACTGCCAGCGTGG + Intronic
1106310563 13:28550355-28550377 GGAAAGGAAGACAGGCAGCCAGG + Intergenic
1106798853 13:33235141-33235163 GCAAACTCACACAGGAGGCTTGG + Intronic
1107080569 13:36370239-36370261 GCAAAGGCAGCCTTGCAGCTGGG + Intergenic
1107222688 13:38004596-38004618 GCAAAATCACACAGGCTACTTGG - Intergenic
1107873077 13:44764683-44764705 CCAAAGGCACTCAGCCAGCCAGG + Intergenic
1109819910 13:67639079-67639101 GCAAAGGCTTACAGGCACTTAGG - Intergenic
1112507604 13:99984556-99984578 TCAAAATCACACAGGCTGCTGGG - Intronic
1112830153 13:103439732-103439754 TCAAAGGCACAGGGACAGCTTGG - Intergenic
1113738671 13:112696402-112696424 GCAGAGGCAGAAAGGCTGCTGGG - Intronic
1118009382 14:61593946-61593968 GCAAAGGCAAAGAGGAAGCATGG + Intronic
1119804872 14:77476010-77476032 GGGTAGGCACACGGGCAGCTGGG + Exonic
1119937395 14:78604600-78604622 GCAGGGCCAAACAGGCAGCTAGG - Intronic
1121140676 14:91539064-91539086 GCAAAGTCACACAGGCAGAAAGG - Intergenic
1121647137 14:95526152-95526174 GCAAAGGCACAGAGGCCCCTGGG - Intergenic
1122785962 14:104163366-104163388 GCACAGACACACAGACAGCGTGG + Intronic
1124137704 15:27049244-27049266 GCAAAGACACATCAGCAGCTGGG - Intronic
1125919089 15:43514428-43514450 GCAAAGGGGACCAGGCAGCTGGG + Intronic
1127392930 15:58521514-58521536 GCAAAGGCACAGAGGCATCCGGG + Intronic
1128775319 15:70315949-70315971 GAAAAAGAACACAGGCATCTAGG - Intergenic
1129459408 15:75692979-75693001 ACAAGGTCACACAGCCAGCTGGG + Intronic
1129685472 15:77684016-77684038 ACAAAGGCCTAGAGGCAGCTTGG - Intronic
1129724553 15:77894907-77894929 ACAAGGTCACACAGCCAGCTGGG - Intergenic
1129977652 15:79835670-79835692 CCAAAGCTACACAGGCAGCCTGG - Intronic
1131258805 15:90877968-90877990 GCAGAGGCAAACAGGTAGTTGGG + Intronic
1131558060 15:93416113-93416135 GAGAAGGCACGCAGGGAGCTGGG + Intergenic
1133734282 16:8602246-8602268 GCAAAGTCACAAAAGCAGCAGGG + Intergenic
1133970563 16:10564764-10564786 GGAAATGCAAACAGGCAGCTCGG + Intronic
1134731150 16:16463247-16463269 CCATAGGAAAACAGGCAGCTCGG + Intergenic
1134880818 16:17743994-17744016 GCAGAGACACACAGGAAGCCAGG + Intergenic
1134936279 16:18248622-18248644 CCATAGGAAAACAGGCAGCTCGG - Intergenic
1135464613 16:22674687-22674709 GAAAAGCCACACTGGCAGCTGGG + Intergenic
1137778228 16:51074270-51074292 GCAAAGGCACGGAGGCAGCAGGG - Intergenic
1137894269 16:52194233-52194255 GCAAAATGACACAGGCATCTGGG + Intergenic
1138653015 16:58472487-58472509 GCAATCACACACAGGCAGCCGGG - Intronic
1139559109 16:67730386-67730408 GGATGGGCACCCAGGCAGCTTGG + Intronic
1140839435 16:78825554-78825576 GCAATGGCACACAGACCTCTGGG - Intronic
1140871685 16:79112459-79112481 CAAAAGGCACGCAGGCATCTGGG - Intronic
1141523619 16:84597735-84597757 TAAAAGGCAGACAGGCAGCAAGG - Intronic
1141573720 16:84950886-84950908 GCAAAGGCTCTGTGGCAGCTGGG - Intergenic
1141697010 16:85624908-85624930 GCAAAGTGACACAGGCCGCTGGG - Intronic
1142203881 16:88773594-88773616 GAAAAGGCTGACAGGCAGGTCGG + Intronic
1142513569 17:412979-413001 GCAAAATCACACAGGCAGGTGGG + Intronic
1143577909 17:7805372-7805394 GCAGAGGCCAAGAGGCAGCTAGG + Exonic
1143722012 17:8819041-8819063 GGAAAGGGAGACAGCCAGCTGGG - Intronic
1144993042 17:19247063-19247085 AAAAAGGCACACAGGGGGCTGGG - Intronic
1145233288 17:21190616-21190638 GCAAAGGCACAGGGCCAGCCCGG - Intronic
1147055258 17:37829243-37829265 CCAAGAGCACACAGGCAGCAGGG - Intergenic
1147326401 17:39671761-39671783 GAACATGCACACAGGCAGCCTGG + Exonic
1147729486 17:42589336-42589358 GCAAAGGCAGACAGGAAAGTTGG - Intronic
1148449916 17:47770297-47770319 GAAATGGCAGACAGTCAGCTAGG + Intergenic
1149075103 17:52587405-52587427 GAAAACACACACATGCAGCTGGG + Intergenic
1151475107 17:74340793-74340815 GCAAAGAGCCACAGGCAGCTGGG - Intronic
1152603641 17:81278004-81278026 TCAAGGGCACAAAGGAAGCTAGG + Intronic
1152876656 17:82790294-82790316 TCAAGGGCACAGAGGCAGCATGG - Intronic
1153171418 18:2320262-2320284 ACAAAGGCACACAGGTATGTGGG - Intergenic
1155179387 18:23330943-23330965 GAAAAGGCCCACGGGCAGCCTGG + Intronic
1157590877 18:48835935-48835957 ACAAATGCAAACAGGGAGCTGGG - Intronic
1159433826 18:68389660-68389682 GCAAAGACAAACATGAAGCTTGG + Intergenic
1159519101 18:69495701-69495723 GCAGAGGCAGACAGGTACCTGGG - Intronic
1159880206 18:73851992-73852014 CCAAAGTCACACAGGCAGCTGGG + Intergenic
1160786448 19:902101-902123 GCTAGGGCAGGCAGGCAGCTGGG + Exonic
1161249798 19:3274461-3274483 GCACATGCACACAGGCAGGAAGG - Intronic
1161293788 19:3509215-3509237 GCCAACGCACACAGGGACCTGGG - Intronic
1161650332 19:5480407-5480429 GCAAAGACACAAAGGAGGCTAGG + Intergenic
1161737398 19:5999885-5999907 GCAAAGGCCCTGAGGCAGCGTGG + Intronic
1162110967 19:8399576-8399598 GCAAGGGGACCCAGGCAGCCAGG - Intronic
1162462142 19:10819597-10819619 GCACAGGCAGTCAGGCACCTAGG + Intronic
1163683302 19:18696188-18696210 GCAAAAACACACAGGCTGCGGGG - Intronic
1164457556 19:28421264-28421286 GTCAGGTCACACAGGCAGCTGGG - Intergenic
1165830545 19:38728312-38728334 GCAGAAGCAGACAGGCAGCATGG + Intronic
1165948514 19:39459343-39459365 GCAGAGTCACACAGGCAGTGTGG + Intronic
1167041640 19:47026333-47026355 GCAAAGGCCCTGAGGCAGGTGGG + Intronic
1167210888 19:48133456-48133478 GCAGAGGGACACAGGAACCTGGG + Intronic
925513241 2:4650986-4651008 GCAGAGGCAGACAGGCAGTTTGG + Intergenic
925588197 2:5484248-5484270 GAGAAGGGACACAGGTAGCTGGG - Intergenic
927068080 2:19493799-19493821 GCAAAGGCCCAGAGGCAGGAAGG + Intergenic
927251714 2:21000558-21000580 GCAAAGGCAGACAGTCAGTGAGG + Intergenic
927689209 2:25195793-25195815 GCAAAGGCCCAGAGGCAGGAGGG - Intergenic
928389420 2:30897733-30897755 GGAAAGGAACACAGACCGCTGGG + Intergenic
929580557 2:43079442-43079464 GAAGAGGAACCCAGGCAGCTAGG - Intergenic
929870009 2:45751096-45751118 GCAAAGGCACAGAGGCTGAAAGG - Intronic
930392015 2:50773402-50773424 GCAAAGGGACACAGGAATCTAGG - Intronic
930720755 2:54635357-54635379 ACACAGCCACACAGGCATCTGGG - Intronic
932343888 2:70983307-70983329 GGAAAGGCATAGAGGCACCTGGG + Intronic
932494419 2:72139358-72139380 GCTGAGGCAGCCAGGCAGCTGGG - Intronic
932948462 2:76265143-76265165 GCAAAGCCGCAGAGGCAGCCAGG + Intergenic
933964276 2:87422682-87422704 GCAAAGACACCCAGCCAGCCAGG + Intergenic
934244647 2:90296648-90296670 GCAAAGCCACTCAGCCAGCCAGG + Intergenic
934264200 2:91500794-91500816 GCAAAGCCACTCAGCCAGCCAGG - Intergenic
934971698 2:98769369-98769391 GCCCAGGCACCCAGGCATCTTGG - Intergenic
935147041 2:100402692-100402714 GAAAAGGCACACAGGTGGATGGG + Intronic
935605847 2:104971542-104971564 GCAAAGGCTCACATGGAGCCTGG + Intergenic
937024814 2:118689274-118689296 CCCAGGGTACACAGGCAGCTGGG - Intergenic
937278201 2:120699804-120699826 GCAAAGACATAAAGGCAGTTGGG + Intergenic
937329635 2:121018642-121018664 TCGAAGGCACACAGGCGGCTGGG - Intergenic
937360347 2:121225197-121225219 GCACAGGCACACTGTCAGGTGGG + Intronic
937770345 2:125713583-125713605 CCAGTGTCACACAGGCAGCTTGG - Intergenic
938671276 2:133588915-133588937 CCAAAGGCACACTGGCTTCTTGG - Intergenic
939737188 2:145862183-145862205 GCACAGCCTCACAGGCAGCTAGG - Intergenic
941917363 2:170821655-170821677 GAAAGGGAACACAGGCATCTGGG - Intronic
942144918 2:173017688-173017710 GGAAAGGTAGACAGGCATCTCGG - Intronic
944211637 2:197211897-197211919 CCAAAGGAACACAAGCACCTCGG + Intronic
944534474 2:200695761-200695783 GCAAAGGCACAGCTGCAGATGGG - Intergenic
946107548 2:217385127-217385149 GCACAATCACACAGGCACCTTGG + Intronic
946804046 2:223452065-223452087 TCACAGGCACAGGGGCAGCTTGG + Intergenic
947461339 2:230306837-230306859 GGAAAGGCAGACAGGCTCCTGGG + Intronic
949023740 2:241755340-241755362 GCAGAGTCACACAGGCAGTGGGG - Intronic
1168973310 20:1945737-1945759 GCAAAGGCACTCGGGCAGCCCGG + Intergenic
1169276124 20:4234849-4234871 GCAAAGGCCCTGAGGCAGCAGGG + Intronic
1169391931 20:5197658-5197680 GCACAGGCACACAGCTATCTGGG - Exonic
1170803717 20:19611758-19611780 GCAAAGGGACACAGCCCGATAGG - Intronic
1170893497 20:20395183-20395205 GCAAAGCCACCCCTGCAGCTGGG + Intronic
1172066513 20:32224522-32224544 GCAATGGCAAACAGGCTGCTTGG + Intronic
1172620139 20:36313285-36313307 AGAAAGGCAGGCAGGCAGCTGGG - Intronic
1172624388 20:36338895-36338917 GCAAAGGCACCGAGGCAGGTGGG + Intronic
1173983492 20:47242639-47242661 GCAAAAGCAAACAGCCAGCAGGG + Intronic
1175115112 20:56676676-56676698 GAAAAGGGACCCAGGCAGCGTGG + Intergenic
1175224089 20:57434714-57434736 GCAAAGGGACACAGTCATCTGGG + Intergenic
1175530861 20:59673590-59673612 ACAAGGGAAGACAGGCAGCTGGG + Intronic
1175803733 20:61815644-61815666 GCAAAGGTACAGAAGCAGCCTGG + Intronic
1176331069 21:5548763-5548785 GGAAAGGAGCACAGGCAGCAGGG - Intergenic
1176396688 21:6272188-6272210 GGAAAGGAGCACAGGCAGCAGGG + Intergenic
1176440469 21:6716916-6716938 GGAAAGGAGCACAGGCAGCAGGG - Intergenic
1176464731 21:7043985-7044007 GGAAAGGAGCACAGGCAGCAGGG - Intergenic
1176488292 21:7425764-7425786 GGAAAGGAGCACAGGCAGCAGGG - Intergenic
1176913546 21:14597782-14597804 GCAAAGGCACACATGAAGGATGG - Intronic
1177283158 21:19011592-19011614 GCACAGGCAAGCAGCCAGCTGGG - Intergenic
1179592712 21:42420602-42420624 GCAAGGGCAGACAGGCAGGAAGG + Intronic
1180055096 21:45353733-45353755 GCATAGGCACACAGGCACACAGG + Intergenic
1180055105 21:45353813-45353835 GCATAGGCACACAGGCACACAGG + Intergenic
1180554387 22:16563395-16563417 GCCAAGCCACACAGGCAGCCAGG + Intergenic
1181528230 22:23502106-23502128 GGAAGGGCACACAGGCAGGTTGG - Intergenic
1182043413 22:27255998-27256020 GCACAGACACAGAGACAGCTGGG + Intergenic
1182390956 22:29995606-29995628 GAAAAGGGACAAAGGCAGATAGG + Intronic
1182503350 22:30764505-30764527 CCCCAGGCACACAGGCAGCAGGG - Intronic
1182748770 22:32625424-32625446 GCAAAGGACCAAAGCCAGCTGGG - Intronic
1183231715 22:36586457-36586479 GTAAAGTCAGCCAGGCAGCTGGG - Intronic
1183413780 22:37671298-37671320 CCAAAGTCACACAGGTAGCTAGG - Intergenic
1184057420 22:42061655-42061677 GCAAAGGCAGACAGGCACAGTGG + Intronic
1184417444 22:44360509-44360531 GCAAAGGCTCAGAGGCAGGAAGG + Intergenic
1185314186 22:50171665-50171687 GCAGAGGCTCACAGGCAGGCTGG - Intronic
949906903 3:8865215-8865237 GCTAAGGCAAACTGGGAGCTGGG - Intronic
950203833 3:11062891-11062913 GGAAAGGCACCCAGGCAGAAGGG + Intergenic
950585342 3:13888267-13888289 CCAAAGGCACATAGCCAGCTAGG + Intergenic
950668628 3:14512139-14512161 GCAAAGGCCCAGAGGCAGGAAGG + Intronic
952089628 3:29868853-29868875 GCAAAGGCTCACTGGGGGCTGGG - Exonic
952332650 3:32378585-32378607 GCAAAGACAAACAAGCAGCCTGG + Intergenic
952881255 3:37987399-37987421 GGGCAGGCTCACAGGCAGCTGGG - Intergenic
954046864 3:47939061-47939083 GCAAAGGCACAGGGGCAGAGTGG - Intronic
954901076 3:54020628-54020650 GCAAAGGCAGGCAAGCAGCAAGG + Intergenic
955321944 3:57980874-57980896 GCAAAGGCACACAGCTAGGCCGG + Intergenic
955764539 3:62328018-62328040 GCAAAGGCACACAATGAGCCTGG - Intronic
956480570 3:69669873-69669895 GCAAAGGCACCAAGGCAGGAAGG - Intergenic
956811493 3:72867866-72867888 GCAAAGGCACGGATGAAGCTTGG + Intergenic
960706692 3:120489209-120489231 GTAAAGGCTTATAGGCAGCTAGG + Intergenic
961050423 3:123740876-123740898 GCAAAGCCAGCAAGGCAGCTGGG + Intronic
961166647 3:124768153-124768175 ACCAAGACAGACAGGCAGCTGGG + Intronic
961312445 3:126012121-126012143 GCAAAGGCCCAGAGGCAGGAAGG - Intronic
961517793 3:127449069-127449091 GGAAAGGCACCCAGGCTGCCTGG + Intergenic
961648538 3:128405769-128405791 CCAACGGCACATAGGAAGCTGGG + Intronic
961978660 3:131053998-131054020 CCTAAGACACACTGGCAGCTTGG - Intronic
962248018 3:133814059-133814081 GCAATGGCCAACATGCAGCTGGG - Intronic
962457363 3:135576998-135577020 GCCAAGGCCCCAAGGCAGCTGGG - Intergenic
962498446 3:135965854-135965876 GCAAAGGAACACTGGCCGCACGG + Intronic
962730372 3:138277149-138277171 ACAAAGGTACAAAGGCAACTTGG + Intronic
964591823 3:158372419-158372441 GCAAAGGTACAAAGGCAATTTGG - Intronic
964821459 3:160774981-160775003 GCAAATGCAATCAGACAGCTTGG - Intronic
966109603 3:176383170-176383192 GCAAAGGCACACAGCTATCTGGG + Intergenic
966256079 3:177917824-177917846 GGAAAGGCAAACAGGCTCCTGGG + Intergenic
967049150 3:185766032-185766054 CCAAAGGCACACATGAAGATGGG + Intronic
967319998 3:188185599-188185621 GCAAAGGCACAAAGTCAGCCAGG - Intronic
968910564 4:3475270-3475292 GCCATGGCACAGAGGCCGCTGGG + Intronic
969621176 4:8279696-8279718 GCCACGGCACACAGGGACCTGGG - Intronic
970505278 4:16723179-16723201 CCAAAGTCAGACAGGGAGCTAGG - Intronic
970668329 4:18364439-18364461 ACAAAGGAACACAGGCAATTTGG - Intergenic
971327850 4:25658637-25658659 GGTGAGGCACACAGGCAACTCGG + Intronic
971400842 4:26273978-26274000 GCAAAGACCCATAGGCAGCAGGG - Intronic
973537392 4:51897021-51897043 GCAAAGGCCCAGAAGCAGATGGG - Intronic
979798652 4:124877846-124877868 AAAAAAGAACACAGGCAGCTGGG - Intergenic
981310921 4:143297417-143297439 GCAAAGGCCCACAGACAGAAGGG - Intergenic
981438029 4:144749341-144749363 GCCAAGGCAAACAGGAGGCTGGG - Intergenic
985452044 4:190067766-190067788 GTAAAGGCCCACAGGCAGGCAGG - Intergenic
985453029 4:190071063-190071085 GTAAAGGCCCACAGGCAGGCAGG - Intergenic
985454018 4:190074356-190074378 GTAAAGGCCCACAGGCAGGCAGG - Intergenic
985455006 4:190077649-190077671 GTAAAGGCCCACAGGCAGGCAGG - Intergenic
985455995 4:190080949-190080971 GTAAAGGCCCACAGGCAGGCAGG - Intergenic
985456978 4:190084243-190084265 GTAAAGGCCCACAGGCAGGCAGG - Intergenic
985457965 4:190087536-190087558 GTAAAGGCCCACAGGCAGGCAGG - Intergenic
985458954 4:190090836-190090858 GTAAAGGCCCACAGGCAGGCAGG - Intergenic
985463206 4:190173601-190173623 GTAAAGGCCCACAGGCAGGCAGG - Intergenic
986051193 5:4091859-4091881 ACATAGGCACATAGGCACCTTGG + Intergenic
986769371 5:10957844-10957866 GCCAAGGAAAACAGGCAGCTTGG + Intergenic
987277206 5:16374590-16374612 GCAAAGGCACCCAGGAAGATGGG + Intergenic
987338095 5:16914861-16914883 GCAAAGTCCCACAGCCAGATGGG - Intronic
988802264 5:34707627-34707649 GCAAAGTCCCCCAGGCATCTGGG + Intronic
988836421 5:35037033-35037055 GCAGTGGCACAAAAGCAGCTCGG - Exonic
988852298 5:35191873-35191895 GCAAAGGCACTGAGGAAGCCTGG - Intronic
989293891 5:39801162-39801184 GCAAAGGCACACCACCAACTTGG + Intergenic
994147140 5:96408272-96408294 GGAGACGCACACAGGCACCTCGG - Exonic
994289734 5:98014620-98014642 ACACAGGCACACAGGCAGCTGGG + Intergenic
995540883 5:113185017-113185039 GCAAAGGCACCAGGGAAGCTGGG + Intronic
995844013 5:116473832-116473854 GCAAAGGCAGGCAGGCAGAGGGG + Intronic
996082713 5:119273114-119273136 CCAAAGCCACACAGCCAGCAGGG - Intronic
996472586 5:123877672-123877694 GCAAAGCCACACAGTAAGCATGG - Intergenic
997028850 5:130098483-130098505 GCAAGGTCACACAGCCAGCATGG - Intronic
998016390 5:138735499-138735521 GCAAAGGCACACAGGCAGCTGGG - Intronic
998549439 5:143063280-143063302 GGAAAGACACAATGGCAGCTTGG - Intronic
998657805 5:144201674-144201696 TCAAAGTCACACAGCCAGCCAGG + Intronic
998794125 5:145799497-145799519 GAAAAGGCACACAGGCAAGTGGG + Intronic
999249536 5:150174111-150174133 CCAAGGTCACACAGCCAGCTAGG + Intronic
1000113345 5:158130103-158130125 TCAAAGGCAGAAAGGCAGCAAGG - Intergenic
1000581234 5:163037160-163037182 CCCAAGGCACACAGGCACATAGG + Intergenic
1001157924 5:169289129-169289151 GCAAAGGTACTCAGACAGGTCGG + Intronic
1001530642 5:172459123-172459145 GACAAGGCACAGTGGCAGCTGGG - Intergenic
1001693307 5:173648913-173648935 ACAAAGGCAGAAAGGAAGCTGGG - Intergenic
1002887247 6:1308706-1308728 GGAAAGGTAAAGAGGCAGCTGGG + Intergenic
1002929747 6:1624952-1624974 GCGCAGGGACACGGGCAGCTGGG - Intronic
1003208789 6:4040112-4040134 GCCAAGGCAGGCAGGGAGCTCGG - Intronic
1003557872 6:7157028-7157050 GCAAAGGACCCCAGGGAGCTGGG - Intronic
1004184960 6:13413762-13413784 GCAAAGCCAAACAAACAGCTTGG + Intronic
1006307816 6:33235227-33235249 GCAAAGACAGACGGTCAGCTGGG + Intergenic
1007106260 6:39285194-39285216 GCAAAGGGACAGAGGCAGACAGG + Intergenic
1007119430 6:39367886-39367908 GTAAAAGCACACAGACAGCTGGG + Intronic
1007309497 6:40934249-40934271 GCAGAGGCTCTCTGGCAGCTGGG - Intergenic
1007400170 6:41598823-41598845 GCAGAGGAAGACAGGCAGCCCGG + Exonic
1007720676 6:43883665-43883687 CCAGAGCCACACAGGCATCTGGG - Intergenic
1008452887 6:51673411-51673433 GCAAAGGCACACAGAAAAGTAGG - Intronic
1008563980 6:52749415-52749437 GCAAATGCACCCAGGCAGGAAGG + Intergenic
1008568292 6:52790702-52790724 GCAAACGCACCCAGGCAGGAAGG + Intergenic
1008579691 6:52895656-52895678 GCAAATGCACCCAGGCAGGAAGG + Intronic
1011356498 6:86477267-86477289 GCCATGGCTCACAGGCAACTTGG - Intergenic
1011666964 6:89643690-89643712 GCAAAAGAAAACAGGCAGCTGGG + Exonic
1012326278 6:97922208-97922230 GCAAAGGAACATATGAAGCTGGG + Intergenic
1014225453 6:118841453-118841475 GCAGAGGCAAACAGGGTGCTTGG + Intronic
1015204328 6:130617849-130617871 TCAAAGGCACACAGGCAAAAGGG + Intergenic
1016749918 6:147621154-147621176 GTAAAAGCATACAGGAAGCTTGG - Intronic
1016956535 6:149632450-149632472 GCAAAGACAGACACGGAGCTTGG + Intronic
1019510317 7:1414393-1414415 CCAAGGCCACACAGCCAGCTGGG - Intergenic
1019611073 7:1936930-1936952 GCCCAGGCACACACGCAGCACGG + Intronic
1020213500 7:6171974-6171996 GCTAAGGCAGACAGGTAGCAGGG - Intronic
1022870309 7:34471483-34471505 GCAAAGGCCCTCAGGCCCCTGGG + Intergenic
1023171072 7:37390857-37390879 GCCAGGGCACACAGGTGGCTGGG + Intronic
1023632446 7:42177833-42177855 GCAGAGGCTCACATGCTGCTGGG + Intronic
1026217268 7:68360723-68360745 GCAAATGCACACAGGTAGGGAGG - Intergenic
1026390492 7:69896805-69896827 GCAAAGGCCTTGAGGCAGCTGGG - Intronic
1026875593 7:73877329-73877351 TCAAAAGCACACAGGAAGCATGG - Intergenic
1028476633 7:91260957-91260979 ACACAGACACACAGGCAGTTAGG - Intergenic
1032316335 7:130842162-130842184 AGAAGGGCACACAGGCGGCTAGG - Intergenic
1033763865 7:144466046-144466068 GCGTAGGGACACAGGCAGCAGGG - Intronic
1033921727 7:146401393-146401415 GGAAAAGAACAAAGGCAGCTAGG + Intronic
1034268153 7:149791080-149791102 GCCAGGGCACAGAGGCAGCTGGG - Intergenic
1035073086 7:156159009-156159031 GCAACTGGACACAGTCAGCTTGG - Intergenic
1035393267 7:158519486-158519508 GCAAAGGCTCAAACACAGCTTGG - Intronic
1036046209 8:5143814-5143836 ACAAAGAGACACAAGCAGCTGGG + Intergenic
1037985567 8:23288686-23288708 GGGAGGGCACACAGGCGGCTCGG - Intronic
1039121726 8:34155570-34155592 GCCAAGGAACACAGGCTGCAGGG - Intergenic
1041289760 8:56297570-56297592 GCAAATGCACAGAAGGAGCTTGG + Intergenic
1041424356 8:57703486-57703508 CCAAGGGCACAGAGGCAGCAGGG + Intergenic
1041452624 8:58022929-58022951 TGAAAGACACACAGGCTGCTGGG - Intronic
1041803792 8:61827956-61827978 GGAAAGGCAGAAAGGCAGATGGG + Intergenic
1043025017 8:75055661-75055683 GCAAAGGCACCCATGTGGCTGGG + Intergenic
1044612761 8:94110542-94110564 GCAAAGACTCCCAAGCAGCTGGG - Intergenic
1044614830 8:94129252-94129274 GAAAAGGCACAGAGGCAGAAGGG + Intronic
1044725250 8:95189651-95189673 GCAACACCACACAGGCAGGTGGG - Intergenic
1045117447 8:98999011-98999033 GAAAATGCTCACAGGCACCTGGG + Intergenic
1045738997 8:105332105-105332127 GAACAGGAAGACAGGCAGCTTGG - Intronic
1046258370 8:111731469-111731491 ACAAAGGCAAACATCCAGCTTGG - Intergenic
1047742844 8:127820645-127820667 CCAAAGTCACACAGTCAGCAGGG - Intergenic
1048711710 8:137219246-137219268 GCAAAGGCACACAAGAAGAAAGG + Intergenic
1048889585 8:138935665-138935687 GCAAGGGATCACAGACAGCTAGG + Intergenic
1049205975 8:141363773-141363795 ACAGAGGCAGACAGGCTGCTGGG - Intronic
1049226033 8:141450924-141450946 CCAAGGTCACACAGCCAGCTTGG - Intergenic
1049394754 8:142394797-142394819 GGACAGGCACGCTGGCAGCTGGG - Intronic
1049426853 8:142541583-142541605 GCACAGGGACACAGGCAGAACGG - Intronic
1052879958 9:33595685-33595707 GAAAATGCACAGATGCAGCTTGG + Intergenic
1053209462 9:36215530-36215552 GCAAAAGCACAGAGGGACCTGGG + Exonic
1053496015 9:38548535-38548557 GAAAATGCACAGATGCAGCTTGG - Intronic
1054467119 9:65503950-65503972 GCAAAGTCACACACCCACCTTGG - Intergenic
1054652274 9:67634425-67634447 GCAAAGTCACACACCCACCTTGG - Intergenic
1056032162 9:82564317-82564339 GCAAAGGCTCAGAGGCAGGAGGG - Intergenic
1056586124 9:87928346-87928368 GAAAATGCACAGATGCAGCTTGG - Intergenic
1056610758 9:88124597-88124619 GAAAATGCACAGATGCAGCTTGG + Intergenic
1057675944 9:97136053-97136075 GAAAATGCACAGATGCAGCTTGG - Intergenic
1058476980 9:105345484-105345506 GCAATGGCACAAAGGAAGCATGG + Intronic
1059437328 9:114284593-114284615 TCAGAGCCACACAGCCAGCTGGG + Intronic
1059736794 9:117108712-117108734 GCAAGGTCACACAGCCAGTTTGG - Intronic
1059887978 9:118768249-118768271 GCAAAGGCACAGAGGCAGGAAGG - Intergenic
1061064661 9:128269891-128269913 GCAAAGATGCAAAGGCAGCTTGG - Intronic
1061385597 9:130287603-130287625 GCAAAGTAGCACAGGGAGCTGGG - Intronic
1061886731 9:133594858-133594880 GCAAAGGCCCAGAGGCAGGCAGG + Intergenic
1061980711 9:134101942-134101964 GGAAAGGCATACAGGGAGCCTGG + Intergenic
1203431033 Un_GL000195v1:91563-91585 GGAAAGGAGCACAGGCAGCAGGG + Intergenic
1186446218 X:9631421-9631443 GCAAAAGCACACAGGAACCGAGG - Intronic
1189316537 X:40060946-40060968 TCAAAGGGAGACTGGCAGCTGGG + Intronic
1190188772 X:48258106-48258128 GCAATGCCACAGAGACAGCTGGG - Intronic
1190755246 X:53395836-53395858 GCAAAGGAAGACAGAAAGCTAGG - Intronic
1192197054 X:69035395-69035417 GCAAAGGCCCAGAGGCAGGAGGG - Intergenic
1193179307 X:78434827-78434849 GCAAAGGCACAAAAGCAGGAAGG + Intergenic
1193338409 X:80317929-80317951 GCTAAGGCACAGAGGGAGGTGGG + Intergenic
1193447880 X:81627270-81627292 GAAATGCCAAACAGGCAGCTGGG - Intergenic
1193483785 X:82060437-82060459 GCACATTCACACAGGCAGCAGGG - Intergenic
1195859709 X:109370297-109370319 AGAAAGGCACACAGGAAGTTAGG - Intergenic
1195872663 X:109502060-109502082 GCAAAGTCTCCCAGGCACCTTGG + Intergenic
1196687449 X:118524084-118524106 GCAAGGGCAAACAGGCAGGGTGG - Intronic
1198120679 X:133589634-133589656 GCAAAGGCACACCAGCACTTTGG - Intronic
1199506463 X:148567413-148567435 GCAAAGCCACACAGGCATCAAGG + Intronic
1199758576 X:150887809-150887831 GAAGAGGCACACACGGAGCTAGG + Intronic
1202370307 Y:24191644-24191666 ACAAGGTCACACAGCCAGCTGGG + Intergenic
1202500477 Y:25478473-25478495 ACAAGGTCACACAGCCAGCTGGG - Intergenic