ID: 998018417

View in Genome Browser
Species Human (GRCh38)
Location 5:138751259-138751281
Sequence GGGGCTGGTGGGAGGCATTT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 2520
Summary {0: 1, 1: 5, 2: 74, 3: 646, 4: 1794}

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
998018417_998018431 17 Left 998018417 5:138751259-138751281 CCCAAATGCCTCCCACCAGCCCC 0: 1
1: 5
2: 74
3: 646
4: 1794
Right 998018431 5:138751299-138751321 TTACATTTCAATGTGAGATTTGG 0: 19
1: 209
2: 2373
3: 7950
4: 15262
998018417_998018434 23 Left 998018417 5:138751259-138751281 CCCAAATGCCTCCCACCAGCCCC 0: 1
1: 5
2: 74
3: 646
4: 1794
Right 998018434 5:138751305-138751327 TTCAATGTGAGATTTGGGCAGGG 0: 12
1: 98
2: 727
3: 3424
4: 13611
998018417_998018425 -7 Left 998018417 5:138751259-138751281 CCCAAATGCCTCCCACCAGCCCC 0: 1
1: 5
2: 74
3: 646
4: 1794
Right 998018425 5:138751275-138751297 CAGCCCCACCTCCAACACTGGGG 0: 8
1: 118
2: 1213
3: 2957
4: 3680
998018417_998018432 18 Left 998018417 5:138751259-138751281 CCCAAATGCCTCCCACCAGCCCC 0: 1
1: 5
2: 74
3: 646
4: 1794
Right 998018432 5:138751300-138751322 TACATTTCAATGTGAGATTTGGG No data
998018417_998018433 22 Left 998018417 5:138751259-138751281 CCCAAATGCCTCCCACCAGCCCC 0: 1
1: 5
2: 74
3: 646
4: 1794
Right 998018433 5:138751304-138751326 TTTCAATGTGAGATTTGGGCAGG 0: 8
1: 65
2: 372
3: 3191
4: 15267
998018417_998018424 -8 Left 998018417 5:138751259-138751281 CCCAAATGCCTCCCACCAGCCCC 0: 1
1: 5
2: 74
3: 646
4: 1794
Right 998018424 5:138751274-138751296 CCAGCCCCACCTCCAACACTGGG 0: 9
1: 109
2: 1073
3: 2912
4: 4064
998018417_998018422 -9 Left 998018417 5:138751259-138751281 CCCAAATGCCTCCCACCAGCCCC 0: 1
1: 5
2: 74
3: 646
4: 1794
Right 998018422 5:138751273-138751295 ACCAGCCCCACCTCCAACACTGG 0: 6
1: 59
2: 220
3: 1442
4: 3599

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
998018417 Original CRISPR GGGGCTGGTGGGAGGCATTT GGG (reversed) Intronic
Too many off-targets to display for this crispr