ID: 998019541 |
View in Genome Browser |
| Species | Human (GRCh38) |
| Location | 5:138757847-138757869 |
| Sequence | ATGAGGCAACAGTCAGATTA TGG |
| Strand | + |
| Crispr in exon? | No |
| Crispr in intron? | Yes |
| Off-Target Counts | All | Exonic | Intronic | Intergenic |
|---|---|---|---|---|
| Total | No data | |||
| Summary | No data |
Found 1 Related Crispr Pairs
Show Crispr Pairs| ID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
|---|---|---|---|---|---|---|---|---|
| 998019538_998019541 | 11 | Left | 998019538 | 5:138757813-138757835 | CCTGGAGTCTAGCTTGTGGATGG | 0: 1 1: 0 2: 1 3: 7 4: 95 |
||
| Right | 998019541 | 5:138757847-138757869 | ATGAGGCAACAGTCAGATTATGG | No data |
Note: the row highlighted in blue is the original CRISPR
| WGE ID | Location | Sequence | Mismatches | Strand | Type |
|---|---|---|---|---|---|
| 998019541 | Original CRISPR | ATGAGGCAACAGTCAGATTA TGG | Intronic | ||
| No off target data available for this crispr | |||||