ID: 998019541

View in Genome Browser
Species Human (GRCh38)
Location 5:138757847-138757869
Sequence ATGAGGCAACAGTCAGATTA TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
998019538_998019541 11 Left 998019538 5:138757813-138757835 CCTGGAGTCTAGCTTGTGGATGG 0: 1
1: 0
2: 1
3: 7
4: 95
Right 998019541 5:138757847-138757869 ATGAGGCAACAGTCAGATTATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
998019541 Original CRISPR ATGAGGCAACAGTCAGATTA TGG Intronic
No off target data available for this crispr