ID: 998020291

View in Genome Browser
Species Human (GRCh38)
Location 5:138764415-138764437
Sequence TGTGAGTTTGATCCCTTGGG AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
998020288_998020291 6 Left 998020288 5:138764386-138764408 CCATTTTGCAGAGAGGTAACTAA 0: 1
1: 0
2: 3
3: 54
4: 325
Right 998020291 5:138764415-138764437 TGTGAGTTTGATCCCTTGGGAGG No data
998020287_998020291 10 Left 998020287 5:138764382-138764404 CCTTCCATTTTGCAGAGAGGTAA 0: 1
1: 0
2: 4
3: 35
4: 281
Right 998020291 5:138764415-138764437 TGTGAGTTTGATCCCTTGGGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
998020291 Original CRISPR TGTGAGTTTGATCCCTTGGG AGG Intronic
No off target data available for this crispr