ID: 998026863

View in Genome Browser
Species Human (GRCh38)
Location 5:138824634-138824656
Sequence CCTTATAGGCTGCGACATCA GGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 38
Summary {0: 1, 1: 1, 2: 0, 3: 1, 4: 35}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
998026863_998026871 13 Left 998026863 5:138824634-138824656 CCCTGATGTCGCAGCCTATAAGG 0: 1
1: 1
2: 0
3: 1
4: 35
Right 998026871 5:138824670-138824692 GATATACAAGCAGCTGCAGCAGG 0: 2
1: 0
2: 1
3: 13
4: 148
998026863_998026873 23 Left 998026863 5:138824634-138824656 CCCTGATGTCGCAGCCTATAAGG 0: 1
1: 1
2: 0
3: 1
4: 35
Right 998026873 5:138824680-138824702 CAGCTGCAGCAGGCGGTCACAGG 0: 1
1: 0
2: 5
3: 19
4: 249
998026863_998026872 16 Left 998026863 5:138824634-138824656 CCCTGATGTCGCAGCCTATAAGG 0: 1
1: 1
2: 0
3: 1
4: 35
Right 998026872 5:138824673-138824695 ATACAAGCAGCTGCAGCAGGCGG 0: 1
1: 0
2: 1
3: 29
4: 315

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
998026863 Original CRISPR CCTTATAGGCTGCGACATCA GGG (reversed) Exonic
900527386 1:3135880-3135902 CTCTGTAGGCTGCGACAACAAGG - Intronic
907622678 1:55997392-55997414 CCTTATAGGCTGCTACACTTGGG + Intergenic
909155232 1:72066216-72066238 ACTTATCGGCTGAGAGATCATGG - Intronic
1064874764 10:19980738-19980760 CCTTATAGGATCAGAGATCAGGG + Intronic
1067128414 10:43540085-43540107 CCTTATAGGGAGAGACATCAGGG - Intergenic
1078576559 11:12507747-12507769 ACTAATATGCTGGGACATCAGGG + Intronic
1089067062 11:115670148-115670170 CCTTATAGCCAGCCACCTCAAGG - Intergenic
1103717322 12:122952504-122952526 CCCTCTAGGCTGCCACCTCATGG - Intronic
1126900467 15:53309326-53309348 CCTTATAGGCTGCATATTCAAGG + Intergenic
1130475000 15:84257070-84257092 CTATATAGACTACGACATCATGG - Intergenic
1130482415 15:84371123-84371145 CTATATAGACTACGACATCATGG - Intergenic
1132505661 16:307278-307300 CCTTGCAGGCTGCGTCACCACGG + Intronic
1135103020 16:19623383-19623405 CCTTATAGGAAGAGACAGCAAGG - Intronic
1135888995 16:26340362-26340384 CCCTATAGGCTGTGACTACATGG + Intergenic
1143394274 17:6579744-6579766 TCTTAGAGGCTGCTACATAAAGG - Exonic
1148519407 17:48256483-48256505 CCTTTTAGTCTGTGGCATCACGG + Intronic
1152379351 17:79934404-79934426 CCTTGGAGGCGGTGACATCAGGG + Exonic
925837051 2:7956328-7956350 CCTTATGAGCTGTGTCATCAGGG + Intergenic
927954708 2:27200477-27200499 CCTGATAGGCTGTGCCATCCAGG + Exonic
947679616 2:232018324-232018346 CCTTCTGGCCTGTGACATCATGG + Intronic
1168879238 20:1192616-1192638 CCTAATAGGCTTCCACTTCATGG - Intergenic
1170980298 20:21206291-21206313 CCTTCTGGGGTGTGACATCATGG + Intronic
1171346789 20:24471182-24471204 CGTGCTAGGCTGCGACCTCAAGG + Intronic
1172831726 20:37841453-37841475 CTTTATAAGCTGCAACATTAAGG + Intronic
1174572359 20:51511111-51511133 CCCTATAGGCTGTGACATGTGGG - Intronic
1178745770 21:35248829-35248851 CCTTACAGGCTCTGGCATCAAGG - Intronic
1179971795 21:44840182-44840204 CCTTGTAGGTTTGGACATCAGGG - Intergenic
955482535 3:59404186-59404208 CCTTATAGGCAGAGGCATGAGGG - Intergenic
962095474 3:132288194-132288216 ACTGATAGGCTGAGACAACAGGG + Intergenic
967996141 3:195168167-195168189 CCTTACAGTCTGCGACAGCTGGG - Intronic
995744720 5:115391666-115391688 CCTTATAGGCTGCAACATCAGGG + Intergenic
998026863 5:138824634-138824656 CCTTATAGGCTGCGACATCAGGG - Exonic
1011380929 6:86741400-86741422 CTTTATGGGATGCGTCATCATGG - Intergenic
1017688963 6:156944463-156944485 CCCTATATGCAACGACATCACGG - Intronic
1019954604 7:4403478-4403500 CCTTATAAGAAGAGACATCAGGG - Intergenic
1026534398 7:71228195-71228217 CCTGCTTGGCTGGGACATCAGGG - Intronic
1036033095 8:4993477-4993499 GCCTACAGGCTGCGACCTCAAGG - Intronic
1039922934 8:41905977-41905999 CCTGACAGGCTGCCACAGCAAGG - Intergenic