ID: 998030775

View in Genome Browser
Species Human (GRCh38)
Location 5:138865777-138865799
Sequence GATATAAAAAGATCAAAAGC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 540
Summary {0: 1, 1: 0, 2: 1, 3: 45, 4: 493}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
998030775 Original CRISPR GATATAAAAAGATCAAAAGC AGG (reversed) Intronic
900834603 1:4990765-4990787 TTTATATAAAGATCAATAGCAGG - Intergenic
901911296 1:12460543-12460565 AATATAAAAAGATGAAAATGAGG + Intronic
904967417 1:34386879-34386901 GAGAAAACAAGACCAAAAGCTGG + Intergenic
905555001 1:38875376-38875398 GTTTTAAAAAGATTAAAAGAGGG - Exonic
905962592 1:42057112-42057134 GATATAAATAAAACAAAACCGGG + Intergenic
906188650 1:43881305-43881327 AATATAAAAAGCTCAGAGGCTGG - Intronic
906403874 1:45525899-45525921 TAAAAAAAAAGAACAAAAGCCGG + Intergenic
906876906 1:49549237-49549259 AAGATACAAAGATAAAAAGCTGG - Intronic
907789781 1:57651101-57651123 GATACAAGAAGATGGAAAGCAGG + Intronic
907861756 1:58360496-58360518 CAGATAAAAAGATGAAAAGGCGG - Intronic
907882828 1:58567003-58567025 GGTATAAATAGACCATAAGCAGG - Intergenic
908609185 1:65837021-65837043 AATATAAACAGATCAACTGCTGG + Intronic
909573039 1:77139327-77139349 TAGATAAAAAGACCAATAGCAGG + Intronic
909936133 1:81553339-81553361 GATACTAAAAGTTCAAAAACCGG - Intronic
911779671 1:101860504-101860526 GATATCAAAAGAATAAAAGAGGG - Intronic
914514747 1:148364547-148364569 GGTATTTAAAGGTCAAAAGCAGG + Intergenic
914867874 1:151447784-151447806 GATCAAAACACATCAAAAGCTGG - Intronic
915226772 1:154417501-154417523 GAAATAAAGAGATTAAAAGCAGG - Intronic
915909573 1:159905421-159905443 GAAAAAAAAATATCAAAAGCTGG - Intergenic
916761200 1:167819537-167819559 AAAATAAAAAAATCATAAGCAGG - Intronic
916914900 1:169395695-169395717 AACATGAAAACATCAAAAGCAGG + Intronic
917148490 1:171919125-171919147 GATATAAAAATAAAAAGAGCTGG - Intronic
918115089 1:181489277-181489299 AATATAGAAAGATGAAAAGACGG - Intronic
918159896 1:181888733-181888755 GAAATATCAAAATCAAAAGCTGG + Intergenic
919046389 1:192457780-192457802 AAAATAAAAAGTTCAAGAGCTGG + Intergenic
921012194 1:211153039-211153061 GAAACAAAAAGTTAAAAAGCAGG + Intergenic
921474513 1:215590470-215590492 GATCTAGAAAGCTCAAAAGGAGG - Intronic
921499696 1:215886733-215886755 GATATTACAAAATCAAAAGAGGG + Intronic
923154288 1:231263575-231263597 TATATAAAAAAATGGAAAGCAGG - Intronic
923934247 1:238744191-238744213 GATGGTAAAAGATCTAAAGCTGG - Intergenic
923966889 1:239151621-239151643 GATAGAAAAATATTAGAAGCTGG + Intergenic
924824990 1:247530180-247530202 TATATAATAAAATCAAAAACAGG + Exonic
1063207238 10:3844891-3844913 GAGTTAAAAAAATCAAAAGAGGG - Intergenic
1063748451 10:8914106-8914128 AATTTAAAAAGATAATAAGCAGG - Intergenic
1065110083 10:22432296-22432318 GAAATTAAAAAATAAAAAGCAGG + Intronic
1065569963 10:27060344-27060366 GATGTACAAACATCCAAAGCAGG - Exonic
1065910850 10:30304252-30304274 TATATATAAGGATCAGAAGCTGG + Intergenic
1067058466 10:43065609-43065631 AATATAAAAACATCAGATGCAGG - Intergenic
1067415162 10:46097150-46097172 GAAACAAAAAGACCAAAGGCTGG + Intergenic
1067435196 10:46272199-46272221 GAAACAAAAAGACCAAAAGCTGG + Intergenic
1067438522 10:46295121-46295143 GAAACAAAAAGACCAAAGGCTGG - Intronic
1068220957 10:54044764-54044786 AATCTAAAAACATCAAAATCAGG + Intronic
1068239150 10:54282090-54282112 GATTTAAAAAGAATAAATGCAGG - Intronic
1068862290 10:61859777-61859799 GATATATAAAGTAAAAAAGCAGG - Intergenic
1069066174 10:63944083-63944105 GATATATAAAGTTCAAAAACAGG - Intergenic
1069424979 10:68280564-68280586 TGTATAAAAACATGAAAAGCTGG + Intergenic
1070354285 10:75624617-75624639 AATATAAAGAGGGCAAAAGCGGG + Intronic
1070897130 10:79994443-79994465 AATAAAAAAAGATGAACAGCTGG - Intergenic
1071070212 10:81682867-81682889 GATAGAAAAATAGCAAAAGAGGG + Intergenic
1071326327 10:84522309-84522331 TATATAAAAAGATTAAAAAATGG - Intergenic
1071401071 10:85271389-85271411 GATATAAAAACAGCAAAAAAGGG + Intergenic
1071946414 10:90650225-90650247 GATAAAAAGAGATCTAAAGATGG - Intergenic
1072492059 10:95917708-95917730 GAAACAAAAAGTTAAAAAGCAGG - Intronic
1072845351 10:98824158-98824180 CATATACAAAGTTCAAAACCAGG + Intronic
1072852206 10:98907805-98907827 GGTATAAAAGTATAAAAAGCAGG + Intronic
1074255202 10:111795043-111795065 GTTTTTAAAAGATCAAAATCAGG - Intergenic
1074348760 10:112714323-112714345 GCGATAAAAAGAACTAAAGCAGG - Intronic
1074730936 10:116374648-116374670 TATTTAAAAAGTCCAAAAGCAGG + Intronic
1075260305 10:120957910-120957932 AACATAAAAAGAGCTAAAGCTGG + Intergenic
1075932012 10:126306581-126306603 GATATTTAAAAACCAAAAGCAGG - Intronic
1077647840 11:3942001-3942023 TATATAAAATGATCAAAAATAGG + Intronic
1078039219 11:7842684-7842706 GTTTTAAAAATATCAAATGCTGG + Intergenic
1078083259 11:8218794-8218816 CAAATAAAAAGATCAATAACAGG - Intergenic
1078782161 11:14449478-14449500 GATATAAAAATCACAAAAGCTGG + Intronic
1081352250 11:42068335-42068357 CATATAAAAAAATCAAAAACAGG - Intergenic
1081456922 11:43232887-43232909 AAGATAGAAAGATCTAAAGCTGG - Intergenic
1081711203 11:45216782-45216804 GATAGAAAAAGACCAGAAGATGG + Intronic
1081877939 11:46423222-46423244 GATCTAAGCAGATCAACAGCTGG - Intronic
1082115550 11:48324490-48324512 GATATAAAACAAACTAAAGCAGG - Intergenic
1082258119 11:50054818-50054840 GATATAAAACAAACTAAAGCAGG + Intergenic
1082857876 11:57825275-57825297 GATAAAAAGAAATAAAAAGCCGG - Intergenic
1083061615 11:59878730-59878752 GGTATAAAAGTATCAAAAGCAGG + Intergenic
1083430149 11:62610117-62610139 GAAATGAAAAGGTCAATAGCGGG - Intronic
1083501801 11:63115707-63115729 CATATAAAAAAAACAAAACCGGG - Intronic
1085154964 11:74284971-74284993 GTTATAAAAAGAACCAAAGGAGG - Intronic
1085545320 11:77312664-77312686 TATATAATAACATCAAATGCAGG + Intergenic
1086165979 11:83778689-83778711 AATATAATAAGGACAAAAGCAGG - Intronic
1086251733 11:84823888-84823910 GATATAAAAATATAAAAAGGTGG + Intronic
1086342372 11:85859106-85859128 GTTAAAAAAAAATAAAAAGCAGG + Intronic
1086758930 11:90602937-90602959 GATAAAAACATATCAAAAACTGG - Intergenic
1087296211 11:96377270-96377292 GATATAAATACTTTAAAAGCAGG - Intronic
1087834064 11:102852779-102852801 GTTATAAACAGATAAGAAGCAGG - Intergenic
1088354985 11:108933547-108933569 ATTATAAAAAGATCAAAACTCGG - Intronic
1088978557 11:114839778-114839800 AAAATAAAAAAATAAAAAGCTGG - Intergenic
1089687096 11:120159632-120159654 GATAAAAAAATATCAAAAGCAGG - Intronic
1089922393 11:122221819-122221841 CATTTAAAAAGATAAAAATCCGG - Intergenic
1090921024 11:131205860-131205882 AATATAAAAAGAGGAAAAGGAGG - Intergenic
1091489269 12:918987-919009 CATATATAAAGTTCAAAAACAGG + Intronic
1091964152 12:4723848-4723870 GATTTAAAAAAATCAGAAGTCGG + Intronic
1092346219 12:7716793-7716815 GAGAAAAAAAGATCAAAATATGG - Intronic
1092621214 12:10271295-10271317 GAAATTAAAATATCAAAACCAGG + Intergenic
1093011557 12:14112298-14112320 GATATAAAGAAAACAAAAACGGG + Intergenic
1093787435 12:23208969-23208991 GATATAACAATATCCAAAACAGG - Intergenic
1093866251 12:24230383-24230405 GGTAGAAAAAGAAAAAAAGCTGG + Intergenic
1094399183 12:30042945-30042967 GATACAAATAGAGCAAGAGCAGG - Intergenic
1095766684 12:45903114-45903136 CATATAGAAAGTTCAAAATCAGG - Intronic
1095790117 12:46157644-46157666 GATACAGACAGATAAAAAGCAGG - Intergenic
1096425155 12:51495264-51495286 GATGTAAAAAGTTCCAGAGCTGG - Intronic
1097033622 12:56107265-56107287 GCTAAACAGAGATCAAAAGCAGG - Intronic
1097294593 12:57948860-57948882 CATGTATAAAGCTCAAAAGCAGG - Intronic
1097298457 12:57992521-57992543 CACATGAAAAGATGAAAAGCTGG - Intergenic
1098698600 12:73592691-73592713 GAAATAAAACGATCAAAGGTCGG - Intergenic
1099213014 12:79816445-79816467 GATAAAAAAAGATAAAAAAAAGG + Intronic
1099466384 12:82993281-82993303 GAAATAAATAAATAAAAAGCTGG - Intronic
1099615530 12:84929904-84929926 TATAGAAAAAGATGAAAAGATGG - Intergenic
1099807645 12:87540610-87540632 GAGGTAAAAAGAACAAAAACAGG - Intergenic
1100131012 12:91493473-91493495 GAAACAAAAAGGTCAAAAGTAGG + Intergenic
1100731661 12:97477577-97477599 GATAGAAAAAAATTAAAAACTGG + Intergenic
1103202537 12:119099992-119100014 GTCATCAAAAGATCAAAAGACGG - Intronic
1104257509 12:127153157-127153179 GAGATAAAAGAATCAAAAGAGGG + Intergenic
1104548149 12:129731357-129731379 GCTGTAAAAAGAGAAAAAGCAGG + Intronic
1104583165 12:130025846-130025868 AATTTAAAAAATTCAAAAGCTGG + Intergenic
1105729577 13:23199714-23199736 GATATAAAAAGAATTACAGCTGG + Intronic
1105784955 13:23739353-23739375 TATTTAAAAAGTTAAAAAGCAGG + Intronic
1106089556 13:26577722-26577744 GAAAAAAAAAAATCAAAACCAGG + Intronic
1106587564 13:31070467-31070489 GATTTTAAAAGATAAAAAGAAGG - Intergenic
1107041000 13:35947330-35947352 GAAAAAAAAAGTTCAAAACCAGG - Intronic
1107452507 13:40522898-40522920 GATATATTAAGATAAAAATCTGG + Intergenic
1107626463 13:42290902-42290924 GATATTTACAGACCAAAAGCTGG + Intronic
1107953041 13:45483116-45483138 AATATATAAAGTTCAAAAACAGG - Intronic
1108204527 13:48074341-48074363 GTTATACCAAGATCAAAAACTGG + Intronic
1108680691 13:52777786-52777808 AAAATAAAAAAATAAAAAGCTGG + Intergenic
1108802128 13:54111646-54111668 CATATAAAAACATCACATGCTGG + Intergenic
1110453524 13:75664080-75664102 GTTACAAAAAAATCAAAAGAAGG - Intronic
1110484917 13:76027509-76027531 AATATAAACAGATAAAAAGAAGG - Intergenic
1110636367 13:77770954-77770976 AATATATAAAGATCAAATCCAGG - Intergenic
1111459942 13:88525984-88526006 TATTTAAAAACATCAAAAGAAGG - Intergenic
1112039040 13:95527427-95527449 GATATAGAAAAAACAAAAACAGG + Intronic
1112932349 13:104757514-104757536 TATATGTAAAGGTCAAAAGCTGG - Intergenic
1112985910 13:105449578-105449600 AATAGAGAAAGTTCAAAAGCCGG - Intergenic
1113128234 13:107004728-107004750 GATATAGAAAGAGTAAAACCAGG + Intergenic
1114411397 14:22504075-22504097 GAAATAAAAACATCAAATGTGGG + Intergenic
1115436074 14:33375584-33375606 GCTATAAAACAATCAAAAGTAGG + Intronic
1115812092 14:37120712-37120734 GAAATAAAAACATCCAGAGCTGG + Intronic
1115921802 14:38382602-38382624 GACATAAGAAGAGAAAAAGCAGG + Intergenic
1116063384 14:39952112-39952134 CATATAAAATGGGCAAAAGCTGG + Intergenic
1116510453 14:45739068-45739090 GATAAAAAAATAACAAATGCTGG - Intergenic
1116561220 14:46381757-46381779 GCTATTAAAAGATGAATAGCAGG - Intergenic
1117109717 14:52438782-52438804 GTTATAAAAAGAAAACAAGCTGG + Intronic
1117110551 14:52448765-52448787 GCAATAAAAAGTTAAAAAGCAGG + Intronic
1117201996 14:53399948-53399970 GATAAAAAATAAACAAAAGCAGG - Intergenic
1117372482 14:55091281-55091303 TATATATAAAGTTCAAAAGCAGG + Intergenic
1117481019 14:56144982-56145004 GTTAGAAAAAGACCAAAAGGTGG + Intronic
1118191627 14:63585934-63585956 CATTTAAAAAGATGAAAAGGTGG - Intergenic
1118506352 14:66416676-66416698 GATATACAATGTTCATAAGCTGG + Intergenic
1118909604 14:70050213-70050235 GAGCTAGAAAGATCTAAAGCAGG + Intronic
1119267934 14:73275825-73275847 GAAATAAAAAGAGGAAAGGCTGG - Exonic
1120184680 14:81382429-81382451 TATATATAAAGTTCAAAACCAGG + Intronic
1120457056 14:84744990-84745012 GATCTAAACAGATCAATTGCAGG + Intergenic
1120597165 14:86454902-86454924 GAAGAAAAAAGATCAAGAGCTGG + Intergenic
1120797408 14:88649515-88649537 CATTTAAAAAGATGAAAAGAGGG - Intronic
1120837575 14:89055285-89055307 TATTAAAAAAGAGCAAAAGCTGG + Intergenic
1122449280 14:101791628-101791650 GAAATTAAAAGCTCAAAAGAAGG - Intronic
1123146307 14:106133911-106133933 AATATATAAAGAGGAAAAGCTGG + Intergenic
1123917207 15:25043663-25043685 AAAATAAAAATATCAAAAGCTGG - Intergenic
1124045369 15:26144647-26144669 TTTATAAAAAGTTCAAAAGCAGG - Intergenic
1125158993 15:36622137-36622159 CAATGAAAAAGATCAAAAGCAGG - Intronic
1125307477 15:38336031-38336053 GCCATAAAAAGATAAAAAGTTGG - Intronic
1125565475 15:40675269-40675291 GAAACAAAAAGTTAAAAAGCAGG - Intergenic
1126154739 15:45555311-45555333 GATGCAAGAAGATCTAAAGCTGG - Intergenic
1126538108 15:49790524-49790546 GAAATAAAAAGAACAATATCTGG - Intergenic
1126925784 15:53584958-53584980 GAAAGAAAAAGGGCAAAAGCAGG + Intronic
1127521337 15:59745958-59745980 TAAATAAAAAGATAAAAATCTGG - Intergenic
1127598997 15:60516384-60516406 GCAATAAAAAGATAAAAAGGTGG - Intronic
1127887080 15:63211049-63211071 AATATCAAAAGATAAACAGCAGG + Intronic
1128097295 15:64967281-64967303 AATAAAAAAAAATTAAAAGCAGG + Intronic
1128171941 15:65520907-65520929 GATATAAAAAAATAATAGGCTGG - Intergenic
1128194581 15:65740662-65740684 GATCTAAAAATATCAAAGGCCGG + Intronic
1129283447 15:74504238-74504260 TATATGAAAAGCTCAAAAGCAGG - Intergenic
1129581150 15:76812015-76812037 TATAGAAAAACATCAATAGCCGG + Intronic
1129645946 15:77432761-77432783 GAAATAACAAGACCAAAAGTTGG + Intronic
1129963064 15:79706369-79706391 GATAAAAAAATAACAAAAGATGG - Intergenic
1130005303 15:80090761-80090783 TATATAAAAAGACAAATAGCAGG + Intronic
1130239477 15:82173580-82173602 GAAATAAAAAGATAAAAACCAGG - Intronic
1130419396 15:83728660-83728682 GAAACAAAAAGTTTAAAAGCAGG - Intronic
1131375981 15:91923746-91923768 GATATACAAAGAAAAAAGGCTGG - Intronic
1131982160 15:98004718-98004740 GAAAAAAAAAGAAGAAAAGCTGG - Intergenic
1132193058 15:99885910-99885932 GAAATAAAAAAAACAAAGGCAGG - Intergenic
1132835008 16:1948522-1948544 AATATAAAAAAATAAAAATCAGG - Intronic
1133183669 16:4079156-4079178 GATATACAATGATTCAAAGCTGG + Intronic
1133382004 16:5338887-5338909 AATATAAAAAGAAAGAAAGCAGG - Intergenic
1133703382 16:8330547-8330569 GAAATAAAAAGATAAAAATGAGG - Intergenic
1136869607 16:33793598-33793620 AATAAATAAATATCAAAAGCTGG + Intergenic
1136888107 16:33946247-33946269 GAAAGAAAAAAAACAAAAGCAGG + Intergenic
1137870457 16:51945300-51945322 ACTGTAAAATGATCAAAAGCAGG - Intergenic
1138685479 16:58721546-58721568 GATGTAAAATGAACATAAGCAGG + Intronic
1138749590 16:59402522-59402544 GATATCAAAAGCTCTAAAGTGGG - Intergenic
1141320188 16:83001079-83001101 CACATAAACAGATTAAAAGCAGG - Intronic
1141979072 16:87538518-87538540 GATTTAAAAAGAAAAAAAGCAGG - Intergenic
1203084342 16_KI270728v1_random:1171590-1171612 GAAAGAAAAAAAACAAAAGCAGG - Intergenic
1203102565 16_KI270728v1_random:1322457-1322479 AATAAATAAATATCAAAAGCTGG - Intergenic
1144324240 17:14162618-14162640 GATAAAAAAAAAAAAAAAGCAGG - Intronic
1145874943 17:28311105-28311127 GAAATAAAAAATTCATAAGCTGG + Intergenic
1145925977 17:28646953-28646975 GAAAAAAAAAGAACAAAACCCGG + Intergenic
1149326118 17:55531339-55531361 GATACAAAAACTTCAAAAGAAGG - Intergenic
1150525863 17:65921590-65921612 GATATAGAAAGAATAAAAACAGG + Intronic
1151111414 17:71682526-71682548 GGTATGAGAAGTTCAAAAGCAGG - Intergenic
1151865644 17:76800344-76800366 GAGGTAAAAAGTCCAAAAGCTGG + Intergenic
1152165989 17:78706554-78706576 TATATAAAATAACCAAAAGCTGG - Intronic
1152248435 17:79198606-79198628 GAGAGAGAAAGTTCAAAAGCAGG - Intronic
1153196671 18:2606459-2606481 GAAAGAAGAAGTTCAAAAGCTGG + Exonic
1155097978 18:22578230-22578252 TATATATAAAGTTCAAAAACAGG - Intergenic
1156165493 18:34415224-34415246 GATAAGAAAAGTTAAAAAGCAGG + Intergenic
1157778154 18:50413100-50413122 GATCCAAAAAGGTCTAAAGCAGG - Intergenic
1158986240 18:62820185-62820207 AGTATAAATAAATCAAAAGCTGG + Intronic
1159583261 18:70257638-70257660 GATGTAAAAATTTTAAAAGCAGG - Intergenic
1159691012 18:71487320-71487342 GACATGAACAGATGAAAAGCAGG + Intergenic
1162277973 19:9673400-9673422 GAGATAAAAAAATAAAACGCTGG - Intronic
1162702239 19:12525327-12525349 AAAATAAAAAGATTGAAAGCAGG - Intronic
1163738533 19:18996545-18996567 AAAAAAAAAACATCAAAAGCTGG - Intronic
1164924857 19:32122567-32122589 GATATAAAAAGTTCAATAAAAGG + Intergenic
1165260402 19:34611269-34611291 GAGATCAAAAAATGAAAAGCTGG - Intronic
1166082616 19:40453693-40453715 GATATAAATTGTTCAAAGGCTGG + Intronic
1167401016 19:49269206-49269228 GATTCAAATAGATCAAAGGCCGG - Intergenic
925992887 2:9268092-9268114 AGTATAAAAAGTTCAAAAACAGG - Intronic
927359265 2:22213272-22213294 GAAATAAAGACATCAAAATCGGG - Intergenic
928787535 2:34907528-34907550 GATTTAAAAAGAACAAGATCTGG - Intergenic
928908283 2:36391426-36391448 GTTCTAAAAAAATCAAAAGTGGG - Intronic
929203651 2:39265405-39265427 CATAAAACAAAATCAAAAGCTGG + Intronic
929740917 2:44598773-44598795 GATATAAGAAAATGAAAAGAAGG + Intronic
931683554 2:64772510-64772532 GAAATAAATAGGTCAAGAGCTGG + Intergenic
932066961 2:68573918-68573940 AATAAAAACAGATAAAAAGCCGG + Intronic
932768612 2:74487512-74487534 AATTTAAAAAAATAAAAAGCCGG - Intronic
932954982 2:76341208-76341230 GTTATTAGAAGATCATAAGCAGG + Intergenic
933726085 2:85428109-85428131 GCGATAAAAAGATAAAAAGGAGG - Intronic
935170271 2:100605869-100605891 GATATCAAAATAGCAAATGCAGG - Intergenic
935376523 2:102404576-102404598 GATAAAAAAATAACAAATGCTGG - Intergenic
935393060 2:102574045-102574067 GATATAAAAATAACAAATGCTGG - Intergenic
935935494 2:108177939-108177961 TATAAAAAAAGATGGAAAGCAGG - Intergenic
936380514 2:111981323-111981345 GATATAAAAAAATCCAATGGGGG - Intronic
936816407 2:116466378-116466400 TATATAAAAATATCAATAGTTGG - Intergenic
937109529 2:119353025-119353047 GATATAAAAGGAGAAAGAGCAGG + Intronic
938951517 2:136259014-136259036 GAGATAGGAAGATCAAAAGAAGG - Intergenic
939233271 2:139458671-139458693 GATATTAAAAGGTTAAAAGGTGG + Intergenic
940208628 2:151233536-151233558 AGTATTAAAAGGTCAAAAGCCGG + Intergenic
940282848 2:152005338-152005360 GTCATAAAAAGAACAAAATCAGG + Intronic
940423720 2:153508310-153508332 GATAGAAAAAGATCACCAGGTGG + Intergenic
940724231 2:157316466-157316488 GAAATAAAAAGTTAAAAAGTTGG + Intergenic
940795648 2:158074403-158074425 AAAATAAAAAGTTAAAAAGCTGG + Intronic
941415017 2:165209219-165209241 GATATATACAGATCAAATCCTGG - Intergenic
941828820 2:169930802-169930824 AATATAAAACCAACAAAAGCTGG + Intronic
942638922 2:178039870-178039892 TTTATACAAAGTTCAAAAGCAGG + Intronic
942677467 2:178443546-178443568 GGTATAAAAATATAAAATGCGGG - Intronic
943241890 2:185395817-185395839 GGAATAAATAGATCAAAATCAGG - Intergenic
943838103 2:192541151-192541173 GATATAAGAAAATCCAGAGCAGG - Intergenic
943895361 2:193350780-193350802 GATCTATAAAGGTTAAAAGCAGG + Intergenic
944258538 2:197650778-197650800 TATTTAAAATAATCAAAAGCAGG - Intronic
944514191 2:200495232-200495254 GATAAGAAATGATGAAAAGCAGG - Intronic
944579825 2:201122623-201122645 GATAGAATAAGATAAAATGCTGG + Intronic
944879319 2:203995240-203995262 GAAATGAAAGGATCAAAAGAGGG + Intergenic
945155476 2:206833199-206833221 GCAATAAAAAGGTCAAAAGTAGG - Intergenic
945922870 2:215773776-215773798 GAAATAAAAGGATCACACGCAGG + Intergenic
946672465 2:222120587-222120609 TATACAAAAAGTTCAAAACCAGG - Intergenic
946940856 2:224769053-224769075 GAAATAAAAAGAACAAATGATGG - Intronic
947165738 2:227260029-227260051 GAAATAAAAATATGAAGAGCAGG - Intronic
947449326 2:230192177-230192199 CATATAAAATGGGCAAAAGCTGG + Intronic
948351065 2:237341243-237341265 GATCACATAAGATCAAAAGCGGG + Intronic
949017933 2:241724017-241724039 TAAATAAAAAGATAAAAACCTGG + Intronic
1168796451 20:612840-612862 GCTATAAAAAGAAATAAAGCAGG - Intergenic
1169248290 20:4041365-4041387 GAAATTAAGAGATCAATAGCGGG - Intergenic
1169441060 20:5634296-5634318 GATCGAAAATGATCTAAAGCAGG + Intergenic
1170261402 20:14412277-14412299 GAAATATCAAGATAAAAAGCTGG - Intronic
1170452173 20:16494851-16494873 GATAAAAAAAGAAAAAAAGGTGG + Intronic
1170581143 20:17700535-17700557 GATTTAAAAACAGCCAAAGCAGG - Intronic
1172373906 20:34419879-34419901 GATATAAAAATCTTAAAACCCGG - Intronic
1172508548 20:35482533-35482555 AATATAAAAAAATAAATAGCCGG - Intronic
1176944637 21:14964679-14964701 GTTTTAAAAAGATCCAAAACTGG + Exonic
1176999826 21:15598477-15598499 AATAAAAAAAGATAAATAGCTGG + Intergenic
1177105928 21:16955501-16955523 GATAGAAAAATATTAAAATCTGG + Intergenic
1177287339 21:19069194-19069216 AATAAAAAAAGATAAATAGCTGG + Intergenic
1177426249 21:20926111-20926133 CATATAGAATGAGCAAAAGCTGG + Intergenic
1178241343 21:30904503-30904525 TTCATAAAAAGATGAAAAGCAGG - Intergenic
1178726924 21:35061493-35061515 GATATAAAAAGGTCAAGAGTGGG + Intronic
1179050663 21:37886209-37886231 GATAACAAAAGATCAAGAGTTGG - Intronic
1179609066 21:42537415-42537437 GGTATAAAAAGACCCAAAGTGGG + Intronic
1180781007 22:18519560-18519582 AAAATAAAAACATAAAAAGCTGG - Intergenic
1181237895 22:21458910-21458932 AAAATAAAAAAATAAAAAGCTGG - Intergenic
1181664051 22:24378639-24378661 GATATAAAAATATTAAAATTAGG - Intronic
1183749871 22:39713761-39713783 GAAATAAAAAGGGCAAAAGCAGG - Intergenic
949921741 3:9008507-9008529 GAAATAAAAAGAGCAACAGATGG + Intronic
950058093 3:10044581-10044603 CATCTCAAAAGATAAAAAGCCGG + Intronic
950878772 3:16304377-16304399 GAAATAAAAAGTAGAAAAGCAGG - Exonic
951810486 3:26693343-26693365 AAAAAAAAAAGATCAAGAGCAGG + Intronic
951954093 3:28235188-28235210 TTTATATAAAGATCAAAAACAGG + Intergenic
953297219 3:41731682-41731704 AAAAAAAAAAGAACAAAAGCTGG + Intronic
953592354 3:44270918-44270940 TTTATATAAAGAACAAAAGCAGG - Intronic
953598460 3:44339161-44339183 CAAAGAAAAAGAGCAAAAGCAGG - Intronic
955757449 3:62239793-62239815 GGAATAAAAAAAGCAAAAGCAGG - Intronic
956821815 3:72960645-72960667 GAAATAGGAAGATCAAATGCAGG - Intronic
957426328 3:80044583-80044605 GGGATAAAAAGATAAAAAGTGGG - Intergenic
958540023 3:95458908-95458930 GATATATCAAGATCAAGACCAGG - Intergenic
959122619 3:102250832-102250854 GATTGAAAAATACCAAAAGCTGG - Intronic
959219363 3:103496645-103496667 CATACAAGAAGATCTAAAGCTGG - Intergenic
959230525 3:103645276-103645298 GATTTAAAATGATTAAAAACAGG - Intergenic
959467993 3:106713783-106713805 GTCATAAAAAAATCAAAAGCAGG + Intergenic
959633866 3:108539261-108539283 TATATATAAAGCTCAAAAGCAGG + Intergenic
959698151 3:109271876-109271898 GAGAGAAAAAGATAAAATGCAGG + Intergenic
960851283 3:122057611-122057633 GATTTAAAAAAAACAATAGCTGG + Intronic
960871358 3:122253020-122253042 GTTTTACAAAGATCAACAGCTGG - Intronic
960933050 3:122874044-122874066 TATTTAAAAAGAACAACAGCAGG + Intronic
962038504 3:131680480-131680502 GAAACAAAAAGTTAAAAAGCTGG - Intronic
962309798 3:134317331-134317353 GACAGAAAAAGTTCATAAGCTGG - Intergenic
963895918 3:150684766-150684788 GAAAGAAAAAGAACAAAACCTGG - Intronic
964068969 3:152609122-152609144 TAAATACATAGATCAAAAGCAGG - Intergenic
964607817 3:158576627-158576649 GAGATAGAAAGCTCAGAAGCAGG + Intronic
964709227 3:159654046-159654068 TATTTAAAAAGATAAAAAGCAGG - Intronic
964987641 3:162764233-162764255 TATTTAAAAAGATAAAAAGGTGG + Intergenic
965387435 3:168061715-168061737 TTTATAAAAAGTTCAAAAACAGG + Intronic
966284537 3:178278516-178278538 GATATAAAAATATAAAACTCAGG + Intergenic
966305006 3:178521708-178521730 GATATAAAGAGTTCAAATGAAGG + Intronic
966662726 3:182432265-182432287 GATATAAAATTAAGAAAAGCAGG + Intergenic
967428040 3:189350179-189350201 GGTTTAAAAGGATCAGAAGCTGG + Intergenic
967516495 3:190375416-190375438 GATGAAAAAAGATCACATGCTGG + Intronic
968113566 3:196070631-196070653 AATTTAAAAAGATCAAGGGCTGG + Intronic
968681514 4:1924069-1924091 GATATAAAATGATACAAAGCAGG + Intronic
970020727 4:11565205-11565227 GACATAATAATATCAAAATCAGG + Intergenic
970574355 4:17412845-17412867 GATATAAATAGATATAAAACTGG + Intergenic
971614734 4:28773948-28773970 GAAGGAAAAAAATCAAAAGCAGG - Intergenic
972063275 4:34908826-34908848 AAAATAAAAATATAAAAAGCAGG + Intergenic
972985491 4:44758717-44758739 GAAATAAAAACATCAAAAGTGGG + Intergenic
973082227 4:46007978-46008000 GATATAAAAAAATGAAAAAAGGG - Intergenic
973590832 4:52439353-52439375 AATATTAAAATATTAAAAGCAGG - Intergenic
973971820 4:56220612-56220634 AAAAAAAAAAAATCAAAAGCCGG - Intronic
974282587 4:59817921-59817943 TATATAAAAAGGAAAAAAGCAGG - Intergenic
974408333 4:61505614-61505636 GATATAAAAATATAAAAAAGAGG - Intronic
974582765 4:63827153-63827175 GATATAGAAAAATCAAAATTAGG - Intergenic
974711333 4:65600158-65600180 GTAATTAAAGGATCAAAAGCAGG - Intronic
974881118 4:67758622-67758644 TATATAAAAAGATTTAAACCAGG + Intergenic
975749823 4:77511337-77511359 GATATAAATAGATTAATAGTTGG - Intergenic
977438241 4:97028525-97028547 GTTATAAAAAGGCCAAAACCTGG + Intergenic
978948817 4:114531372-114531394 GAAATAAAAAGATCAAAGCAGGG + Intergenic
979132730 4:117068837-117068859 GCTATAAAAAGATAAAAGGCAGG + Intergenic
979444643 4:120797215-120797237 CAGATAAAAGGATAAAAAGCTGG + Intronic
980203349 4:129684988-129685010 CATAAAAAAAGAACAAAATCTGG + Intergenic
980771845 4:137383664-137383686 GAAATAAAAACATCCAAAGTGGG - Intergenic
980847406 4:138340832-138340854 CATAACAAAATATCAAAAGCTGG + Intergenic
981063730 4:140458503-140458525 GACGTAAAAAAATTAAAAGCAGG + Intronic
981452068 4:144910195-144910217 CATATAAAAAGGTAAAAAGGAGG - Intergenic
981831190 4:149004110-149004132 AATATTAAAAGATCAATAACAGG + Intergenic
982624744 4:157752483-157752505 GTAATAAAAAGATCAAAGTCTGG + Intergenic
983102218 4:163638668-163638690 TATCCAAAAGGATCAAAAGCAGG + Intronic
983284230 4:165719047-165719069 GAAATAAAAACATCCAAAGATGG - Intergenic
983870637 4:172821605-172821627 GTTATAAACAGACCAGAAGCTGG - Intronic
984025192 4:174534905-174534927 AAAAGAAAAAGATAAAAAGCAGG + Intergenic
984096764 4:175444462-175444484 GATAAAAAAAGATCATGAGGAGG + Intergenic
984099423 4:175467250-175467272 GACAAAAAAAGATCCATAGCTGG - Intergenic
989623890 5:43411474-43411496 GAAAGAAAAAGAAGAAAAGCAGG - Intronic
989715497 5:44457981-44458003 GAAAAAAAAAGTTAAAAAGCAGG + Intergenic
990683698 5:58276146-58276168 AATATAAAAAGTTCAAAATTAGG + Intergenic
990737223 5:58877523-58877545 TCTTTAAAAAGATCTAAAGCTGG - Intergenic
990829872 5:59944269-59944291 GATGGAAAAGTATCAAAAGCTGG - Intronic
991158204 5:63463246-63463268 TATATAAAATGGGCAAAAGCTGG + Intergenic
991380414 5:66016909-66016931 GCTAAAAAAAGATCCCAAGCCGG - Intronic
991623631 5:68573528-68573550 GATATAAAAAGACAAAAGGAGGG - Intergenic
992878157 5:81078182-81078204 GATGTAAAATGATCAAATGTGGG + Intronic
993301045 5:86210575-86210597 GAAAAAAAAAGATAAAAGGCTGG - Intergenic
993434206 5:87871525-87871547 GATTCAAAAAGATCAAAATCTGG + Intergenic
993441850 5:87966642-87966664 TTTATATAAAGATCAAAAACAGG - Intergenic
993729740 5:91408245-91408267 GATGTATAAAGATTAAAAGTAGG - Intergenic
993730220 5:91413344-91413366 AATATAAAAAGATGGAAATCTGG + Intergenic
993854205 5:93052605-93052627 AATATATAAAGATGAATAGCAGG - Intergenic
993865726 5:93192708-93192730 CATAGAAAAAGATCATAAACAGG + Intergenic
993880397 5:93353833-93353855 GATATAAAAAGATCTGGAGCGGG + Intergenic
994060219 5:95467573-95467595 GATATTAGAACATCAAAAGCTGG - Intronic
994262421 5:97675679-97675701 CATACTAAAAGAGCAAAAGCTGG + Intergenic
994725532 5:103430852-103430874 AATATAAAAGGATCAGAAGAGGG + Intergenic
994900620 5:105764349-105764371 GATATAAAGGGCTCAGAAGCAGG - Intergenic
995018474 5:107340717-107340739 AATGAAAAATGATCAAAAGCTGG - Intergenic
995044547 5:107630494-107630516 GTTATAAAAAGATTAAAAAATGG + Intronic
995151150 5:108846956-108846978 GAAGAAAAAAGACCAAAAGCTGG - Intronic
995579206 5:113576623-113576645 GAAATAAAAAGAGCAAATGAAGG - Intronic
995587451 5:113662762-113662784 TACATAAAAAGATCACATGCAGG + Intergenic
995593695 5:113726349-113726371 AATATAAAATGGTCAAAAGCTGG - Intergenic
996490532 5:124089476-124089498 TATATAAACAGATAAAAAGCTGG + Intergenic
996634359 5:125672227-125672249 AATATAAAAAGTTCAAAACCAGG - Intergenic
996986032 5:129565704-129565726 GATAGAAAAAGATAAAATGTTGG - Intronic
997927267 5:138042269-138042291 GTTAAAAACAGTTCAAAAGCAGG + Intronic
998030775 5:138865777-138865799 GATATAAAAAGATCAAAAGCAGG - Intronic
998570538 5:143252977-143252999 TTTATATAAAGTTCAAAAGCAGG - Intergenic
999469147 5:151835852-151835874 CATATAGAATGAGCAAAAGCTGG + Intronic
1000540427 5:162532269-162532291 AATAAAAAAAGAGAAAAAGCAGG + Intergenic
1000761238 5:165227348-165227370 GATACAATCAGATCAACAGCTGG - Intergenic
1001169030 5:169399906-169399928 CATATAAAAAGAAGAAAAACAGG + Intergenic
1001554673 5:172628345-172628367 AATATAAAATGAGCAAAACCAGG - Intergenic
1003310901 6:4969093-4969115 CATATAAAATAATCAAAAGCAGG + Intergenic
1003889102 6:10548097-10548119 GGTATTTAAAGATCAAAATCTGG + Intronic
1004879956 6:19997487-19997509 GATCCAGAAGGATCAAAAGCAGG + Intergenic
1005116572 6:22345051-22345073 GAGGTAGAAAAATCAAAAGCTGG - Intergenic
1005653735 6:27910280-27910302 CATTTTAAAAGGTCAAAAGCAGG + Intergenic
1005980637 6:30833945-30833967 CATGTAAAAAGTTCAAAATCAGG + Intergenic
1006205133 6:32334250-32334272 AATTTAAAAAGAACAAAAGTAGG - Intronic
1006557617 6:34881996-34882018 AATATAAATAGATAAAAAGAAGG - Intronic
1006606942 6:35264580-35264602 ATTATAAAAAGATTAAAGGCAGG + Intronic
1007152100 6:39703904-39703926 GATATAGAAAGAACACAAGTAGG - Intronic
1007366636 6:41398674-41398696 CATATACAAAGATCTAAAGATGG - Intergenic
1008155702 6:48011409-48011431 GAAAAAAAAACATCAAAAGGTGG - Intronic
1008312429 6:49992444-49992466 GACACAAAAAAATAAAAAGCAGG + Intergenic
1008747408 6:54689464-54689486 GAAATAAAAAAATCAAAAGTGGG + Intergenic
1009049667 6:58261728-58261750 GATATAAAAAAGTCACAAGTGGG + Intergenic
1009245651 6:61233800-61233822 ACTATAAAAAGTTAAAAAGCAGG + Intergenic
1009914853 6:69982111-69982133 GATATAGAAAGAAAAAAAGAGGG + Intronic
1010336318 6:74687935-74687957 GATAGAAAAGGATGAAAAACAGG + Intergenic
1010678423 6:78770730-78770752 GATAGGAAAAGATAAAAGGCAGG - Intergenic
1011017681 6:82775721-82775743 TTTATAAAAAGGTCAAAAGAAGG + Intergenic
1012212370 6:96536666-96536688 AATGTAAAAAGACTAAAAGCTGG + Intronic
1012789191 6:103671930-103671952 GAAATAAGGAGATCAAAAGTGGG - Intergenic
1012896674 6:104957094-104957116 GAGAGAAAAAAATCAAAAGAAGG + Exonic
1013395053 6:109727453-109727475 TATGTAAAAAGATCAAATGTTGG + Intronic
1013500548 6:110745343-110745365 GATATATAAAGACCAAAACAGGG + Intronic
1014824177 6:126029507-126029529 TTTATACAAAGATCAAAACCAGG - Intronic
1014833492 6:126130219-126130241 GATATGAAGAGAACAACAGCGGG + Intergenic
1015246348 6:131079073-131079095 TATATATAAAGCACAAAAGCAGG + Intergenic
1016605344 6:145916025-145916047 GATAGAAAAAGAACAAAATAGGG - Intronic
1016749050 6:147612620-147612642 AATAAAAAAAGTTCAAGAGCAGG - Intronic
1016912418 6:149212231-149212253 GTTAAAAAAAAATTAAAAGCCGG + Intergenic
1017459938 6:154639493-154639515 GTTATATAACGTTCAAAAGCAGG - Intergenic
1017512187 6:155124319-155124341 GAAAAAAAAAGTTCAAAACCTGG - Intronic
1018258493 6:161945877-161945899 GATATAAAAATAGTAAAAGAAGG - Intronic
1018562253 6:165113586-165113608 GAGATAAAAAGAAGAAAAGCTGG - Intergenic
1018819403 6:167361826-167361848 GATATTAAAAGAACAAATGGAGG - Intronic
1019688434 7:2395659-2395681 GATATACATAGATCGATAGCTGG + Intergenic
1019808071 7:3143400-3143422 AATATAAAAACATGAAATGCTGG + Intronic
1019889369 7:3933814-3933836 GATATGAAAAAATAAAAAGGGGG + Intronic
1020345401 7:7156884-7156906 GAGAGAAAAAGATCAAACACTGG - Intergenic
1020574631 7:9911087-9911109 AAAATAAAAAGTTAAAAAGCAGG - Intergenic
1020852773 7:13377898-13377920 GAAATAAAGAGAGCAGAAGCAGG + Intergenic
1021364210 7:19756181-19756203 TACATTAAAAGATCAAAAGGGGG + Intronic
1021630614 7:22642306-22642328 GAGATAAAAATATCCAAACCAGG - Intergenic
1022541761 7:31143937-31143959 GCAATAAAAAGATTAAAAGTGGG - Intergenic
1022721694 7:32947186-32947208 AATATAAAAATATAAAAAGAGGG - Intergenic
1023687378 7:42750226-42750248 GGTAGAAAAAGAGCAAAAGAAGG - Intergenic
1024561702 7:50650138-50650160 GAGATGAAGAGATCACAAGCTGG + Intronic
1024802932 7:53101823-53101845 AATTTAAAAAAATCAAAAACTGG + Intergenic
1025710346 7:63901980-63902002 GACATAAAAAGCATAAAAGCTGG - Intergenic
1026237891 7:68544555-68544577 GAAAAAAAAAGATAAAAAGATGG - Intergenic
1026424257 7:70274195-70274217 GATATTAAAAGAAGAAAAGAGGG - Intronic
1027559349 7:79707584-79707606 TCTATAAGAAAATCAAAAGCAGG - Intergenic
1027763372 7:82307831-82307853 GATAAAAAATATTCAAAAGCTGG + Intronic
1027827113 7:83130029-83130051 GGTATAAAAAGTTTATAAGCTGG - Intronic
1027857892 7:83536195-83536217 CATTAAAAAAAATCAAAAGCTGG - Intronic
1029747915 7:102526759-102526781 TTTATATAAAGAGCAAAAGCAGG - Intergenic
1029765864 7:102625849-102625871 TTTATATAAAGAGCAAAAGCAGG - Intronic
1030270366 7:107662765-107662787 GAAAGAAAAATATCAAAAGTAGG - Intronic
1030561301 7:111090049-111090071 TATATCAACAGGTCAAAAGCAGG - Intronic
1030658446 7:112193724-112193746 GATATAAAAAAAGTAGAAGCAGG - Intronic
1030711639 7:112757240-112757262 GTTATAAAAAGTTCAGGAGCTGG + Intergenic
1030728935 7:112961326-112961348 ATTATAAAATGATCAAAAGCAGG - Intergenic
1030981478 7:116189877-116189899 CATATAAAAACATCAAAAAATGG + Intergenic
1030985103 7:116231954-116231976 GATTTACAAAGATAAAAAGTTGG + Intronic
1031315060 7:120246342-120246364 AAAATAAAAAGTTCAAAAGCAGG - Intergenic
1031419138 7:121528776-121528798 GATAGAAAAAGATGCAAAGATGG + Intergenic
1031722180 7:125190118-125190140 GCTATAAAAAGAGAAAAAGAAGG + Intergenic
1033374034 7:140740185-140740207 GATAAAGAGAGACCAAAAGCAGG - Intronic
1035139504 7:156744012-156744034 GATATAAAACGAACAAATGAGGG + Intronic
1036144119 8:6237264-6237286 GATTTAAAAAGAGAAAAAACAGG + Intergenic
1037456589 8:19070413-19070435 GATATAAAAATATAAACAGTTGG + Intronic
1037470269 8:19201749-19201771 GCTATAAAAACACCTAAAGCTGG - Intergenic
1038047199 8:23775565-23775587 GATGTCAAAAGAACAAAAGAGGG + Intergenic
1038917646 8:32042289-32042311 AAAATAAAAAAATAAAAAGCTGG + Intronic
1039526373 8:38220040-38220062 GTTATAAAAAGGTCAACAGGAGG - Intergenic
1039744756 8:40414501-40414523 GAAAAAAAATGATCAAAATCAGG - Intergenic
1040011713 8:42666611-42666633 GAGATAAAAAGATGAAAAGGTGG - Intergenic
1041560081 8:59207624-59207646 GATATAAAAATAATAAAAGATGG - Intergenic
1041678724 8:60564429-60564451 GAGAGAAAAGGATTAAAAGCTGG - Intronic
1041792173 8:61709203-61709225 GAAAAACAAAGATCAAATGCAGG + Intronic
1042122186 8:65500138-65500160 GATATATAATCAGCAAAAGCAGG + Intergenic
1042485906 8:69345448-69345470 GAGAGAAAAAGAGCAAAGGCAGG + Intergenic
1042863916 8:73340228-73340250 GAAGTAAAAAGATAAAAAGAAGG + Intergenic
1042896305 8:73672273-73672295 GATATAAAAAGTTCAACAACAGG + Intronic
1043832015 8:85001026-85001048 GAAATAAAAAAATCAAAAATTGG - Intergenic
1044349504 8:91147344-91147366 GATATAAAAAGGTTGAAAGTAGG - Intronic
1045783921 8:105899334-105899356 GAAAGAAAAAAATAAAAAGCAGG + Intergenic
1047165864 8:122437723-122437745 CATATAAAATGTTCATAAGCAGG - Intergenic
1047361012 8:124169430-124169452 TCTATAAAATGATCAAAACCTGG - Intergenic
1047876767 8:129147224-129147246 GTTAGAAAAATATCAAAAGTAGG - Intergenic
1048062102 8:130930713-130930735 GATATAAAAATAGAAAATGCTGG - Intronic
1048247223 8:132819663-132819685 GAAATAAAAACATAAAAACCTGG - Intronic
1048913854 8:139163509-139163531 AATAAAAAAAAAACAAAAGCAGG - Intergenic
1048920061 8:139220179-139220201 GAAATAATGAAATCAAAAGCAGG + Intergenic
1050177173 9:2880343-2880365 GATATAAGAATATCAATAGAGGG + Intergenic
1050971667 9:11884375-11884397 GAGGTGAAAAGATAAAAAGCAGG + Intergenic
1051291445 9:15549677-15549699 AATAGAAAAAAATCAAAAGCAGG - Intergenic
1051548601 9:18304439-18304461 GATATTAAAATAGCAAAACCTGG + Intergenic
1051981861 9:23030235-23030257 GACATAAACATATAAAAAGCTGG + Intergenic
1052164471 9:25307662-25307684 ATTATAAATAGATTAAAAGCAGG - Intergenic
1052220052 9:26009755-26009777 GATATAAATCTATGAAAAGCAGG - Intergenic
1052266406 9:26578797-26578819 AATTTAAAAAGTTCAAAATCAGG - Intergenic
1052547980 9:29904752-29904774 GATATAAATAAATAAATAGCCGG - Intergenic
1052910627 9:33878055-33878077 GATATAAAAATATAAATAGGTGG - Intronic
1055685107 9:78764812-78764834 ATTTTAAAAAGATCAAATGCTGG + Intergenic
1055863885 9:80788729-80788751 GATAAATAAAGATCAGAAGAGGG + Intergenic
1056079423 9:83075867-83075889 GATCTAAAAAATTCTAAAGCCGG + Intergenic
1056168228 9:83958670-83958692 GATAGAAAAAAGTCAAATGCCGG + Intergenic
1056841415 9:90000847-90000869 AATATATAGAGATAAAAAGCTGG - Intergenic
1057453289 9:95184778-95184800 TTTATATAAAGTTCAAAAGCAGG + Intronic
1057838511 9:98466270-98466292 GAGTTCAAAAGTTCAAAAGCAGG + Intronic
1058060330 9:100488827-100488849 GAAATAAAAAAATTAAAAACAGG - Intronic
1058230073 9:102414973-102414995 TATATAAAAATACCATAAGCTGG + Intergenic
1058344573 9:103945813-103945835 GATATAAAAAGATCACCATCAGG + Intergenic
1058724421 9:107788375-107788397 TTTATAAAAAGGTCAAAATCAGG - Intergenic
1060307355 9:122426817-122426839 GTTAGAAAAAGAACAAAAGGGGG + Intergenic
1062138543 9:134942890-134942912 GAGAAAAACAGAACAAAAGCAGG - Intergenic
1187312534 X:18159194-18159216 GATATAAAATGAACATATGCTGG - Intergenic
1187418628 X:19115413-19115435 GATATAAAGAAAACAAAAGTGGG + Intronic
1187972456 X:24672634-24672656 AAGATAAAAAGATCAGGAGCAGG - Intronic
1188033600 X:25292189-25292211 AATATAATAAGATAAAAAGGAGG - Intergenic
1188279259 X:28243816-28243838 GATATAAAATAAACAAAAGGCGG - Intergenic
1188334170 X:28908161-28908183 GAAAAAAAGACATCAAAAGCTGG - Intronic
1188954938 X:36422767-36422789 GATTTAAACATATGAAAAGCAGG - Intergenic
1189076184 X:37917663-37917685 GATATAAAAACATGAAAAGGTGG - Intronic
1189519882 X:41755211-41755233 GAAATAAAAGAATAAAAAGCAGG + Intronic
1189597643 X:42586522-42586544 GAAATTATAAGATCAAAAGCAGG - Intergenic
1189889032 X:45579372-45579394 GATATAAAAACTTCAAAATGTGG - Intergenic
1190599994 X:52081636-52081658 GCTATAAAAAGATACAAAGAAGG + Intergenic
1191123503 X:56930180-56930202 AATATAAAAAGAACAAAAAAAGG + Intergenic
1191193956 X:57701059-57701081 ACTATAAAATGATCAAAAGAAGG - Intergenic
1192414376 X:70965201-70965223 GATCTAATAAGATCAAAGGAGGG + Intergenic
1193254234 X:79327328-79327350 AAAATAAACAGATCAAAAGGTGG - Intergenic
1193513816 X:82438234-82438256 CATATAGAATGAGCAAAAGCTGG + Intergenic
1193568098 X:83105242-83105264 TATACAAAATGACCAAAAGCAGG - Intergenic
1193741779 X:85225875-85225897 GTAATAAAAAGATCAAGACCAGG - Intergenic
1193837124 X:86357294-86357316 GTAATAAAAATAACAAAAGCAGG - Intronic
1193897827 X:87135047-87135069 AATATAAAAAGATAAGAAACAGG + Intergenic
1194021916 X:88701666-88701688 CATACAAAAATATCAACAGCTGG - Intergenic
1194234855 X:91370947-91370969 AAAATAATAAAATCAAAAGCTGG - Intergenic
1194821010 X:98507156-98507178 GATATAAAAAGATTAAAAAATGG - Intergenic
1195018970 X:100807216-100807238 GCAATAAAAAGATAAATAGCTGG - Intergenic
1195122734 X:101772952-101772974 GATACAAAGAGATTAAAAGCAGG - Intergenic
1195457754 X:105088548-105088570 AATCTATAAAGATCAAAACCTGG + Intronic
1196087981 X:111706987-111707009 AAAATAAATAGGTCAAAAGCTGG - Intronic
1196573434 X:117289947-117289969 GAAACAAAAAGTTAAAAAGCAGG + Intergenic
1197669255 X:129257891-129257913 GATATAAACATATAAAAAACAGG + Intergenic
1197854932 X:130904151-130904173 GAAAAAAAAAGGTCAAAAGTTGG - Intergenic
1198163648 X:134032092-134032114 CATGTAAAAAGAGCTAAAGCAGG - Intergenic
1198375541 X:136035394-136035416 TATATATAAAGATCAAAATCAGG - Intronic
1198560029 X:137839536-137839558 GCTATAAAAAAATCTGAAGCTGG - Intergenic
1199653168 X:149968515-149968537 GAAATAAAACGATCAAAGACAGG - Intergenic
1200371880 X:155735868-155735890 GATAGAAAAAGATAAAGAACCGG - Intergenic
1200737898 Y:6820043-6820065 TATATAAAAACATCAAAAACTGG + Intergenic
1202094484 Y:21232876-21232898 GATACAAAAAGAAAAAAAACAGG - Intergenic