ID: 998036720

View in Genome Browser
Species Human (GRCh38)
Location 5:138923627-138923649
Sequence TAGAGGCTGAGGCGGGAGGA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 104212
Summary {0: 3, 1: 39, 2: 942, 3: 11583, 4: 91645}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
998036720_998036726 1 Left 998036720 5:138923627-138923649 CCATCCTCCCGCCTCAGCCTCTA 0: 3
1: 39
2: 942
3: 11583
4: 91645
Right 998036726 5:138923651-138923673 ATCTGTATCATCCACTTTAATGG 0: 1
1: 0
2: 0
3: 17
4: 172

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
998036720 Original CRISPR TAGAGGCTGAGGCGGGAGGA TGG (reversed) Intronic
Too many off-targets to display for this crispr