ID: 998036726

View in Genome Browser
Species Human (GRCh38)
Location 5:138923651-138923673
Sequence ATCTGTATCATCCACTTTAA TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 190
Summary {0: 1, 1: 0, 2: 0, 3: 17, 4: 172}

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
998036718_998036726 16 Left 998036718 5:138923612-138923634 CCTCCTGGGTTCAAGCCATCCTC 0: 143
1: 4145
2: 72711
3: 172551
4: 206409
Right 998036726 5:138923651-138923673 ATCTGTATCATCCACTTTAATGG 0: 1
1: 0
2: 0
3: 17
4: 172
998036721_998036726 -3 Left 998036721 5:138923631-138923653 CCTCCCGCCTCAGCCTCTAGATC 0: 1
1: 2
2: 49
3: 908
4: 11047
Right 998036726 5:138923651-138923673 ATCTGTATCATCCACTTTAATGG 0: 1
1: 0
2: 0
3: 17
4: 172
998036719_998036726 13 Left 998036719 5:138923615-138923637 CCTGGGTTCAAGCCATCCTCCCG 0: 14
1: 692
2: 13812
3: 172206
4: 289930
Right 998036726 5:138923651-138923673 ATCTGTATCATCCACTTTAATGG 0: 1
1: 0
2: 0
3: 17
4: 172
998036717_998036726 22 Left 998036717 5:138923606-138923628 CCTCTGCCTCCTGGGTTCAAGCC 0: 597
1: 21346
2: 61961
3: 111731
4: 135080
Right 998036726 5:138923651-138923673 ATCTGTATCATCCACTTTAATGG 0: 1
1: 0
2: 0
3: 17
4: 172
998036724_998036726 -10 Left 998036724 5:138923638-138923660 CCTCAGCCTCTAGATCTGTATCA 0: 1
1: 0
2: 1
3: 23
4: 256
Right 998036726 5:138923651-138923673 ATCTGTATCATCCACTTTAATGG 0: 1
1: 0
2: 0
3: 17
4: 172
998036723_998036726 -7 Left 998036723 5:138923635-138923657 CCGCCTCAGCCTCTAGATCTGTA 0: 1
1: 0
2: 4
3: 41
4: 533
Right 998036726 5:138923651-138923673 ATCTGTATCATCCACTTTAATGG 0: 1
1: 0
2: 0
3: 17
4: 172
998036722_998036726 -6 Left 998036722 5:138923634-138923656 CCCGCCTCAGCCTCTAGATCTGT 0: 1
1: 0
2: 15
3: 173
4: 3885
Right 998036726 5:138923651-138923673 ATCTGTATCATCCACTTTAATGG 0: 1
1: 0
2: 0
3: 17
4: 172
998036720_998036726 1 Left 998036720 5:138923627-138923649 CCATCCTCCCGCCTCAGCCTCTA 0: 3
1: 39
2: 942
3: 11583
4: 91645
Right 998036726 5:138923651-138923673 ATCTGTATCATCCACTTTAATGG 0: 1
1: 0
2: 0
3: 17
4: 172

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
998036726 Original CRISPR ATCTGTATCATCCACTTTAA TGG Intronic
911771203 1:101744607-101744629 AGCTGTATAGTCCACTTTGAGGG - Intergenic
912065818 1:105741379-105741401 AGCTGTATCGTACAATTTAAAGG - Intergenic
912657495 1:111500137-111500159 AACTGCATCATCTACTTTAATGG - Intronic
913043093 1:115048549-115048571 ATCTGAATTAACAACTTTAAAGG - Exonic
913278225 1:117159550-117159572 AACTATATCACCTACTTTAAAGG + Intronic
915148708 1:153811651-153811673 TTCTGTAGCAGCCCCTTTAAGGG - Intronic
918898234 1:190376966-190376988 ATCTCTATCCTCCAATTTGATGG + Intronic
919644896 1:200085704-200085726 ATGTGTATCCCCCTCTTTAAGGG - Intronic
920839654 1:209543897-209543919 ATCGATATCATCAATTTTAATGG - Intergenic
921770378 1:219030769-219030791 ATCTGTATTATTCACTGAAATGG + Intergenic
921923362 1:220691580-220691602 AGGTTTATCATCCTCTTTAAAGG + Intronic
922226771 1:223652376-223652398 ATCTGTGTCATCTGCTCTAAGGG - Intronic
922987679 1:229878684-229878706 ATCTGTATCTTCCAGTTAAGGGG + Intergenic
924032245 1:239897511-239897533 TTCTTTATCCTCCACTATAAAGG + Intronic
924679307 1:246215857-246215879 GTGTGTATCTTCCACTTGAAAGG + Intronic
1063498697 10:6533546-6533568 TTCTGTGTGATCCACTGTAATGG - Intronic
1063718842 10:8557979-8558001 ATCTATAGCATCCAATATAATGG - Intergenic
1064557274 10:16559835-16559857 ATCTGCATCTCCCACTTCAAGGG - Intergenic
1064915311 10:20450006-20450028 ATCTTTGTCTTCCACTTTTAAGG - Intergenic
1065109827 10:22428869-22428891 ATATGCATCATCAACTATAAGGG - Intronic
1069181652 10:65368348-65368370 ATCTTTTTCATCCATTTTACTGG + Intergenic
1069671914 10:70213479-70213501 ATCAGGATCATCCACATTAATGG + Exonic
1071365958 10:84900862-84900884 ACCAGTATCATCCACCTTGAGGG - Intergenic
1073869091 10:107841276-107841298 ATCTGTTTCTTCCAGTTTATTGG - Intergenic
1081239879 11:40692110-40692132 ATCTGTATCATACACATTTCTGG - Intronic
1081513311 11:43799039-43799061 GTCAGCACCATCCACTTTAAAGG - Intronic
1081836003 11:46154989-46155011 ATCTATTGCATCCACTTTAAAGG + Intergenic
1085372854 11:76026675-76026697 GTATTTATCATCCAATTTAAAGG - Intronic
1087402884 11:97689874-97689896 ATTTTTATAAACCACTTTAAGGG + Intergenic
1087702369 11:101449832-101449854 ATCTCTAACATTCCCTTTAAGGG - Intergenic
1090131921 11:124152162-124152184 ATCTGTAACATTCATTTTAATGG - Intergenic
1090357574 11:126150235-126150257 ATCTCTATTCTTCACTTTAATGG - Intergenic
1090634248 11:128680038-128680060 AAATGAATCAGCCACTTTAAAGG - Intergenic
1091527847 12:1322949-1322971 TTTTGTATCATCCACTGTCAGGG - Intronic
1091923297 12:4322580-4322602 ATCTGTATGATCCAGTCTACTGG - Intronic
1092119065 12:6031311-6031333 CTCTGCCTCATCCTCTTTAATGG + Intronic
1092582474 12:9858526-9858548 TTCAATATCATTCACTTTAAAGG + Intronic
1093190027 12:16063744-16063766 ATCTGTATCAGCCAGAATAATGG - Intergenic
1093534444 12:20206862-20206884 ATCTGTATTAGCAGCTTTAACGG + Intergenic
1094699239 12:32852770-32852792 ATCTTTATCATGCATTTAAATGG - Intronic
1096268174 12:50141402-50141424 ACCTGTTTCACCCACTTTAAAGG + Intronic
1100192721 12:92209823-92209845 ATCTGTATCATCCTCAGGAAGGG + Intergenic
1100977373 12:100136578-100136600 ATTTGTATCATAAACTTTTATGG - Intronic
1102088664 12:110167075-110167097 ATCTGGAACATTAACTTTAATGG - Intronic
1103529361 12:121589828-121589850 ATCTGTCTCTTCCACTGTGAGGG + Intergenic
1105558245 13:21465991-21466013 ATCTGCTTCATACACTTGAATGG + Intergenic
1106724879 13:32473792-32473814 GCCTCTATCATCCACTTTTAAGG + Intronic
1107014406 13:35696862-35696884 ATTTGTTTCTGCCACTTTAAGGG + Intergenic
1107894611 13:44948807-44948829 ATCCGTAACATCATCTTTAAAGG + Intronic
1108290610 13:48956344-48956366 TTCTGGATCATCCATTTTGAGGG + Intergenic
1108678736 13:52761250-52761272 AAATGTCTCATCCAATTTAATGG + Intergenic
1109073351 13:57799460-57799482 ATCTATATCAACCACATGAAGGG - Intergenic
1110975484 13:81828617-81828639 CTCTGTATCATCAACTTTTAGGG + Intergenic
1112366701 13:98761520-98761542 TTCTGTAACATGCACTCTAACGG - Intergenic
1118425643 14:65658009-65658031 TTCTCTTTCATCCTCTTTAACGG - Intronic
1119363882 14:74074700-74074722 ATCTGTAAAAACCACTCTAAAGG + Intronic
1121063657 14:90940361-90940383 ATCTCCATCATCCCCTTGAAGGG + Intronic
1121706476 14:95999526-95999548 ATTAGTTTCATCCACTCTAATGG - Intergenic
1130345097 15:83036482-83036504 AACTGTTACAACCACTTTAAGGG + Intronic
1130841662 15:87706546-87706568 GTCTGTATCTTCCTATTTAATGG + Intergenic
1131382887 15:91978808-91978830 ATCAGTATCATCTAGTTCAAGGG + Intronic
1132459274 16:42409-42431 TTCTTTATCATGCACTTCAAAGG - Intergenic
1133020220 16:2963894-2963916 TTCTGTATCTCCCATTTTAAGGG + Intergenic
1136147962 16:28326938-28326960 AAGGGTGTCATCCACTTTAATGG + Intergenic
1137909850 16:52366274-52366296 ATCTGTATGTTTCACTTTAAAGG + Intergenic
1141141017 16:81496981-81497003 ATCTGTGCAATCCACTTTTATGG - Intronic
1141327909 16:83080015-83080037 ATCTGTCTCATCCCTTTTCAAGG + Intronic
1146042010 17:29464709-29464731 ACCTGTACCATTCACTGTAAAGG - Intronic
1146590298 17:34122954-34122976 ATTTCAATTATCCACTTTAAAGG + Intronic
1146671332 17:34740183-34740205 ATCTGTGCCACCCACTTTCAGGG - Intergenic
1151066600 17:71158079-71158101 ATCTGTCTTATCAATTTTAATGG - Intergenic
1155607870 18:27628433-27628455 ATCTGTAACTGCCACTTAAATGG - Intergenic
1155684778 18:28535199-28535221 CTCTGTATCTTTCTCTTTAAAGG - Intergenic
1156955116 18:42953402-42953424 CTCTGTATCACTCACTTTTAGGG - Intronic
1157458635 18:47862933-47862955 ATCTCTAATATCCACTATAAAGG + Intronic
1158381383 18:56933778-56933800 ACCTGTATCAACCACTTCATAGG + Intronic
1158412362 18:57218992-57219014 AATTGTAACAACCACTTTAAAGG + Intergenic
1158885047 18:61819171-61819193 ATCTGTATCAGAGACTGTAAGGG - Intronic
1159265934 18:66079112-66079134 CTCTGTATCCTCCTTTTTAAAGG + Intergenic
1163200190 19:15761122-15761144 ATCTGCATCATCAACATTATAGG - Intergenic
926184256 2:10676472-10676494 GTCTGCCTCATCCACTTTATGGG - Intronic
926252114 2:11160639-11160661 CTCTGTATCTTTCATTTTAACGG + Exonic
926756455 2:16240243-16240265 ATCTGTATCATCCACATGGATGG + Intergenic
927924365 2:26999865-26999887 ATTTGTATTATCCACTAAAATGG - Intronic
928845381 2:35665576-35665598 TTCTGTCTCATCCACTAAAATGG + Intergenic
929403884 2:41617644-41617666 ATCAGTGTCAGCCACTTCAAGGG + Intergenic
931093728 2:58916022-58916044 ATCTTCATCATCCTCTTTAGAGG - Intergenic
933522264 2:83389009-83389031 ATATGTATCATCCAACTCAAAGG - Intergenic
933762572 2:85682588-85682610 CTCTGTAACATCTATTTTAAGGG + Intergenic
933793182 2:85899791-85899813 ATCTCTATCATGCACTTCAGGGG - Intergenic
933892483 2:86784620-86784642 ATTTGTAGCATCCTCTTTAATGG - Exonic
936668658 2:114629917-114629939 ATCTGTATCATTGATTTTCATGG - Intronic
938637441 2:133244409-133244431 ATCTGTCTCATACAATTTATTGG + Intronic
938894923 2:135740581-135740603 ACCTTTAACATCAACTTTAATGG - Intergenic
941375341 2:164722078-164722100 ATCTGTCTCATCCACGCTCATGG + Exonic
944653867 2:201858495-201858517 CTCTGTGTCCTCCACTTCAAAGG + Intronic
945417822 2:209597066-209597088 ATGTGTATCAGCTACTTAAATGG + Intronic
1172549354 20:35786956-35786978 ATCAATATCATCCACCTCAATGG - Intronic
1178940811 21:36903657-36903679 ATCTGGATGATTCACTTTAGAGG - Intronic
1179357773 21:40677338-40677360 ATCTATATCAGGCATTTTAATGG + Intronic
1183885117 22:40873510-40873532 ATCTCTATCGTCAACTATAATGG + Intronic
951105465 3:18736951-18736973 AACTGTATCCTCTACTTTATTGG - Intergenic
951770402 3:26249663-26249685 ATATGTATCATCCATTTGAATGG - Intergenic
952352890 3:32557711-32557733 TTCTGTATTGGCCACTTTAAAGG - Intronic
956698179 3:71936217-71936239 ACCTTTATTATCCACTTTTATGG - Intergenic
957708954 3:83828565-83828587 ACATGTATCATGCACTTTGATGG - Intergenic
958261655 3:91388445-91388467 ATATGTATTTTCCACATTAATGG + Intergenic
959214981 3:103439282-103439304 ATCTGTTTCATCTACTTCTATGG + Intergenic
959669206 3:108955698-108955720 AAGAGTATCATTCACTTTAATGG - Intergenic
960226575 3:115176453-115176475 ATCTGTATCATCAAATTTGTGGG - Intergenic
960858306 3:122125583-122125605 ATCTATATCATCCATGTTAAAGG + Intergenic
962134407 3:132719192-132719214 AGTTGTGTCATCAACTTTAAGGG + Intronic
962762662 3:138530016-138530038 ATCTGTCACATCTACTTTACAGG + Intronic
963472730 3:145763087-145763109 ATCTGTGTCATACACTTTTTGGG - Intergenic
964313058 3:155414580-155414602 CTCTGTGTCCTGCACTTTAATGG - Intronic
964386858 3:156156656-156156678 ATCTTTCTCATCTAATTTAAGGG - Intronic
965056970 3:163732047-163732069 CTCTGGACCATCCACTTTAAAGG + Intergenic
966187310 3:177239688-177239710 ATCTGTATCATCATTCTTAAAGG + Intergenic
966774926 3:183535616-183535638 ATCTGTATAATCAAGTCTAAAGG + Intronic
967411272 3:189168851-189168873 ATCTGCATGATCCACTATGAGGG + Intronic
970145211 4:13028872-13028894 ATCAGTTTCTTCAACTTTAAAGG - Intergenic
970176927 4:13349013-13349035 TTCTGTATCTTACACTTTATGGG - Intergenic
971651912 4:29287763-29287785 ATCTTTCTCTTCCACTTTTAAGG - Intergenic
971929766 4:33065611-33065633 CTCTGTCTCATCCATTTAAAGGG - Intergenic
972973785 4:44609087-44609109 TTCTTTTTCATCCACTTTACAGG - Intergenic
977941650 4:102866117-102866139 ATCCTTATTATCCACTTAAAAGG - Intronic
979843689 4:125480082-125480104 ATCTCTAGCTTCCACTTTAAAGG + Intronic
981325474 4:143441738-143441760 CTCTGTATCCTCTACTTAAATGG + Intronic
985223912 4:187738507-187738529 ATCTGGAGCATCCACTTTTCTGG + Intergenic
985273351 4:188215870-188215892 CTCTGTATCACCTAGTTTAATGG - Intergenic
985961770 5:3307933-3307955 AACTGTAATATCCTCTTTAAAGG + Intergenic
987962125 5:24824054-24824076 ATCTGGAGCATCCACTCTACTGG - Intergenic
988247918 5:28712623-28712645 CTCTGTATTTTCCACTTAAAAGG - Intergenic
990173199 5:53078172-53078194 CTCTGGATCATCCATCTTAAAGG + Intronic
991282078 5:64926162-64926184 ATCTGTATCATAAACTCTGAAGG + Intronic
991417995 5:66411293-66411315 GTCTCTCTCATCCACTTTTAAGG - Intergenic
991560999 5:67952514-67952536 ATGTGAAGCATTCACTTTAAGGG + Intergenic
993058419 5:83009813-83009835 ATTATTATAATCCACTTTAAAGG + Intergenic
993860539 5:93131425-93131447 ATCAGTCTCATCCACATTATGGG - Intergenic
996635455 5:125683903-125683925 CTCTGTATCATAAACTTTCAAGG + Intergenic
997968439 5:138379747-138379769 ATCTAAACCATCCTCTTTAAGGG - Intronic
998036602 5:138922371-138922393 ATCTACCTCATCCATTTTAATGG - Intronic
998036726 5:138923651-138923673 ATCTGTATCATCCACTTTAATGG + Intronic
998902319 5:146869448-146869470 ATCTGTCTCATGCCTTTTAATGG - Intronic
1001607882 5:172975983-172976005 ATCAGGATCATCCATATTAATGG - Intergenic
1002459091 5:179364016-179364038 GTCTGGATCGTCCAGTTTAATGG + Intergenic
1004703005 6:18096673-18096695 TTCAGTATCTTCCACTTCAATGG - Intergenic
1004759252 6:18647973-18647995 GTCTCTCTCCTCCACTTTAAAGG - Intergenic
1005406709 6:25497288-25497310 ATCACTGTCATCCACATTAAAGG - Intronic
1008323812 6:50151721-50151743 ATCTGTAGCATTCAAATTAAAGG + Intergenic
1009572434 6:65404227-65404249 ATCTCTCTCTTCCACTTTAAAGG + Intronic
1009876309 6:69509628-69509650 ATCTGGCTCATCAACTTTAGAGG + Intergenic
1010182983 6:73109392-73109414 ATGTGTATAATCCACTTGTATGG - Intronic
1012660936 6:101890633-101890655 ATCTGTATCACAGATTTTAAAGG - Intronic
1014759282 6:125337920-125337942 ATCTGCATAATCCACTTAGAAGG - Intergenic
1015598513 6:134889676-134889698 ATTGGCAGCATCCACTTTAATGG + Intergenic
1016090877 6:139977317-139977339 AACTGTATCATTAAATTTAAAGG + Intergenic
1016431944 6:143994446-143994468 ATCAGTGTCATACGCTTTAATGG - Intronic
1016735260 6:147471284-147471306 ATATGTATCAAACACTTTAATGG + Intergenic
1016806082 6:148213345-148213367 ATCTGTATTCTCCGCTTTTATGG + Intergenic
1021044515 7:15906268-15906290 TTTTGTATCATCCACCATAAAGG - Intergenic
1022548079 7:31207880-31207902 ATCTGGATCAGCCTTTTTAATGG + Intergenic
1023121962 7:36918558-36918580 ATGTGTATCATCATCTCTAAGGG + Intronic
1024008799 7:45250253-45250275 AAATGTATCATAGACTTTAAGGG + Intergenic
1024923264 7:54584042-54584064 ATGTGTATGATGTACTTTAAGGG - Intergenic
1028997958 7:97122475-97122497 ATCTATATCCTCCATTTTCAAGG - Intronic
1031454058 7:121957565-121957587 ATCAGTATCATTCACTGCAAGGG - Intronic
1031831879 7:126637884-126637906 ATTTGTATCATCTACCTTCAGGG - Intronic
1046133103 8:109992758-109992780 ACCTGCAACACCCACTTTAAAGG + Intergenic
1047038187 8:120963024-120963046 TTCTGTTTGATCCATTTTAAGGG + Intergenic
1047931023 8:129728365-129728387 ATCTGGAGCATCCACTTTCCTGG + Intergenic
1048361363 8:133699854-133699876 ATATTTATCACCCACTTTAATGG - Intergenic
1053038074 9:34842996-34843018 CTCTGTGTCATCCATTTTTATGG + Intergenic
1054893524 9:70280442-70280464 ATCTGCTGCATCCACTTGAAGGG - Intronic
1055179144 9:73361577-73361599 ATTTATATCTTCCTCTTTAAGGG - Intergenic
1055245225 9:74233416-74233438 GTCTGAATGATCCCCTTTAAGGG + Intergenic
1055603085 9:77940222-77940244 ATCTGTAATATGCACTATAAGGG - Intronic
1056263821 9:84876199-84876221 CTCTATATCAACCACTTTATTGG - Intronic
1056272302 9:84958211-84958233 CACTGAATCATTCACTTTAAAGG + Intronic
1058648062 9:107149114-107149136 ATCTGTTTCATCCTCTATACTGG + Intergenic
1203490119 Un_GL000224v1:96748-96770 TTCTGTAACATGCACTCTAACGG - Intergenic
1203502742 Un_KI270741v1:38631-38653 TTCTGTAACATGCACTCTAACGG - Intergenic
1186663774 X:11697779-11697801 AACTGTAGCATCCAGTTTTATGG + Intergenic
1187511445 X:19923264-19923286 ATTTGTTTCATCCATTTTAATGG - Intronic
1188324227 X:28780435-28780457 AACCATATGATCCACTTTAATGG - Intronic
1192192610 X:69001028-69001050 GTCTTTATCTTCCACATTAAAGG - Intergenic
1193838733 X:86381129-86381151 ATGTGTGTCTTCAACTTTAATGG + Intronic
1197452291 X:126634373-126634395 TTCTGTATTATCCAATTTATTGG + Intergenic
1198874860 X:141213327-141213349 ATCTGCATCATCCAAGTTGAAGG + Intergenic
1199438946 X:147846282-147846304 AACAGTATCATCCACCTTATAGG - Intergenic