ID: 998037030

View in Genome Browser
Species Human (GRCh38)
Location 5:138926144-138926166
Sequence GCAACCTGAACAATAGATCT AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 89
Summary {0: 1, 1: 0, 2: 0, 3: 9, 4: 79}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
998037030_998037036 23 Left 998037030 5:138926144-138926166 CCTAGATCTATTGTTCAGGTTGC 0: 1
1: 0
2: 0
3: 9
4: 79
Right 998037036 5:138926190-138926212 GCGAGCCTTTGAGTCTACTGTGG 0: 1
1: 0
2: 0
3: 2
4: 55
998037030_998037038 25 Left 998037030 5:138926144-138926166 CCTAGATCTATTGTTCAGGTTGC 0: 1
1: 0
2: 0
3: 9
4: 79
Right 998037038 5:138926192-138926214 GAGCCTTTGAGTCTACTGTGGGG No data
998037030_998037037 24 Left 998037030 5:138926144-138926166 CCTAGATCTATTGTTCAGGTTGC 0: 1
1: 0
2: 0
3: 9
4: 79
Right 998037037 5:138926191-138926213 CGAGCCTTTGAGTCTACTGTGGG 0: 1
1: 0
2: 0
3: 1
4: 57

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
998037030 Original CRISPR GCAACCTGAACAATAGATCT AGG (reversed) Intronic
902868192 1:19294971-19294993 GCTCCCTGAAAAATGGATCTTGG + Intergenic
903103066 1:21050242-21050264 GCAAGCTAAACAATATATCTTGG + Intronic
907324638 1:53628965-53628987 GGAACTTGAAAAATAAATCTGGG + Intronic
907597018 1:55729376-55729398 GCAACCTGGACAACAGAATTGGG + Intergenic
907752856 1:57280222-57280244 GACACATGAACAATAGATATTGG + Intronic
908386363 1:63645989-63646011 GCAACCTGCACAAAACATCTGGG - Intronic
908480015 1:64530252-64530274 CCAACCTCAACAATAGAGGTTGG + Intronic
910102833 1:83597058-83597080 GAAACCTGATCGATAGATGTGGG + Intergenic
919684688 1:200472947-200472969 GCAAGGTGAAAAATAGATATTGG - Intergenic
923152684 1:231247756-231247778 GCAACTTGAATCAGAGATCTGGG + Intronic
1063066307 10:2612691-2612713 GCTACCTGAAGAATGGATCTTGG + Intergenic
1067780915 10:49206630-49206652 GCAACCTGTACAGGAGATCCTGG + Intergenic
1070126265 10:73624941-73624963 GCAGGCTGAACACTAAATCTAGG - Intronic
1070956507 10:80467242-80467264 GAAACCTGAAAAACAGCTCTTGG - Intronic
1074059910 10:109955600-109955622 ACCATCTGAACAATAGGTCTGGG + Intergenic
1077932299 11:6746360-6746382 GCAACCTGAAGACAGGATCTTGG - Intergenic
1085650350 11:78262336-78262358 GCTACCTGAAGAATTGTTCTGGG + Intronic
1087584611 11:100102826-100102848 GCAATCTGAACATTAGCACTAGG + Intronic
1089543705 11:119206425-119206447 GCAACGTGAAGAAGAGCTCTGGG + Exonic
1095383369 12:41620916-41620938 GCAGCCTGAATTATACATCTTGG - Intergenic
1096824478 12:54264185-54264207 GCAGCCTGAACAACAGAACGAGG - Intronic
1098257439 12:68631373-68631395 GAAGGCTGAACAATACATCTAGG - Intronic
1100082262 12:90866731-90866753 CCAACCTGAACAGAAGAGCTGGG - Intergenic
1101107741 12:101456642-101456664 GGAACCTGAACAATGGATATGGG + Intergenic
1102991554 12:117319878-117319900 GGAACCTGAACACTAGTTCTAGG + Intronic
1106316961 13:28602826-28602848 GGGACCTGAACAATATATCATGG - Intergenic
1111884583 13:94004153-94004175 GCAGCATTAACAATAGATCAGGG - Intronic
1125427965 15:39568546-39568568 GCAAAATGAACATTAGATATGGG - Intergenic
1128252553 15:66173226-66173248 CCAACCAAACCAATAGATCTGGG + Intronic
1129502756 15:76055898-76055920 GCAATAAGAACAGTAGATCTTGG - Intronic
1139744178 16:69061042-69061064 GAAACCTGAATACTAGATTTTGG - Intronic
1148447879 17:47750981-47751003 GCAGCCTGGACAATATAACTAGG - Intergenic
1154221640 18:12459924-12459946 GGAACCTGAACAACAGATAAGGG + Intronic
1157102041 18:44739922-44739944 AAAACCTGAAGAATAGATTTTGG + Intronic
1157475834 18:48022925-48022947 GCAACCTGGACAACTGATCTTGG + Intergenic
1158185474 18:54766567-54766589 GAAACATAAACATTAGATCTAGG - Intronic
1159174373 18:64814558-64814580 GCTCCCTGAAAAATGGATCTTGG - Intergenic
926183962 2:10673164-10673186 GCAACCTGGCAAATAAATCTAGG + Intronic
933884963 2:86710657-86710679 CCAATCTGAACAATAGAGATAGG - Intronic
933925211 2:87086030-87086052 CCAATCTGAACAATAGAGATAGG + Intergenic
941033282 2:160537334-160537356 ACAAACTGAAAAACAGATCTGGG - Intergenic
943984713 2:194604465-194604487 CCTCCCTGAAAAATAGATCTTGG - Intergenic
946561084 2:220914691-220914713 GCAAACTGAACAATTGAACTAGG - Intergenic
947522999 2:230862999-230863021 GCCACCTAAACAAAAGCTCTTGG + Intergenic
1172994170 20:39057784-39057806 GCATCCTGGACATTAGCTCTAGG - Intergenic
1173047577 20:39527391-39527413 GCAAACTGAACATAAGACCTTGG - Intergenic
1173438346 20:43053271-43053293 GCATCCAGAACAGTGGATCTGGG - Intronic
1179546535 21:42115964-42115986 CCATCCTGAAGAATAGTTCTAGG - Exonic
1181553135 22:23652412-23652434 GCAGCCTGAACAGCAGACCTAGG - Intergenic
1182405512 22:30125839-30125861 ACAAACTGAACACTAGAGCTGGG + Intronic
954504379 3:51054918-51054940 GCAATCAGAAAAATAGATATTGG - Intronic
955739456 3:62074642-62074664 GTAAGCTGAAGAAAAGATCTGGG - Intronic
958958415 3:100486576-100486598 TTAACCTGACCAATAGAGCTGGG + Intergenic
959662877 3:108888852-108888874 TCACCCTAAACAATAGATTTGGG + Intergenic
963340982 3:144033235-144033257 GCGAGCTGATGAATAGATCTGGG - Intronic
970426999 4:15954715-15954737 GCAACATGGACAATAAATCCAGG - Intergenic
971922490 4:32960343-32960365 GAAACCTGTACAGTAAATCTCGG - Intergenic
976266462 4:83190146-83190168 GGAACCTGCAGAATAGATCCTGG - Intergenic
979106637 4:116697460-116697482 GAAACCTAAACAATAGCTCCAGG - Intergenic
986870096 5:12035957-12035979 CAAACCTGAAAAAGAGATCTTGG + Intergenic
987376223 5:17237516-17237538 GCAAGCTCAACTATAGATTTAGG - Intronic
992928238 5:81613965-81613987 ACACACTGAACAATAGCTCTTGG - Intronic
998037030 5:138926144-138926166 GCAACCTGAACAATAGATCTAGG - Intronic
1008022452 6:46595906-46595928 TCAACCTGAAAAATATATGTGGG + Intronic
1013602713 6:111719971-111719993 GCAGCCTGAACCAGAGCTCTGGG - Exonic
1020470547 7:8529495-8529517 CCAGCATGAACAATAGATCTTGG - Intronic
1021387351 7:20047464-20047486 GCAACCAAAACAATACATATAGG + Intergenic
1023418566 7:39953853-39953875 GCAACCTGTTCACTAGATTTGGG + Intronic
1024991532 7:55238295-55238317 GCTACATAAACAATAGATCTTGG + Intronic
1032705253 7:134415737-134415759 GCAAACTGAACAGGACATCTAGG - Intergenic
1033704739 7:143875917-143875939 GCAACCTGAAGATAAGAACTGGG + Intronic
1035969762 8:4234752-4234774 GCTCCCAGAACAAAAGATCTGGG + Intronic
1037264304 8:17040993-17041015 GTAACTTGTACAATAGATCAAGG + Intronic
1045340305 8:101248460-101248482 GCAACAAGAACAAAATATCTGGG + Intergenic
1046657498 8:116911347-116911369 GTAACCTGAACAATAGAAGAAGG + Intergenic
1047727208 8:127694327-127694349 GCAGCCTGAATTTTAGATCTGGG - Intergenic
1051218163 9:14821078-14821100 GAAACCTGAGCACTGGATCTGGG - Intronic
1051489962 9:17651440-17651462 GCAACAAAAACAATACATCTTGG - Intronic
1053083001 9:35193128-35193150 GCTCCCTGAAAAATGGATCTTGG + Intronic
1058865131 9:109155030-109155052 GGAACCTGAACCTTAGATCCAGG - Intronic
1058957319 9:109961023-109961045 GCAACCTGAACAATCATACTTGG - Intronic
1203443703 Un_GL000219v1:34578-34600 GCAGCCTGAAAACTAGAACTGGG + Intergenic
1203514511 Un_KI270741v1:153487-153509 GCAGCCTGAAAACTAGAACTGGG + Intergenic
1187090364 X:16089690-16089712 GCACCTGGACCAATAGATCTTGG - Intergenic
1195976318 X:110531579-110531601 GGAATCTGACCAATAGATCATGG - Intergenic
1196017673 X:110956852-110956874 CCTACCTGATCAATAGAGCTGGG + Intronic
1197613225 X:128662075-128662097 GCAAAATGCACAATAGATCCAGG + Intergenic
1199916800 X:152351297-152351319 GCTACATGAACAACAGATTTTGG - Intronic
1200912999 Y:8547527-8547549 CCCACCTGAACAATAGACCATGG - Intergenic