ID: 998037395

View in Genome Browser
Species Human (GRCh38)
Location 5:138928569-138928591
Sequence AGAACTGTCCTGGGTAGAAA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 266
Summary {0: 1, 1: 0, 2: 2, 3: 17, 4: 246}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
998037395_998037399 5 Left 998037395 5:138928569-138928591 CCTTTTCTACCCAGGACAGTTCT 0: 1
1: 0
2: 2
3: 17
4: 246
Right 998037399 5:138928597-138928619 TTGTCTTAAAATGCCGGTGTTGG No data
998037395_998037400 6 Left 998037395 5:138928569-138928591 CCTTTTCTACCCAGGACAGTTCT 0: 1
1: 0
2: 2
3: 17
4: 246
Right 998037400 5:138928598-138928620 TGTCTTAAAATGCCGGTGTTGGG 0: 1
1: 0
2: 0
3: 7
4: 94
998037395_998037403 19 Left 998037395 5:138928569-138928591 CCTTTTCTACCCAGGACAGTTCT 0: 1
1: 0
2: 2
3: 17
4: 246
Right 998037403 5:138928611-138928633 CGGTGTTGGGGAAGTAAATTAGG 0: 1
1: 0
2: 0
3: 10
4: 156
998037395_998037398 -1 Left 998037395 5:138928569-138928591 CCTTTTCTACCCAGGACAGTTCT 0: 1
1: 0
2: 2
3: 17
4: 246
Right 998037398 5:138928591-138928613 TCATCTTTGTCTTAAAATGCCGG 0: 1
1: 0
2: 1
3: 32
4: 273
998037395_998037401 7 Left 998037395 5:138928569-138928591 CCTTTTCTACCCAGGACAGTTCT 0: 1
1: 0
2: 2
3: 17
4: 246
Right 998037401 5:138928599-138928621 GTCTTAAAATGCCGGTGTTGGGG 0: 1
1: 0
2: 1
3: 6
4: 65

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
998037395 Original CRISPR AGAACTGTCCTGGGTAGAAA AGG (reversed) Intronic