ID: 998037396

View in Genome Browser
Species Human (GRCh38)
Location 5:138928578-138928600
Sequence ACAAAGATGAGAACTGTCCT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 250
Summary {0: 1, 1: 0, 2: 4, 3: 19, 4: 226}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
998037396_998037400 -3 Left 998037396 5:138928578-138928600 CCCAGGACAGTTCTCATCTTTGT 0: 1
1: 0
2: 4
3: 19
4: 226
Right 998037400 5:138928598-138928620 TGTCTTAAAATGCCGGTGTTGGG 0: 1
1: 0
2: 0
3: 7
4: 94
998037396_998037403 10 Left 998037396 5:138928578-138928600 CCCAGGACAGTTCTCATCTTTGT 0: 1
1: 0
2: 4
3: 19
4: 226
Right 998037403 5:138928611-138928633 CGGTGTTGGGGAAGTAAATTAGG 0: 1
1: 0
2: 0
3: 10
4: 156
998037396_998037398 -10 Left 998037396 5:138928578-138928600 CCCAGGACAGTTCTCATCTTTGT 0: 1
1: 0
2: 4
3: 19
4: 226
Right 998037398 5:138928591-138928613 TCATCTTTGTCTTAAAATGCCGG 0: 1
1: 0
2: 1
3: 32
4: 273
998037396_998037399 -4 Left 998037396 5:138928578-138928600 CCCAGGACAGTTCTCATCTTTGT 0: 1
1: 0
2: 4
3: 19
4: 226
Right 998037399 5:138928597-138928619 TTGTCTTAAAATGCCGGTGTTGG No data
998037396_998037401 -2 Left 998037396 5:138928578-138928600 CCCAGGACAGTTCTCATCTTTGT 0: 1
1: 0
2: 4
3: 19
4: 226
Right 998037401 5:138928599-138928621 GTCTTAAAATGCCGGTGTTGGGG 0: 1
1: 0
2: 1
3: 6
4: 65

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
998037396 Original CRISPR ACAAAGATGAGAACTGTCCT GGG (reversed) Intronic