ID: 998037397

View in Genome Browser
Species Human (GRCh38)
Location 5:138928579-138928601
Sequence GACAAAGATGAGAACTGTCC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 177
Summary {0: 1, 1: 0, 2: 0, 3: 16, 4: 160}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
998037397_998037403 9 Left 998037397 5:138928579-138928601 CCAGGACAGTTCTCATCTTTGTC 0: 1
1: 0
2: 0
3: 16
4: 160
Right 998037403 5:138928611-138928633 CGGTGTTGGGGAAGTAAATTAGG 0: 1
1: 0
2: 0
3: 10
4: 156
998037397_998037399 -5 Left 998037397 5:138928579-138928601 CCAGGACAGTTCTCATCTTTGTC 0: 1
1: 0
2: 0
3: 16
4: 160
Right 998037399 5:138928597-138928619 TTGTCTTAAAATGCCGGTGTTGG No data
998037397_998037400 -4 Left 998037397 5:138928579-138928601 CCAGGACAGTTCTCATCTTTGTC 0: 1
1: 0
2: 0
3: 16
4: 160
Right 998037400 5:138928598-138928620 TGTCTTAAAATGCCGGTGTTGGG 0: 1
1: 0
2: 0
3: 7
4: 94
998037397_998037401 -3 Left 998037397 5:138928579-138928601 CCAGGACAGTTCTCATCTTTGTC 0: 1
1: 0
2: 0
3: 16
4: 160
Right 998037401 5:138928599-138928621 GTCTTAAAATGCCGGTGTTGGGG 0: 1
1: 0
2: 1
3: 6
4: 65

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
998037397 Original CRISPR GACAAAGATGAGAACTGTCC TGG (reversed) Intronic