ID: 998037398

View in Genome Browser
Species Human (GRCh38)
Location 5:138928591-138928613
Sequence TCATCTTTGTCTTAAAATGC CGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 307
Summary {0: 1, 1: 0, 2: 1, 3: 32, 4: 273}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
998037396_998037398 -10 Left 998037396 5:138928578-138928600 CCCAGGACAGTTCTCATCTTTGT 0: 1
1: 0
2: 4
3: 19
4: 226
Right 998037398 5:138928591-138928613 TCATCTTTGTCTTAAAATGCCGG 0: 1
1: 0
2: 1
3: 32
4: 273
998037395_998037398 -1 Left 998037395 5:138928569-138928591 CCTTTTCTACCCAGGACAGTTCT 0: 1
1: 0
2: 2
3: 17
4: 246
Right 998037398 5:138928591-138928613 TCATCTTTGTCTTAAAATGCCGG 0: 1
1: 0
2: 1
3: 32
4: 273
998037393_998037398 19 Left 998037393 5:138928549-138928571 CCTCTATTTTTAAGTCAGTACCT 0: 1
1: 0
2: 0
3: 17
4: 181
Right 998037398 5:138928591-138928613 TCATCTTTGTCTTAAAATGCCGG 0: 1
1: 0
2: 1
3: 32
4: 273

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
998037398 Original CRISPR TCATCTTTGTCTTAAAATGC CGG Intronic