ID: 998037399

View in Genome Browser
Species Human (GRCh38)
Location 5:138928597-138928619
Sequence TTGTCTTAAAATGCCGGTGT TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
998037393_998037399 25 Left 998037393 5:138928549-138928571 CCTCTATTTTTAAGTCAGTACCT 0: 1
1: 0
2: 0
3: 17
4: 181
Right 998037399 5:138928597-138928619 TTGTCTTAAAATGCCGGTGTTGG No data
998037396_998037399 -4 Left 998037396 5:138928578-138928600 CCCAGGACAGTTCTCATCTTTGT 0: 1
1: 0
2: 4
3: 19
4: 226
Right 998037399 5:138928597-138928619 TTGTCTTAAAATGCCGGTGTTGG No data
998037397_998037399 -5 Left 998037397 5:138928579-138928601 CCAGGACAGTTCTCATCTTTGTC 0: 1
1: 0
2: 0
3: 16
4: 160
Right 998037399 5:138928597-138928619 TTGTCTTAAAATGCCGGTGTTGG No data
998037395_998037399 5 Left 998037395 5:138928569-138928591 CCTTTTCTACCCAGGACAGTTCT 0: 1
1: 0
2: 2
3: 17
4: 246
Right 998037399 5:138928597-138928619 TTGTCTTAAAATGCCGGTGTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
998037399 Original CRISPR TTGTCTTAAAATGCCGGTGT TGG Intronic