ID: 998037401

View in Genome Browser
Species Human (GRCh38)
Location 5:138928599-138928621
Sequence GTCTTAAAATGCCGGTGTTG GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 73
Summary {0: 1, 1: 0, 2: 1, 3: 6, 4: 65}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
998037395_998037401 7 Left 998037395 5:138928569-138928591 CCTTTTCTACCCAGGACAGTTCT 0: 1
1: 0
2: 2
3: 17
4: 246
Right 998037401 5:138928599-138928621 GTCTTAAAATGCCGGTGTTGGGG 0: 1
1: 0
2: 1
3: 6
4: 65
998037396_998037401 -2 Left 998037396 5:138928578-138928600 CCCAGGACAGTTCTCATCTTTGT 0: 1
1: 0
2: 4
3: 19
4: 226
Right 998037401 5:138928599-138928621 GTCTTAAAATGCCGGTGTTGGGG 0: 1
1: 0
2: 1
3: 6
4: 65
998037397_998037401 -3 Left 998037397 5:138928579-138928601 CCAGGACAGTTCTCATCTTTGTC 0: 1
1: 0
2: 0
3: 16
4: 160
Right 998037401 5:138928599-138928621 GTCTTAAAATGCCGGTGTTGGGG 0: 1
1: 0
2: 1
3: 6
4: 65
998037393_998037401 27 Left 998037393 5:138928549-138928571 CCTCTATTTTTAAGTCAGTACCT 0: 1
1: 0
2: 0
3: 17
4: 181
Right 998037401 5:138928599-138928621 GTCTTAAAATGCCGGTGTTGGGG 0: 1
1: 0
2: 1
3: 6
4: 65

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
998037401 Original CRISPR GTCTTAAAATGCCGGTGTTG GGG Intronic