ID: 998040357

View in Genome Browser
Species Human (GRCh38)
Location 5:138947481-138947503
Sequence TACCTGGCCTGCGGCTGTGG CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 246
Summary {0: 1, 1: 0, 2: 2, 3: 14, 4: 229}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
998040357_998040372 26 Left 998040357 5:138947481-138947503 CCGCCACAGCCGCAGGCCAGGTA 0: 1
1: 0
2: 2
3: 14
4: 229
Right 998040372 5:138947530-138947552 GGGAGCAGTTAGCTCACACCTGG 0: 1
1: 0
2: 1
3: 9
4: 126
998040357_998040367 -10 Left 998040357 5:138947481-138947503 CCGCCACAGCCGCAGGCCAGGTA 0: 1
1: 0
2: 2
3: 14
4: 229
Right 998040367 5:138947494-138947516 AGGCCAGGTAGGGTGGGGGTGGG 0: 1
1: 1
2: 15
3: 133
4: 888
998040357_998040370 5 Left 998040357 5:138947481-138947503 CCGCCACAGCCGCAGGCCAGGTA 0: 1
1: 0
2: 2
3: 14
4: 229
Right 998040370 5:138947509-138947531 GGGGTGGGGAGAGAACACACAGG 0: 1
1: 0
2: 8
3: 50
4: 553
998040357_998040368 -9 Left 998040357 5:138947481-138947503 CCGCCACAGCCGCAGGCCAGGTA 0: 1
1: 0
2: 2
3: 14
4: 229
Right 998040368 5:138947495-138947517 GGCCAGGTAGGGTGGGGGTGGGG 0: 1
1: 2
2: 19
3: 159
4: 1271
998040357_998040371 6 Left 998040357 5:138947481-138947503 CCGCCACAGCCGCAGGCCAGGTA 0: 1
1: 0
2: 2
3: 14
4: 229
Right 998040371 5:138947510-138947532 GGGTGGGGAGAGAACACACAGGG 0: 1
1: 1
2: 1
3: 46
4: 491

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
998040357 Original CRISPR TACCTGGCCTGCGGCTGTGG CGG (reversed) Intronic
900421878 1:2559290-2559312 TACTTGGGCTGAGGATGTGGGGG + Intronic
901630384 1:10645147-10645169 CCCCGGGCCTGAGGCTGTGGTGG + Intronic
901653432 1:10755866-10755888 TCCATGGCCTGCAGCTGGGGTGG - Intronic
901783347 1:11608895-11608917 ACCCGGGCCAGCGGCTGTGGAGG + Intergenic
902061926 1:13651640-13651662 TGCCTGGAGTGAGGCTGTGGAGG - Intergenic
903498901 1:23791252-23791274 TACCCAGCCGGCGGCTGCGGAGG + Intronic
904622719 1:31784957-31784979 ATCCTGGCCTGGGGCAGTGGGGG + Intergenic
905612872 1:39370244-39370266 TAACTGGTCTCCAGCTGTGGTGG + Intronic
905856544 1:41318342-41318364 TTCCTGGCCTGAGGCTGGAGGGG + Intergenic
905866116 1:41377627-41377649 TGCCAGGGCTGTGGCTGTGGTGG + Intronic
906650361 1:47508458-47508480 TGCCGGGCCTGCGGCCGCGGCGG - Intergenic
907294200 1:53439287-53439309 ACCCTGGGCGGCGGCTGTGGAGG - Intergenic
908817567 1:68050005-68050027 CACCTGGCCTCAGGCTGAGGGGG + Intronic
910149700 1:84126887-84126909 TACCTGAACTGAGGTTGTGGTGG - Intronic
912174681 1:107141227-107141249 TCCCCGGGCTGCGGCGGTGGCGG + Intronic
917949506 1:180015951-180015973 TACCTTGCAAGAGGCTGTGGAGG - Exonic
918792037 1:188841398-188841420 CACCCGGCCAGCGGCTGCGGAGG - Intergenic
919091904 1:192987048-192987070 ACCCGGGCCAGCGGCTGTGGAGG + Intergenic
919174474 1:194001979-194002001 ACCCAGGCCAGCGGCTGTGGAGG + Intergenic
920389896 1:205592934-205592956 TGCCTGCCTTGTGGCTGTGGTGG + Intronic
922089123 1:222378757-222378779 TACCTGGGCTGCAGCAGTGATGG - Intergenic
922722893 1:227907722-227907744 GGCCTGGCATGCGGGTGTGGAGG - Intergenic
922763098 1:228144552-228144574 CACCTGCTCTGCGGCTGTGCAGG - Intronic
1062899587 10:1132782-1132804 GACCAGGGCTGTGGCTGTGGTGG + Intergenic
1066234046 10:33468171-33468193 ACCCGGGCCAGCGGCTGTGGAGG + Intergenic
1069825802 10:71254380-71254402 TACCTGGCGTCCTGCTGTCGTGG + Intronic
1069896795 10:71685071-71685093 TTCCAGGCCTGTGGCTGTGGTGG - Intronic
1070713754 10:78702569-78702591 TTCCTGGCCTGCGGGGGTGAGGG - Intergenic
1076012035 10:126996657-126996679 TACCTGCCCAGTTGCTGTGGTGG + Intronic
1076744050 10:132503953-132503975 AGCCTGGCCTGGGGGTGTGGTGG - Intergenic
1082129466 11:48470974-48470996 TTCCTGGCCTGGTGCTGAGGTGG + Intergenic
1083441373 11:62678826-62678848 ACCCCGGCCTGCGGGTGTGGGGG - Intronic
1084210463 11:67619174-67619196 ACCCGGGCCAGCGGCTGTGGAGG + Intergenic
1084888200 11:72224057-72224079 GGCCCGGCCTGCGGGTGTGGGGG + Intronic
1085122184 11:73974349-73974371 AAACAGGCCTGCGGCTGGGGTGG + Intergenic
1085245599 11:75098344-75098366 ACCCGGGCCAGCGGCTGTGGAGG + Intergenic
1089204480 11:116748462-116748484 TAACTTTCCTGAGGCTGTGGGGG - Exonic
1090236219 11:125149544-125149566 ACCCTGGCCTACAGCTGTGGAGG - Intergenic
1091049258 11:132352715-132352737 TGCCCGGCCTGAGCCTGTGGGGG - Intergenic
1091529911 12:1344268-1344290 TACCTGGCCTGGTTCTGTGGCGG + Intronic
1094718195 12:33034154-33034176 ACCCAGGCCAGCGGCTGTGGAGG - Intergenic
1095089050 12:38087192-38087214 CACCTGGGCTGGGGCTGTAGGGG + Intergenic
1096513826 12:52145748-52145770 TGCCTGCCCTGCGGAGGTGGGGG - Intergenic
1104485541 12:129148753-129148775 GCCCTGGCATGCAGCTGTGGAGG - Intronic
1104614515 12:130256877-130256899 ACCCGGGCCAGCGGCTGTGGAGG - Intergenic
1104772302 12:131371060-131371082 TCCCTGGCCTGGGGCTCTGATGG - Intergenic
1105722174 13:23127709-23127731 ACCCAGGCCAGCGGCTGTGGAGG + Intergenic
1106562091 13:30855672-30855694 TTGCTGGCCTGCTGCTGTGCTGG + Intergenic
1106923302 13:34588060-34588082 AACCTGGGCTGGGGATGTGGTGG - Intergenic
1108435342 13:50396732-50396754 TCCCGGGCCAGCGGCTGCGGAGG + Intronic
1108469457 13:50753530-50753552 AACCGGGCCAGCGGCTGTGGAGG - Intronic
1108858959 13:54829723-54829745 ACCCGGGCCAGCGGCTGTGGAGG - Intergenic
1109201868 13:59440047-59440069 ACCCTGGCCAGCAGCTGTGGAGG + Intergenic
1110368868 13:74718529-74718551 ACCCGGGCCGGCGGCTGTGGAGG + Intergenic
1110417484 13:75268586-75268608 AACCGGGCCAGCGGCTGCGGAGG + Intergenic
1112494538 13:99894722-99894744 TACCTTGCCTGAGGCGGGGGGGG + Exonic
1112538268 13:100282565-100282587 ACCCGGGCCAGCGGCTGTGGAGG + Intronic
1112832026 13:103464783-103464805 TTCCTGGCCTGCTGCTCTGGGGG + Intergenic
1113160269 13:107372098-107372120 TTCCTGTTCTGCGGCTGTGCAGG - Intronic
1113791960 13:113033690-113033712 TGGCTGGCCTGAGGCTGTGCTGG + Intronic
1114679567 14:24473246-24473268 CACCTGGCCAGCAGCTGGGGAGG + Intergenic
1117128649 14:52660999-52661021 TCCCTGGCCTGAGGCAATGGGGG + Intronic
1118156283 14:63245543-63245565 TACCTGGCAGGGGGCTGAGGAGG + Intronic
1119821035 14:77616445-77616467 TACCTGGCCGGCGGCGGCTGCGG + Exonic
1120050706 14:79862264-79862286 TTCCAGGCCTGCGGAAGTGGTGG - Exonic
1120632308 14:86905653-86905675 ATCCTGGCCAGCAGCTGTGGAGG - Intergenic
1121828117 14:97027368-97027390 TCCCAGGCCTGGGGCTGAGGAGG + Intergenic
1122128394 14:99591407-99591429 AGCCTGGCCTGGGGCTGCGGAGG + Intronic
1123047991 14:105527734-105527756 CCCCAGGCCTGGGGCTGTGGAGG + Intronic
1125722628 15:41852494-41852516 TCCCTGGCCAGCTGCGGTGGTGG - Intronic
1126145341 15:45468397-45468419 TGCCTGTCCTGGGGATGTGGGGG + Intergenic
1129458245 15:75687174-75687196 GACTTGGGCTGTGGCTGTGGTGG - Intronic
1129466442 15:75726932-75726954 TCCCTGCCCTGCTGCTGAGGTGG + Intronic
1129617491 15:77110614-77110636 TACCTACCCTGCTGCTGTTGAGG - Exonic
1129725537 15:77899692-77899714 GACTTGGGCTGTGGCTGTGGTGG + Intergenic
1129788232 15:78323106-78323128 TGCCTGGCCTGGGGATGAGGGGG + Intergenic
1130132864 15:81158760-81158782 GCCCGGGCCAGCGGCTGTGGAGG + Intergenic
1132865024 16:2089034-2089056 TACCTGGCCTGGGGCAAGGGAGG + Exonic
1135262122 16:20989864-20989886 CACCCGGCCAGCGGCTGCGGAGG - Intronic
1135615082 16:23904166-23904188 AACCTGGCCTGCAGCTAAGGGGG + Intronic
1136374116 16:29854966-29854988 TACCTGGCCTGCTGCAGTCAAGG - Intergenic
1137719313 16:50618681-50618703 ATCCTGCCCTGGGGCTGTGGGGG - Intronic
1138663808 16:58545422-58545444 TAGCTGTACTGTGGCTGTGGTGG + Exonic
1140475756 16:75238569-75238591 TGCCAGGCCTGCGGCTGCTGGGG - Intronic
1142429736 16:90019542-90019564 CACCTGTCCTGCGGCTGGGGGGG - Intronic
1144245215 17:13356108-13356130 TTCCTGGCCGGCGGGTGCGGTGG - Intergenic
1144865829 17:18335182-18335204 GGCCTGGCCTGTGGCAGTGGAGG - Intronic
1147374966 17:40017847-40017869 TGCCTGGCCAGGGGCTGGGGAGG + Intergenic
1147947513 17:44088349-44088371 TGAATGGCCTGGGGCTGTGGTGG - Intronic
1148566015 17:48633511-48633533 TACCTGGGCGGCGGCGGTGCCGG + Intronic
1148568463 17:48647480-48647502 TCGCTGGGCTGCGGCTGGGGCGG - Intergenic
1148857154 17:50585005-50585027 TACCTGGGCTGGGGCTGGGCAGG + Intronic
1152264295 17:79285088-79285110 TACCTGCCTTGCGGATGTGTTGG + Intronic
1153822674 18:8845549-8845571 TACCAGGGCTGCGGGGGTGGGGG + Intergenic
1156551476 18:38023635-38023657 TGCCTGGCCTGAGGCTGTGGTGG - Intergenic
1156943168 18:42795370-42795392 ACCCGGGCCAGCGGCTGTGGAGG + Intronic
1158697260 18:59714315-59714337 ACCCGGGCCAGCGGCTGTGGAGG - Intergenic
1160805396 19:990296-990318 GACCTGCACTGCGGCTTTGGGGG + Exonic
1161054722 19:2184571-2184593 CACCTGGCCTGCGGCTCTGCAGG - Intronic
1161623469 19:5311669-5311691 TCCCTGGCTGGCGGCTGGGGTGG + Intronic
1162199477 19:9010266-9010288 TACCTGGCCAGCAGGTGAGGAGG + Intergenic
1162230145 19:9259651-9259673 ACCCGGGCCAGCGGCTGTGGAGG + Intergenic
1162233111 19:9283676-9283698 AACCGGGCCAGCGGCTGTGGAGG - Intergenic
1163220038 19:15912056-15912078 TACTGGGCCCGCGGCTGCGGCGG - Intergenic
1163406417 19:17125919-17125941 CAGTTGGCCTGCGGATGTGGGGG - Intronic
1163636933 19:18441325-18441347 TCCTGGGCCTGCAGCTGTGGGGG - Intergenic
1163786601 19:19277907-19277929 CACCAGGGCTGGGGCTGTGGTGG + Intronic
1166735026 19:45079093-45079115 CACCTGGCCCGCGGCTTTGCGGG - Intergenic
1167644050 19:50696186-50696208 TCCTTGGCCTCCGTCTGTGGGGG - Intronic
1168056975 19:53869461-53869483 ACCCTGGGCGGCGGCTGTGGAGG - Exonic
925088699 2:1134945-1134967 CCCCTGGCCAGCGGCTGCGGAGG - Intronic
925532971 2:4884343-4884365 CACCCGGCCAGCAGCTGTGGAGG + Intergenic
926079045 2:9968865-9968887 TACCTGGCCTGCGGAACTAGTGG - Intronic
927718511 2:25368030-25368052 TACCAGGCCGGCGGCTGTGGTGG + Intergenic
928042353 2:27890844-27890866 TACCTGGACTGGGGCTGGTGCGG + Exonic
928432934 2:31235056-31235078 TACTTGGCCCTTGGCTGTGGTGG + Intronic
929595731 2:43174473-43174495 CGCCTGGGCTGGGGCTGTGGGGG - Intergenic
929890872 2:45917894-45917916 CACCGGGCCAGCGGCTGCGGAGG - Intronic
932095643 2:68846039-68846061 CAAATGGCCTGGGGCTGTGGGGG - Intergenic
932813675 2:74844672-74844694 TCCCTGGCCTGGGGCTGTCGAGG + Intronic
935586127 2:104801659-104801681 TAACTAGCCTCCTGCTGTGGAGG - Intergenic
937002372 2:118479277-118479299 AACCTGCCCTGCCACTGTGGGGG + Intergenic
937326125 2:120990331-120990353 TGACAGGCCTGTGGCTGTGGTGG - Exonic
938126082 2:128672347-128672369 ACCCTGGCCAGCAGCTGTGGAGG - Intergenic
941847523 2:170148412-170148434 TACCAGGCCTGCAGCTCTTGGGG - Intergenic
944012104 2:194984507-194984529 TGCCTGTCCTGTGGCTGTGCAGG - Intergenic
946085257 2:217164163-217164185 CACCTGATCTGAGGCTGTGGCGG + Intergenic
946819237 2:223613321-223613343 AACCTGGCCTTGGGCTGAGGAGG - Intergenic
948189596 2:236047389-236047411 GCCCTGGCCTGGGGCTGTGGAGG - Intronic
948506080 2:238427571-238427593 TCCCTGGTCTGTGCCTGTGGTGG - Intronic
948673836 2:239585345-239585367 TTCCTTGCCTGCTTCTGTGGGGG - Exonic
948698234 2:239744850-239744872 TCTCTGGCCTGGGGCTGTGCAGG + Intergenic
1170589698 20:17762527-17762549 CACCTGCCCTGCACCTGTGGCGG - Intergenic
1172434445 20:34919183-34919205 CACCTGGCCTCAGGCTGAGGAGG - Intronic
1172620209 20:36313589-36313611 GACTTGGCCTGCTGCTGGGGGGG + Intronic
1175252624 20:57618619-57618641 TGCCTGGTCTGCGGCTGCAGTGG + Intronic
1175751185 20:61499137-61499159 TCCCTGCACTGTGGCTGTGGAGG + Intronic
1176017535 20:62943446-62943468 TCCCTGGCCTGGGTGTGTGGGGG + Intronic
1177565828 21:22819062-22819084 ACCCTGGCCAGCGGCTGCGGAGG - Intergenic
1178821944 21:35983312-35983334 TGCTTGGCCTCGGGCTGTGGAGG - Intronic
1179769171 21:43601198-43601220 CAGCTGGCCTGTGTCTGTGGAGG - Intronic
1179833498 21:44012688-44012710 GACCAGGGCTGCGGCTGAGGCGG + Intronic
1179880993 21:44293291-44293313 CACAGGGCCTGGGGCTGTGGGGG + Intronic
1179999334 21:44987969-44987991 CAACTGGCCTGTGGCTGTGTGGG + Intergenic
1181522887 22:23459635-23459657 TGCCTGACCTGGGGCTGTGTGGG + Intergenic
1181603273 22:23964936-23964958 GACCTGGACTGGGGCTGGGGAGG - Intergenic
1181605241 22:23976371-23976393 GACCTGGACTGGGGCTGGGGAGG + Intronic
1183404828 22:37625240-37625262 TGCCAAGCCTGCAGCTGTGGGGG + Intronic
1183912860 22:41092129-41092151 CACCTGGCCGCCGGCGGTGGGGG + Exonic
1184856510 22:47149470-47149492 AGCCTGGCCTGTGGCCGTGGGGG - Intronic
1185385799 22:50530883-50530905 TCCCTGGTCCGCGGCAGTGGAGG - Intronic
950600379 3:14029717-14029739 ACCCGGGCCAGCGGCTGTGGAGG - Intronic
950608464 3:14107344-14107366 TCCCTGGACTAAGGCTGTGGGGG - Intergenic
954116662 3:48470383-48470405 TCCCTGCCCTGGGGCTGTTGTGG - Intronic
956739055 3:72260734-72260756 TGCCTGGCCTGCGGCTAGGGAGG - Intergenic
957419670 3:79951593-79951615 ACCCTGGCCAGCGGCTGCGGAGG - Intergenic
957556298 3:81767609-81767631 ACCCTGGCCAGCGGCTGCGGAGG - Intergenic
959289016 3:104449376-104449398 GAACTGGCCTGGGGCAGTGGTGG - Intergenic
961521135 3:127467925-127467947 GACCTGGCCTGCAGCTTGGGAGG - Intergenic
961554930 3:127691005-127691027 GGCCTGGCCTGCTGCTGTGCTGG + Exonic
965200343 3:165649539-165649561 ACCCGGGCCAGCGGCTGTGGAGG - Intergenic
967046836 3:185745285-185745307 TACCTGGCCTGCAGATGAAGGGG + Intronic
967746995 3:193067794-193067816 TCTCTGGACTGCGGCTGTGATGG + Intergenic
968232535 3:197012162-197012184 TCCTTGGCCTGAGGCTGGGGTGG + Intronic
968641479 4:1717124-1717146 TCCCTGCCCTGTGGCTTTGGGGG + Exonic
969439431 4:7208534-7208556 TCCCTTGCCTGCGGCTGCCGGGG - Intronic
969440742 4:7215267-7215289 ACCCGGGCCAGCGGCTGTGGAGG + Intronic
971043354 4:22778818-22778840 CACCCGGCCAGCAGCTGTGGAGG - Intergenic
976477324 4:85499572-85499594 TACCTAGCCTGCAGCCTTGGTGG + Intronic
981146723 4:141333240-141333262 ACCCGGGCCAGCGGCTGTGGAGG - Intergenic
983558206 4:169077036-169077058 TCCCTGGACAGCGGGTGTGGGGG + Intergenic
984192837 4:176625387-176625409 ACCCGGGCCAGCGGCTGTGGAGG - Intergenic
985653352 5:1117193-1117215 GGCCTGGCCTGCGGGGGTGGGGG + Intergenic
986661746 5:10065628-10065650 ACCCTGGCCAGCAGCTGTGGAGG + Intergenic
987358223 5:17083589-17083611 ACCCGGGCCAGCGGCTGTGGAGG + Intronic
989652937 5:43713688-43713710 TACCTGGCTTGAGGCTGAAGTGG - Intergenic
991425451 5:66487512-66487534 TACATGGCCTGAAGCTGTTGGGG - Intergenic
991601472 5:68355253-68355275 TACCTGGCCTGTAGCTTAGGAGG + Intergenic
992028015 5:72690520-72690542 TACCTGGTCCAGGGCTGTGGGGG + Intergenic
992255428 5:74916249-74916271 TACCTGGAATGCAGCTTTGGGGG - Intergenic
995946274 5:117650340-117650362 TACCTGGCTTGCACCTGTGCTGG + Intergenic
996433043 5:123402177-123402199 GGCCTGGGCGGCGGCTGTGGTGG - Intronic
998040357 5:138947481-138947503 TACCTGGCCTGCGGCTGTGGCGG - Intronic
998117537 5:139549482-139549504 ACCCTGGCCAGCCGCTGTGGAGG + Intronic
998417809 5:141958310-141958332 TAAGTGGCCTGCCGCTGAGGAGG + Exonic
999855282 5:155586973-155586995 ACCCAGGCCAGCGGCTGTGGAGG - Intergenic
1001865002 5:175096238-175096260 CACCAGGCCTGCTGCGGTGGTGG + Intergenic
1002464395 5:179399008-179399030 TACCAAGCCTGAGGCTGAGGGGG - Intergenic
1002772811 6:304035-304057 ATCCTGGCCTGGGGCTGGGGAGG + Intronic
1003403662 6:5810965-5810987 TCCCAGGCCAGGGGCTGTGGTGG + Intergenic
1003845729 6:10171863-10171885 ACCCGGGCCAGCGGCTGTGGAGG + Intronic
1003862792 6:10337550-10337572 ACCCGGGCCAGCGGCTGTGGAGG + Intergenic
1005059286 6:21761297-21761319 ACCCGGGCCAGCGGCTGTGGAGG + Intergenic
1005284514 6:24310927-24310949 GACCTGGCCTTGGGCTGTGGGGG - Intronic
1007097268 6:39221263-39221285 TACTTGGCCACAGGCTGTGGGGG - Intronic
1014788471 6:125644591-125644613 ACCCGGGCCAGCGGCTGTGGAGG + Intergenic
1016482318 6:144495371-144495393 CACCGGGCCAGCGGCTGTGGAGG - Intronic
1017298985 6:152834483-152834505 ACCCGGGCCAGCGGCTGTGGAGG + Intergenic
1017537372 6:155363208-155363230 ACCCGGGCCAGCGGCTGTGGAGG + Intergenic
1017581219 6:155866976-155866998 AACCGGGCCAGCGGCTGCGGAGG - Intergenic
1018686948 6:166310490-166310512 TACCTGGCCTGGTGATGAGGTGG - Intergenic
1018813478 6:167314455-167314477 TACTTCGCCTCAGGCTGTGGAGG + Intronic
1018914533 6:168125072-168125094 CTCCTGGCCTGCGTCTGAGGTGG - Intergenic
1019588438 7:1816902-1816924 TGCCTGACCTGGGGCTGTGTGGG - Intronic
1019725602 7:2600759-2600781 TACCTGTCATCCGGCCGTGGTGG + Intronic
1024156810 7:46634475-46634497 TTACTGGCCTTCTGCTGTGGTGG + Intergenic
1026053701 7:66967332-66967354 GACCTGGCCTGCGGGGGTAGGGG - Intergenic
1032789183 7:135229811-135229833 CACCTGTCTTGCAGCTGTGGTGG + Intergenic
1033195239 7:139321801-139321823 TCCCTGGCCTGCTGCTGTCCTGG - Intergenic
1033661925 7:143408491-143408513 TTGCTGGCCTGCGGGAGTGGGGG + Intronic
1034989777 7:155541124-155541146 TCCTTGGCCTGGGGCTGTTGGGG - Intergenic
1036049520 8:5180223-5180245 TACTTGGCCTGTGGTTCTGGAGG - Intergenic
1036930570 8:12951833-12951855 AAGCTGGCCTGCGGCCGCGGCGG + Intronic
1038117556 8:24574489-24574511 TACCTTCCCTGCAGCAGTGGTGG - Intergenic
1038640168 8:29317866-29317888 TATCCGGCTTGCCGCTGTGGAGG + Intergenic
1038980318 8:32752321-32752343 TCCCTGTCCTGTGGCTATGGGGG + Intronic
1039069113 8:33634054-33634076 ACCCGGGCCAGCGGCTGTGGAGG - Intergenic
1039550825 8:38441651-38441673 TAGATGCCCTGCGGCTATGGAGG + Intronic
1040380208 8:46865033-46865055 TTCCTGGCTTGGGGCTTTGGGGG + Intergenic
1044075820 8:87820973-87820995 ACCCGGGCCAGCGGCTGTGGAGG + Intergenic
1044444589 8:92259450-92259472 CACCTGACCTGGGGCAGTGGAGG + Intergenic
1046633556 8:116646491-116646513 ATCCTGGCAGGCGGCTGTGGTGG + Exonic
1048757500 8:137755342-137755364 ACCCGGGCCAGCGGCTGTGGAGG - Intergenic
1049020924 8:139957258-139957280 TACCTGCCCTGCAGCCTTGGGGG + Intronic
1049154150 8:141056705-141056727 TCCCTGGCGTGAGGCAGTGGCGG - Intergenic
1049198639 8:141329320-141329342 TGCCTGGCCTGGAGCTGTGGTGG + Intergenic
1049651437 8:143771633-143771655 TGCCTGGCCCCCGGCTGTTGCGG - Intergenic
1050291543 9:4160450-4160472 TGCCAGGCCTGCCGCTGTGCGGG - Intronic
1053027287 9:34740458-34740480 ACCCAGGCCAGCGGCTGTGGAGG - Intergenic
1053066425 9:35072365-35072387 CTCCCGGCCGGCGGCTGTGGCGG + Exonic
1056799435 9:89681229-89681251 ACCCTGGCCAGCAGCTGTGGAGG + Intergenic
1056831337 9:89919558-89919580 TCCATGGCATGCTGCTGTGGAGG + Intergenic
1057432269 9:95005046-95005068 TACCTCGCCCGCGGCCGGGGAGG - Intronic
1057502253 9:95605051-95605073 TGGCTGGCATGTGGCTGTGGTGG + Intergenic
1057546508 9:96022912-96022934 TAAGTGGCCTGTGTCTGTGGGGG - Intergenic
1062336863 9:136075122-136075144 TTCCTGGCCTGCCGCTTTGAGGG - Intronic
1062491097 9:136805256-136805278 TACCTGCCCAGCTGCTGGGGCGG - Intronic
1186152597 X:6690729-6690751 GCCCGGGCCAGCGGCTGTGGAGG - Intergenic
1187562764 X:20418339-20418361 TGCATTGCCTGCTGCTGTGGGGG + Intergenic
1189304911 X:39979637-39979659 CTCCTGGGCTGAGGCTGTGGTGG + Intergenic
1190375627 X:49785731-49785753 TACCTGGGATGCTGATGTGGTGG - Intergenic
1192360271 X:70434676-70434698 TACCTGACCTGCAGCTGGCGCGG + Intergenic
1196892270 X:120302672-120302694 TGCCTGCCCTGGAGCTGTGGAGG + Intronic
1198299982 X:135325592-135325614 ACCCGGGCCAGCGGCTGTGGAGG + Intronic
1200227777 X:154428644-154428666 CACCTGATCTGCGGCTGTCGAGG + Exonic
1201313582 Y:12621100-12621122 TTCCAGGCCTGCGGCTGGGGAGG - Intergenic