ID: 998041504

View in Genome Browser
Species Human (GRCh38)
Location 5:138953564-138953586
Sequence CCAGGCTGCTCTGCAGACAC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 511
Summary {0: 1, 1: 0, 2: 6, 3: 40, 4: 464}

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
998041504_998041513 4 Left 998041504 5:138953564-138953586 CCTGTGTCTGCAGAGCAGCCTGG 0: 1
1: 0
2: 6
3: 40
4: 464
Right 998041513 5:138953591-138953613 GGGCCAGAGTCCCTGGGGAAGGG 0: 1
1: 0
2: 11
3: 169
4: 1190
998041504_998041512 3 Left 998041504 5:138953564-138953586 CCTGTGTCTGCAGAGCAGCCTGG 0: 1
1: 0
2: 6
3: 40
4: 464
Right 998041512 5:138953590-138953612 TGGGCCAGAGTCCCTGGGGAAGG 0: 1
1: 0
2: 6
3: 75
4: 479
998041504_998041511 -1 Left 998041504 5:138953564-138953586 CCTGTGTCTGCAGAGCAGCCTGG 0: 1
1: 0
2: 6
3: 40
4: 464
Right 998041511 5:138953586-138953608 GAGATGGGCCAGAGTCCCTGGGG 0: 1
1: 0
2: 9
3: 44
4: 313
998041504_998041509 -3 Left 998041504 5:138953564-138953586 CCTGTGTCTGCAGAGCAGCCTGG 0: 1
1: 0
2: 6
3: 40
4: 464
Right 998041509 5:138953584-138953606 TGGAGATGGGCCAGAGTCCCTGG 0: 1
1: 0
2: 7
3: 20
4: 353
998041504_998041515 7 Left 998041504 5:138953564-138953586 CCTGTGTCTGCAGAGCAGCCTGG 0: 1
1: 0
2: 6
3: 40
4: 464
Right 998041515 5:138953594-138953616 CCAGAGTCCCTGGGGAAGGGAGG 0: 1
1: 0
2: 8
3: 63
4: 533
998041504_998041518 30 Left 998041504 5:138953564-138953586 CCTGTGTCTGCAGAGCAGCCTGG 0: 1
1: 0
2: 6
3: 40
4: 464
Right 998041518 5:138953617-138953639 CTGACAGCTCCTCTCCAGATAGG No data
998041504_998041510 -2 Left 998041504 5:138953564-138953586 CCTGTGTCTGCAGAGCAGCCTGG 0: 1
1: 0
2: 6
3: 40
4: 464
Right 998041510 5:138953585-138953607 GGAGATGGGCCAGAGTCCCTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
998041504 Original CRISPR CCAGGCTGCTCTGCAGACAC AGG (reversed) Intronic
900485563 1:2921070-2921092 TCTGGCTGCTCTGCAGGCTCCGG + Intergenic
900529970 1:3148342-3148364 CCAGGCAGCCCTGCAAACCCAGG + Intronic
901197621 1:7448930-7448952 CCAGGCTGTTTTGCACACACAGG + Intronic
901453240 1:9348857-9348879 CATGGCTGCTCTGGAAACACTGG + Intronic
901537101 1:9889600-9889622 GCAGGCGGATGTGCAGACACAGG - Intronic
901684506 1:10936152-10936174 CCTGGCTGCTGGGGAGACACAGG - Intergenic
901760348 1:11467045-11467067 CTAGGCTGATCTGCAGACAAGGG + Intergenic
902374333 1:16023219-16023241 CCAGGCTGGGCTGCAGCCAGCGG + Intronic
902542915 1:17167064-17167086 CCAGGATGCTCTGCAGGGAGTGG - Intergenic
902635176 1:17730096-17730118 CAAGGCAGCTCTGCTGACAAAGG - Intergenic
902731053 1:18369082-18369104 ACAGGCAGGTCTGCACACACCGG + Intronic
903026807 1:20435217-20435239 CCAGGTTGCTATGTAGAGACTGG + Intergenic
903741737 1:25562449-25562471 CCAGGCTGCTTTGGAGACCTGGG + Intronic
904567466 1:31436172-31436194 TCAGGCTGCTCTGAAGACAGGGG - Intergenic
904614977 1:31744668-31744690 CCAGGCTCATCTGCAGACCTCGG + Exonic
905168861 1:36098572-36098594 CCAGGAAGCCCTGCAGACCCAGG + Exonic
906079096 1:43071850-43071872 CCAAGCTGCTGAGCAGTCACAGG - Intergenic
906940625 1:50252156-50252178 CCAGCCTAAGCTGCAGACACTGG + Intergenic
907238843 1:53069638-53069660 CCAGGCTGCCCTCCAGAGGCGGG - Intronic
907271853 1:53295930-53295952 CCAGGCTGCTGTGTCAACACGGG - Intronic
907533926 1:55130591-55130613 CTAGGTTGCTCTGGAGAAACAGG + Intronic
908186531 1:61657758-61657780 CCTGGCTGCTCTGTAGAGAATGG + Intergenic
908739838 1:67316232-67316254 CCAGGGTGCTCTGAGGATACTGG + Intronic
909564479 1:77039424-77039446 ACAGCCTCCTCTGCAGACAGAGG + Intronic
913107217 1:115625534-115625556 CCAGGCTTCTCTGCAGGCCCTGG - Intergenic
914196750 1:145451726-145451748 CCAGGCCCTGCTGCAGACACAGG + Intergenic
915595176 1:156893103-156893125 CCAGGCTGGTCTCCAAACTCTGG + Intergenic
915764752 1:158351460-158351482 CCAGGCTGCAGTGCAGCCACAGG - Intergenic
915993404 1:160540274-160540296 CCAGGCTTATCTGCAAACGCTGG + Intergenic
916090431 1:161304824-161304846 AGAGGCTGCACTGCAGCCACAGG - Exonic
918100566 1:181369650-181369672 CCACACTGCCCTGGAGACACAGG + Intergenic
918210604 1:182347778-182347800 CCAGGCTGGTCTCCAGATCCTGG + Intergenic
918421948 1:184373161-184373183 CCAGGCTGCTGTGCAGCCTAAGG + Intergenic
918609590 1:186473128-186473150 CCAGGCTGCTCTCAAACCACTGG + Intergenic
919197582 1:194308735-194308757 CCAGGCTGCTCTCCAACAACTGG - Intergenic
919511625 1:198472417-198472439 CCAGGCAGCTCAGCACACAGAGG + Intergenic
920535282 1:206733135-206733157 CCAGGCTGTTGTGGAGAAACAGG - Exonic
921371538 1:214428097-214428119 ACTGGCTGCTTTGTAGACACTGG + Intronic
922507271 1:226133800-226133822 CCTGGCTGTGCTGCAGAGACTGG + Intergenic
922511613 1:226172846-226172868 CCAGGCTTCTCTGGAGGCTCAGG + Intronic
922543894 1:226440550-226440572 CCAGGCTGGAGTGCAGAGACTGG + Intergenic
923160273 1:231308866-231308888 CCAGGCTGCTCTTCAACCGCTGG - Intergenic
923199200 1:231695048-231695070 GCAGGCTCCTCTGCAGGCCCCGG + Intronic
923879931 1:238092550-238092572 CCAGCCTCCTTTGCAGACAGGGG - Intergenic
1063292380 10:4762453-4762475 TGAAGCTGCTCTGAAGACACAGG - Intergenic
1064739127 10:18414075-18414097 CCAGGCAGCTCTGCAGTCCCTGG - Intronic
1065679783 10:28217317-28217339 CCAGGCTGGTCTGAAGATCCTGG - Intronic
1066165938 10:32788452-32788474 CCAGGCCAGTCTGCAGATACTGG + Intronic
1066335052 10:34467886-34467908 CCAGGCTCTTCTGCAGAGAAGGG + Intronic
1066372134 10:34826168-34826190 CCAGGCTCTTCTGCAGATAAGGG + Intergenic
1067343796 10:45423915-45423937 CCAGGCAGCTCTGCAGAGGTAGG - Intronic
1069592864 10:69652661-69652683 CCAGGCATCTCTGCAGTCTCTGG + Intergenic
1069595811 10:69669390-69669412 GCTGGCTGCTCTGCCGACAGTGG - Intergenic
1069655261 10:70083142-70083164 CCAGCCAGCTCTGGAGACCCCGG - Intronic
1069862670 10:71481279-71481301 CCTGGCTGCTCTGCACCCTCTGG - Intronic
1070326872 10:75395473-75395495 CCAGGCGGCGCTGCAGAGCCCGG - Intergenic
1070359363 10:75672393-75672415 CAAGGCTGCTTTGAAGGCACTGG + Intronic
1070832260 10:79425266-79425288 CCATGCCGCCCTGCAGTCACTGG + Intronic
1073322140 10:102621916-102621938 CCAGGCTGCACTGCAGGCAGGGG - Intronic
1073426256 10:103457474-103457496 CCAGCCTGCTCTGCAAGGACTGG - Intronic
1074876722 10:117619331-117619353 CCCGGCTCCTCTGCAGACTCAGG - Intergenic
1075188747 10:120286694-120286716 CTAGGCTGCACTGCTGACTCGGG - Intergenic
1075259369 10:120949455-120949477 ACAGCCTCCTCTGCAGACACAGG - Intergenic
1076832981 10:133006248-133006270 CCAGGCTCACCTGGAGACACAGG + Intergenic
1077320367 11:1938324-1938346 CCAGGCTGCTCTCAGGGCACAGG - Intronic
1077323311 11:1952178-1952200 CGTGGCTGCTGTGCGGACACGGG + Exonic
1077432122 11:2520908-2520930 CCAGGCTGATAAGCAGACAATGG - Intronic
1078860969 11:15245908-15245930 CCAGGCTGCTCTGCGTAGATTGG + Exonic
1078934739 11:15941034-15941056 CCAGGCTGCTGGGCAGGCAGAGG - Intergenic
1080457742 11:32431117-32431139 CCCGGCTTCTCTGCAGCCGCCGG - Intronic
1080461611 11:32459594-32459616 CCAGGCTCTCCTGCACACACTGG + Intergenic
1080641517 11:34161179-34161201 GCGGGGTGCTCTGCAGACAGCGG - Intronic
1081733145 11:45385304-45385326 CCAGGCCCCTTAGCAGACACAGG + Intergenic
1081734477 11:45393518-45393540 CAAGGCTGCACAGCAGCCACAGG + Intergenic
1082172341 11:49020928-49020950 CCAGGCTGGAGTGCAGTCACTGG + Intergenic
1082214152 11:49546861-49546883 TCATGCTGCTGTGAAGACACAGG - Intergenic
1083137220 11:60690800-60690822 CCAGGCTGGTCTGCAGTGGCAGG - Intergenic
1083322729 11:61857301-61857323 CCAGCCTTCTCTGCAGGCCCCGG + Intronic
1084317749 11:68355138-68355160 CCATGGTGCTCTGCAGCCTCAGG - Intronic
1084502698 11:69544330-69544352 CTGGGCTGCCCTGCAGACAACGG - Intergenic
1084574190 11:69978024-69978046 CCAAGCTGCCCTGGGGACACCGG - Intergenic
1088146409 11:106685679-106685701 CCAGTCTGCTCTGCTCATACTGG + Intronic
1088877463 11:113947842-113947864 CCAGCCTACTCTGCAGAATCTGG - Intergenic
1088952863 11:114588474-114588496 ACAGGCAGCTCTGCAGGCAGGGG + Intronic
1089192198 11:116661139-116661161 ACAGGCTGCCCTGCATACCCTGG - Intergenic
1089404683 11:118187674-118187696 CCAGGCTGGTCCGCAGAGGCTGG + Intergenic
1089891607 11:121886985-121887007 CCAGGCTGCTAAACAGACCCTGG + Intergenic
1090137102 11:124209981-124210003 CCAGGCATCTCTGCAGACTTGGG - Intergenic
1091234140 11:134008480-134008502 CAAGGCTGCTCTGATGGCACAGG + Intergenic
1202806299 11_KI270721v1_random:7373-7395 CGTGGCTGCTGTGCGGACACGGG + Intergenic
1091706266 12:2695454-2695476 ACAGGCTGCTGTGCAAAGACAGG + Intronic
1092761764 12:11817069-11817091 ACAGGCTGGTCTGCAAACCCCGG + Intronic
1092948656 12:13480086-13480108 CCAGGTTCCTCTACAGACAGTGG + Intergenic
1093419918 12:18963965-18963987 CCAGGCAGCTCAGCACAGACAGG - Intergenic
1094144517 12:27214521-27214543 GCATGCTGCTATGAAGACACAGG + Intergenic
1094365234 12:29672809-29672831 CTTGGCTGCACTGCAGACAAAGG + Intronic
1095119401 12:38398394-38398416 CCAGGGTGCTCAGAAGGCACTGG - Intergenic
1095169814 12:39020509-39020531 CCAGGCAGCTCAGCAGAGAGAGG + Intergenic
1095542424 12:43326028-43326050 CCTGCCTGCTCTGCAGACCCTGG - Intergenic
1096256271 12:50064005-50064027 CCAGACTGCCATGCAGACAGGGG + Intronic
1097320471 12:58220289-58220311 TCTGGCTGCTCTGCAGAGAATGG - Intergenic
1098521549 12:71439721-71439743 CCAGGCTGCGCTGACGTCACTGG + Intronic
1098742597 12:74193081-74193103 TCAGGCATCTCTGCTGACACCGG + Intergenic
1102340191 12:112115456-112115478 CCAGCCAACTCTGCAGACTCCGG - Intergenic
1103919174 12:124390578-124390600 CCAGGGTGCTCAGCAGGCCCCGG - Intronic
1103980446 12:124733687-124733709 CCACCCTCCCCTGCAGACACAGG + Intergenic
1104202905 12:126609200-126609222 CATGTCTGCTCTACAGACACAGG + Intergenic
1104769918 12:131354946-131354968 CCAGGCTGCACTGCAGAGAGAGG + Intergenic
1105303081 13:19152344-19152366 CCAGCCTTCTCTGAAGACAGTGG + Intergenic
1105303342 13:19153669-19153691 CCAGGGGGCTCTCCACACACTGG + Intergenic
1105779009 13:23690231-23690253 CCCGGGTGCACTGCAGACACTGG - Intergenic
1107579638 13:41769114-41769136 CCAGGCTGGTCTGCAGCTTCTGG + Intronic
1107934683 13:45335703-45335725 CCAGGCTGGTCTGAAAACTCTGG - Exonic
1109984688 13:69964249-69964271 CCAGGCTGGTCTGGAGCTACTGG + Intronic
1110183612 13:72646358-72646380 CCAGGCTGGAGTGCAGACAGAGG - Intergenic
1111328963 13:86737439-86737461 CCAGTCTGTCCTGCAGACCCTGG + Intergenic
1111929294 13:94497294-94497316 CCAGGCTACTCTGCAGATCTTGG + Intergenic
1112758499 13:102667827-102667849 CGAGTCTGCCCTGCAGACTCTGG + Intronic
1113780427 13:112973705-112973727 CCGGCCTGCTCTGAGGACACTGG + Intronic
1117740549 14:58814861-58814883 CCAGACTGCTCTGCAGATTTTGG + Intergenic
1117748024 14:58891367-58891389 GCAGGCTGCCCTGGAGAAACAGG - Intergenic
1117782073 14:59243639-59243661 CCAGGCTGTTGTGCAGAAAGAGG - Intronic
1120919314 14:89740572-89740594 GAAGGCTGCTGTGAAGACACAGG - Intergenic
1121011131 14:90520900-90520922 TCAGGCTTCTCTGAAGACAGGGG + Intergenic
1121036055 14:90704568-90704590 CCAGGCTGCTCTCCTGTCCCTGG - Intronic
1121700855 14:95953107-95953129 CCAGGCTTCTCTGCACAAACAGG + Intergenic
1122184731 14:99982811-99982833 CCAGGCTGCTCAGTATACAGGGG - Intronic
1122269226 14:100560927-100560949 TCAGGTTGCTTTGCAGACACGGG + Intronic
1122519642 14:102334243-102334265 CCAGGCTGCGCCGCATACTCAGG - Intronic
1122672024 14:103379737-103379759 CCAGGCTGCTCCCCCCACACCGG - Intergenic
1122717076 14:103702247-103702269 GCTGGCTTCCCTGCAGACACTGG - Intronic
1122876197 14:104666445-104666467 CCAGGGTGCTCTGCAGCCAGGGG - Intergenic
1123117039 14:105899509-105899531 CCAGGCTGCCCTGCTGTCCCTGG - Intergenic
1123880455 15:24674595-24674617 CCAGTCTCCTCTGAAGACATGGG - Intergenic
1124654797 15:31499456-31499478 CCAGGATGAGCTGCAGACTCAGG - Intronic
1124694543 15:31853026-31853048 CCAGGCTGCTCTGCAAGGAAGGG + Intronic
1124803227 15:32855576-32855598 GCTGGCTGCTTTGCAGACGCAGG + Intronic
1125972567 15:43923706-43923728 ATAGGCAGCTCTGCAGACACAGG - Intronic
1126437269 15:48648129-48648151 CTGGGCTGCTCTGCACCCACAGG + Intergenic
1126440669 15:48684258-48684280 CCAGGCAGCTCAGCATAGACAGG + Intergenic
1128074728 15:64819018-64819040 CCAGGCCACTCTGCAGCCAGTGG - Intronic
1128086369 15:64889258-64889280 CCATGCTGGTTTGCAAACACAGG - Intronic
1128176395 15:65560084-65560106 CCAGGCTGATCTTAAGATACTGG + Intronic
1128685473 15:69681299-69681321 CCAGGCTGCTCACCATCCACAGG - Intergenic
1128791197 15:70435151-70435173 CCAGACTGCTCTGGAGACCATGG + Intergenic
1128931112 15:71705637-71705659 CCTGGCTGCTGTCCTGACACAGG - Intronic
1129107546 15:73319990-73320012 CCTGGCCACTCTGCAGAGACTGG - Exonic
1129287812 15:74540198-74540220 CCAGGCTGCTCTCCAACTACTGG + Intergenic
1129876249 15:78977481-78977503 CTAGGCTGCTCTGTGGTCACAGG + Intronic
1130882961 15:88070712-88070734 CCAGGCTTCCCTGCAGACCTAGG - Intronic
1131240942 15:90742843-90742865 CCAGGCTGCTCTGCAGCTCCTGG + Intronic
1131578594 15:93617612-93617634 GCAGCCTGCTCTGCTGACAGTGG - Intergenic
1131624939 15:94107894-94107916 CCATGCTAGTCTGCTGACACTGG + Intergenic
1132558751 16:584098-584120 CGAGCCTGCGCTCCAGACACGGG - Exonic
1133131311 16:3677631-3677653 CCTGGATGCTCTGCAGAACCAGG - Exonic
1133133069 16:3690049-3690071 CCAGGCTGCTATGCAGTGGCAGG + Intronic
1133263479 16:4568500-4568522 CCAGGCTGCTCTGGAACCCCTGG + Intronic
1133315933 16:4884085-4884107 CCAGGCTGCTCTTGAGCCTCTGG + Exonic
1133477515 16:6137816-6137838 CCAGGCTGCTCTTGAAACTCCGG + Intronic
1134443577 16:14313998-14314020 CCAGGCTGGTCTGCAACCCCTGG - Intergenic
1134539557 16:15054069-15054091 CCGGGCTGCTCCGGAGAAACTGG + Intronic
1135333361 16:21580309-21580331 CCAGGCTGGTCTTGAGCCACTGG - Intergenic
1136289800 16:29264741-29264763 CCATGCAGTTCAGCAGACACAGG - Intergenic
1136509019 16:30724446-30724468 CCCGGCTTCTACGCAGACACTGG + Exonic
1138178947 16:54929824-54929846 CCACGCTCCACTGCAAACACTGG - Intergenic
1138405501 16:56789524-56789546 GCAGGCAGCTCTGGAGCCACAGG - Intronic
1139643641 16:68311277-68311299 CCCGGCTGCACTGCAGAGCCGGG - Exonic
1139778717 16:69333375-69333397 CCAGGCTGGTCTGGAGCCCCTGG + Intronic
1139902926 16:70342333-70342355 CCAGGCTCCTCTTCCCACACAGG - Intronic
1140457675 16:75114455-75114477 GCGGGCTGCCCTGCAGAGACCGG - Intronic
1141137582 16:81476548-81476570 CATGGCCACTCTGCAGACACCGG - Intronic
1141593912 16:85086165-85086187 TCAGGCTGGTCAGGAGACACAGG + Intronic
1141921270 16:87137155-87137177 CCAGGCTGCCCTCCAGTCATTGG + Intronic
1142095684 16:88238217-88238239 CCATGCAGTTCAGCAGACACAGG - Intergenic
1142406664 16:89893983-89894005 CCAGACCGCCCTGCAGAGACTGG - Intronic
1142608150 17:1093498-1093520 CTACGTTGCTCTGCAGACCCAGG + Intronic
1142627711 17:1203214-1203236 CCAGGATCCTCTGCTCACACCGG - Intronic
1142811598 17:2398025-2398047 CCCAGGTGCTCTGCAGGCACAGG + Intronic
1143094349 17:4469294-4469316 CCAGGCTGCTCTGGAACTACTGG + Intronic
1143720181 17:8803744-8803766 CCAGTCCCCTCTGCAGGCACGGG - Intronic
1144467609 17:15508861-15508883 CCAGGGTGCTGTCTAGACACTGG - Intronic
1146115177 17:30130306-30130328 CCAGGCTGTTCTGGAGCCCCTGG + Intronic
1146549651 17:33769339-33769361 GTTGGCTGCTCTGCTGACACAGG - Intronic
1146659984 17:34659166-34659188 TCAGGCTGCTCTGGAAACAGAGG - Intergenic
1147202834 17:38814954-38814976 GCAGGCTGCTCTTCTGAAACAGG - Exonic
1147338602 17:39740936-39740958 CCAGCCTGTTCTCCAAACACTGG - Intronic
1147861255 17:43525001-43525023 CCAGGCTGCTCTCCAATCCCTGG + Exonic
1148716526 17:49719825-49719847 CCAGGCTCCTGTGCAGGCAGGGG + Exonic
1148813345 17:50309037-50309059 CCCTGCTTCTCTCCAGACACCGG - Intergenic
1148823023 17:50371605-50371627 CAAGGCTTCTCTAAAGACACTGG - Intronic
1149530618 17:57392038-57392060 CCAGGCTGCTCTGCATCTGCAGG - Intronic
1149658469 17:58322677-58322699 CCAGCTTGCTCTGCAGGCCCTGG + Exonic
1150486219 17:65545827-65545849 CCTGCCTGCTCTGCACACTCAGG + Intronic
1151007288 17:70452299-70452321 CCAGGTTGATATGTAGACACAGG - Intergenic
1151112507 17:71695830-71695852 CCAGACTGCACTGCAGAGAGAGG + Intergenic
1151562663 17:74878927-74878949 CCATGCTGCTGTGGATACACTGG + Intronic
1151584636 17:75001684-75001706 CCAGGCTCTTCTTTAGACACTGG + Intronic
1152097600 17:78280990-78281012 TCTGGGTGCTCTGCAGACCCAGG + Intergenic
1152317805 17:79591032-79591054 CCAGGGTCCCCGGCAGACACGGG - Intergenic
1152475337 17:80514129-80514151 GCAGCCTGCCCTGCAGACTCCGG - Intergenic
1152579806 17:81160828-81160850 CCACGCTGTTCTGCTGTCACCGG - Intronic
1152664208 17:81558008-81558030 CTGGGCTGCTCTGCACCCACGGG - Exonic
1152915984 17:83036245-83036267 CCAGGCTGCTAAGCAGAGAAGGG + Intronic
1156260924 18:35444483-35444505 CAAGGTTGATGTGCAGACACAGG + Intronic
1156383536 18:36585566-36585588 CCAGACAGGTCTCCAGACACAGG + Intronic
1156539571 18:37896324-37896346 CCAGGCAACTTTTCAGACACAGG - Intergenic
1157856596 18:51110375-51110397 CCAGCCCGCCCTGCAGACCCTGG - Intergenic
1157963130 18:52179203-52179225 CCAGGGAGCTCTGCAGCCAGAGG + Intergenic
1158490556 18:57906179-57906201 CCAGGCTGCTGTGCACCCTCAGG + Intergenic
1159174507 18:64815427-64815449 GCAGGCAGCTCTGCAGGCAGCGG + Intergenic
1160442550 18:78903452-78903474 CACGGCTGCTCTGGAGACCCAGG - Intergenic
1160828408 19:1091357-1091379 CCAGGCTGCTGTGCTGTGACGGG - Intronic
1161024222 19:2028113-2028135 CCAGGCTGGTCTGGAGCCCCTGG - Intronic
1161043060 19:2120383-2120405 CCAGGCCCCTCTGGAGGCACAGG - Intronic
1161197044 19:2992734-2992756 CCAGGCTGGACTACAGTCACTGG - Intronic
1161237552 19:3205354-3205376 CCACTCTGCTCTGCGGTCACTGG + Intronic
1162290580 19:9777022-9777044 CCTGCCTGCTCTGCATACCCCGG - Intronic
1163267341 19:16228966-16228988 CCAGGCTGCCTTGCAGAGACAGG - Intronic
1163321258 19:16576341-16576363 GCAGGCTGCTCTGCCGGCTCAGG + Exonic
1163364528 19:16868684-16868706 CCAGGCTGCTCAGAAGACGCCGG - Intronic
1163404503 19:17113759-17113781 CTGGGCTGCTCTGCAGACCCAGG - Intronic
1163637267 19:18443112-18443134 GCAGGCAGCCCTGCAGACACCGG - Exonic
1163870994 19:19821334-19821356 CCGGGCAGCTCTGCACCCACAGG - Intronic
1164830995 19:31320709-31320731 CCTGGGTGCACTGCAGACTCAGG - Intronic
1165103004 19:33450013-33450035 CAAGGCTGGTCTGCACACAGTGG - Intronic
1165205967 19:34186475-34186497 CCAGCCTGCTCTGCAGATTTTGG + Intronic
1165452302 19:35890652-35890674 CCAGGCTGGTCTGCAGCTCCTGG - Intronic
1166761382 19:45226478-45226500 CCAGGCTGCAGTGCAGTGACGGG + Intronic
1166938560 19:46349674-46349696 CCTGGCTGCCATGCAGAGACTGG + Intronic
1167226998 19:48251828-48251850 CCAGTCTCCTCTGCAGACACCGG + Intronic
1167772521 19:51530140-51530162 CCAGGCTGTCCTGCAGAGAGTGG + Intronic
1168105681 19:54164550-54164572 CCAGGCTGCGGTGCGGACGCTGG - Exonic
1168528227 19:57105704-57105726 CCAGGCTGGTCTGCAGCTCCTGG + Intergenic
1168648452 19:58076964-58076986 CCAGGTAGCTCTTGAGACACAGG - Intronic
1202705319 1_KI270713v1_random:18754-18776 CCAGGCTGGTCTGCAACCGCTGG + Intergenic
925175097 2:1777436-1777458 CGGGGCTGCTGTGCAGACAGAGG + Intergenic
925410287 2:3635797-3635819 CCAGGCTGCTCTCCTGATGCTGG - Intronic
926162320 2:10497837-10497859 CCAGGGTGCTCGGCATCCACGGG - Intergenic
926226252 2:10968848-10968870 CCATGGTGCTCTGCAGGCAGAGG - Intergenic
926579464 2:14618817-14618839 CCACCGTGCTCTGCAGACAGTGG - Intergenic
926889444 2:17626575-17626597 CTTTGCTCCTCTGCAGACACAGG - Intronic
927109521 2:19854407-19854429 CCAGCCTGCTCTATAGAAACAGG - Intergenic
927300047 2:21501786-21501808 CCTGGGTGCTCTGCGGAAACAGG - Intergenic
927812616 2:26188361-26188383 TGAGGCTGCTCAGCAGCCACTGG + Exonic
929210563 2:39352245-39352267 CCAGGCTGCTGTGCAGTGGCAGG - Intronic
929707987 2:44235853-44235875 CCAGGCTGCTGTGCAGTGGCTGG - Intronic
930489334 2:52048123-52048145 CCAAGCTGATCTGCAGACTCAGG + Intergenic
930765963 2:55085393-55085415 CCAGGCTGCCCTGCAGATTTTGG - Intronic
932628643 2:73319351-73319373 CCAGCCTTCACTGCAGACAAAGG - Intergenic
932818806 2:74882212-74882234 CCAGGCTGTTCTGCTGGCAGGGG - Exonic
933688653 2:85162388-85162410 CCAGGCTGCTCTGTGGATCCAGG + Intronic
934524499 2:95043224-95043246 CCAGGCTGCTCTGCCCACTCGGG + Intronic
934652188 2:96099048-96099070 CCAGGCTACTCTCCAGGGACAGG + Intergenic
934789589 2:97047302-97047324 CCAGGCTGCTCTTGAGATCCTGG + Intergenic
934816882 2:97335238-97335260 CCAGGCTGCTCTTGAGATCCTGG - Intergenic
934820814 2:97373246-97373268 CCAGGCTGCTCTTGAGATCCTGG + Intergenic
935616664 2:105091387-105091409 CCATGCTCCTCTCCAGTCACTGG - Intronic
935694090 2:105756026-105756048 ACAGGCAGCTTTGCAGACACTGG - Intronic
936806480 2:116338423-116338445 CCAGCCAGCTCTGCAGCCATAGG - Intergenic
937052352 2:118902676-118902698 CCAGGCCACTTTGGAGACACTGG - Intergenic
937262930 2:120597939-120597961 CCTGGCTGCCCTGGAGACACGGG + Intergenic
937408070 2:121649133-121649155 CCAGGCTGCTTTGCAGAGGGAGG - Intronic
937925098 2:127162119-127162141 CCTAGCTGCTCTGCAGCCCCAGG + Intergenic
938324378 2:130388436-130388458 CCTGGCTGCTCTCCAGAGAGTGG + Intergenic
938417543 2:131116658-131116680 CCAGGCCCCTCTGCCAACACTGG + Intronic
938575237 2:132597250-132597272 CCAGGCAGCTCTGCTTACATTGG + Intronic
938623001 2:133076889-133076911 CCAGACTCCTCTGCAGAAAGAGG - Intronic
938661238 2:133489266-133489288 TCAGCCTTTTCTGCAGACACAGG + Intronic
940009068 2:149036627-149036649 CAAGGCTGCTCAGCAAGCACAGG + Intergenic
940052928 2:149483016-149483038 CCAGGGGACTCTCCAGACACAGG - Intergenic
944240913 2:197484156-197484178 CCAGGCTGGAGTGCAGACAGTGG - Intergenic
944688830 2:202141074-202141096 ACAGGGTGCTCTGCAGAGGCTGG + Intronic
946172440 2:217903519-217903541 CCTGGCTCCTCTCAAGACACAGG + Intronic
947530662 2:230906934-230906956 CCTGGCTTCTCTGCATACACAGG - Intergenic
948125718 2:235563501-235563523 CCAGGGTCCTCAGCACACACTGG + Intronic
948159878 2:235814857-235814879 TCTGGCTGCTCTGCAGAGAAGGG + Intronic
948567536 2:238896354-238896376 CCAGGCTGCGCTGGAATCACAGG + Intronic
948727759 2:239945223-239945245 GCAGGCCGCTCTGCAGACGCTGG + Intronic
1168828497 20:830802-830824 CCAGGCTGGTCTGAAGCCCCTGG + Intergenic
1169081118 20:2798282-2798304 CCAGGCCTGACTGCAGACACAGG + Exonic
1169209200 20:3756229-3756251 CCTGGCTGCCCTGCTGGCACTGG + Intronic
1170214416 20:13876583-13876605 CCAGGCTACTCTGCAGCCACAGG + Intronic
1170392819 20:15893929-15893951 CCAGACTGCACTGCAGACTGAGG - Intronic
1171397118 20:24842593-24842615 CCTCGCTGCTCAGCAGAAACAGG - Intergenic
1172526219 20:35601874-35601896 CCAGGCTGCCCAGCAGCCCCAGG + Intergenic
1172902723 20:38346684-38346706 CCAGGCTGCTCTGGGTACAGTGG + Intronic
1173870623 20:46339741-46339763 CCAGCCTCCTCTGCAGTGACGGG + Intergenic
1173947892 20:46965962-46965984 CCAGCTTTCTCTCCAGACACTGG - Intronic
1174207811 20:48853844-48853866 CCTGGCTGCCCTGCAGACCTTGG + Intergenic
1175183484 20:57164830-57164852 GGAGGTTGCTCTGCAGAGACTGG - Intergenic
1175515599 20:59567861-59567883 ACACGCTGCACTGCAGCCACTGG - Intergenic
1176376078 21:6087412-6087434 CCAAGGGGCTGTGCAGACACGGG + Intergenic
1178669091 21:34575177-34575199 CCAGGTAGCTGTGCAGACAGAGG - Intronic
1179072101 21:38081225-38081247 CAAAGCTGCTCCACAGACACGGG + Intronic
1179249751 21:39663026-39663048 CCTGGCTGCTCTGAACGCACTGG + Exonic
1179297318 21:40074979-40075001 CCCTGCTGCTCTGCAGCCAATGG - Intronic
1179747397 21:43450832-43450854 CCAAGGGGCTGTGCAGACACGGG - Intergenic
1179799394 21:43803841-43803863 CCGGGCTGTTCTGTAGACTCAGG + Exonic
1180782658 22:18529602-18529624 CCAGGACGCGCTGCAGACAGCGG + Exonic
1180899938 22:19363395-19363417 CCAGGCTGCTCTCAAGCCTCTGG - Intronic
1181010358 22:20036769-20036791 CAGGGCGGCTCTGCTGACACAGG - Exonic
1181126218 22:20703629-20703651 CCAGGACGCGCTGCAGACAGCGG + Intergenic
1181239548 22:21468940-21468962 CCAGGACGCGCTGCAGACAGCGG + Intergenic
1181310861 22:21944001-21944023 CCAGGGAGTTCTGCAGCCACTGG - Intronic
1181431134 22:22882518-22882540 CTGGGCTGCTCTGCAGAGGCTGG - Intronic
1182517545 22:30867555-30867577 ACAGTCTGTTCTGCAGAGACAGG - Intronic
1183438650 22:37810085-37810107 CCAGGCAGGTCTGCAGGCTCTGG + Exonic
1183751635 22:39724246-39724268 CCATGCGGCTCTGCAGTCTCTGG + Intergenic
1183993982 22:41619801-41619823 CCTGGCTTCTGTGGAGACACTGG - Intronic
1184874304 22:47263375-47263397 CCAAGCTGACCTGCACACACAGG + Intergenic
1185053854 22:48567792-48567814 CCAGGCCACCCTGCAGACAGCGG - Intronic
1185117053 22:48944002-48944024 CCAGGCTGCTCAGCTGAGCCGGG - Intergenic
1185131101 22:49039326-49039348 CCCCGCTGCTCTCCAGACCCTGG + Intergenic
949132486 3:521371-521393 GCAGGCAGCTCTGCAGACTATGG + Intergenic
950273196 3:11635705-11635727 CCAGCCTGGTCTCCAGAAACTGG + Intronic
950631471 3:14284858-14284880 CCCTGCTGCTCTGGAGGCACTGG + Intergenic
951587705 3:24232397-24232419 CCAGTCTACTCTGAAGAGACAGG - Intronic
951801140 3:26597125-26597147 CCAGGCTGCTTTATAGACAGGGG + Intergenic
953016121 3:39078460-39078482 CCAGGCTGGACTGCAGTGACGGG + Intronic
953881939 3:46695160-46695182 CCAGGCTGTGCTGTAGACTCAGG - Intergenic
953980040 3:47409053-47409075 CCGGGCTGCCCTGCCCACACCGG + Exonic
953991324 3:47485694-47485716 CCAGGAGGCTCTACAGCCACTGG - Intergenic
954876970 3:53808680-53808702 CCTGGCTGCTCTGCCGGCGCAGG - Exonic
954960746 3:54562711-54562733 CCACGCTGCTTGGCAGATACTGG - Intronic
955248879 3:57257376-57257398 CCAGGCTGATCTTCACACACAGG - Exonic
955283428 3:57616111-57616133 CCAGGCTGCTCTCCAACTACTGG - Intergenic
955491077 3:59483405-59483427 CGAAGATGCTCTGCTGACACTGG - Intergenic
958752161 3:98204180-98204202 CCAGGCCCCTCTGCTAACACTGG + Intergenic
960900713 3:122551646-122551668 CCAGGCTCCACTGCAGGCATGGG + Intronic
961253816 3:125528631-125528653 CCAGGCTGATCTGCATGCAGTGG - Intergenic
961349242 3:126288499-126288521 CCAGGCTGGGCTGCAGAAGCAGG - Intergenic
961454514 3:127017412-127017434 CCAGGCAGCCCTGGAGACACAGG - Exonic
961846641 3:129770304-129770326 CCAGGCTGCTCTCCAGCTCCTGG - Intronic
961866171 3:129954949-129954971 CCTGACTGCTCTGCAGTCAGCGG - Intergenic
965299459 3:166991428-166991450 CCAGGCTGCTCTCCAAATACTGG - Intergenic
965773095 3:172201301-172201323 TCTGGCTGCTCTCCAGACCCTGG + Intronic
966309122 3:178574266-178574288 TCAGGCTGCACTGAACACACAGG + Intronic
966421448 3:179738672-179738694 CCAGGATGCTCTGAAGAGGCAGG - Intronic
967100712 3:186213300-186213322 CCTGGCTGCTCTGCAGGCTGAGG - Intronic
967254312 3:187574078-187574100 CCTGGGTGCCCTGCAGACAGCGG + Intergenic
967556049 3:190860611-190860633 CCATGATGCTCCGCAGCCACGGG + Intronic
967814462 3:193787431-193787453 CACGCCTGCTCTGCAGACAGAGG + Intergenic
968441905 4:628564-628586 CCTGCCTGCCCTGCAGACTCAGG - Intronic
968921601 4:3524997-3525019 CCACGCTGATCTGAAGATACAGG - Exonic
968969412 4:3785798-3785820 CCAGGCTGGTCTCCAGCCTCTGG + Intergenic
969174826 4:5390510-5390532 CCAGGCTGCTATTCAGAAAAGGG - Intronic
969264626 4:6056403-6056425 CCAGGCCACTCTGCAGAAATGGG - Intronic
969463152 4:7339484-7339506 CCAGGCTGCTCTGCAACTTCTGG + Intronic
969466109 4:7357437-7357459 CCAGGCTTCTCTGCCAACATGGG - Intronic
969617810 4:8263522-8263544 TCAGGGTGCAGTGCAGACACCGG - Intergenic
969870692 4:10102726-10102748 ACAGGCTGCTGTGCACACGCAGG + Intronic
971630027 4:28979246-28979268 CCAGCCTGCTCTAGAGACAATGG - Intergenic
973005962 4:45007164-45007186 CCAGGCTGCTCTGGAGGCTGAGG + Intergenic
975657319 4:76654536-76654558 CCAGGCTGCCATGCAGAAAATGG + Intronic
976444221 4:85111238-85111260 CCAGGCAGCTCAGCACAGACAGG + Intergenic
978192475 4:105930798-105930820 CCAGGCAGCTCTAAAGGCACTGG - Intronic
982067431 4:151666639-151666661 CCAAGCTGATTTGGAGACACTGG - Intergenic
982892601 4:160875117-160875139 CCAGGCTGGTCTGCAGCTCCTGG + Intergenic
983684166 4:170388515-170388537 CCAGGCTTCTCAGCAGAATCTGG + Intergenic
984417868 4:179483730-179483752 CCAGGCTGGTCTCCAGCCCCTGG + Intergenic
984965255 4:185134254-185134276 CCAGGCTGCTCTCCAACCCCTGG + Intergenic
985495317 5:201019-201041 GCAGCCTGCTGTGTAGACACTGG - Exonic
985495325 5:201058-201080 GCAGCCTGCTGTGTAGACACTGG - Exonic
985524166 5:393522-393544 CCACGTGGCCCTGCAGACACTGG - Intronic
985782912 5:1880400-1880422 GCAGCCCGCTCTGCAGACTCTGG - Intronic
985846860 5:2356164-2356186 CCAGACTGTACTGCAGGCACTGG + Intergenic
985964468 5:3329527-3329549 CCAGGCCACTCTGCAGAGGCTGG + Intergenic
986775965 5:11013941-11013963 CCAGGGTGCTTTGCTTACACAGG + Intronic
987057849 5:14212093-14212115 CCAGGCTGCAGTGCAGTGACAGG - Intronic
988503037 5:31799296-31799318 GCAGGCTGTTCTGCAGCCACTGG - Exonic
989326314 5:40199870-40199892 CCCGGCTACTCTGCAGGCTCAGG + Intergenic
989628657 5:43458309-43458331 CCAGGCTGGTCTGCAGCTCCTGG + Intronic
990085831 5:51975571-51975593 CCAGGCTGCTCTCCACCAACTGG + Intergenic
991412346 5:66357658-66357680 CCAGGCTCCTCTGGAGACCCAGG - Intergenic
991921297 5:71659967-71659989 CCAGGCTGTTCTCCAACCACTGG - Intergenic
994704286 5:103181526-103181548 CCAGGCTGCAGTGCAGTCAGGGG - Intronic
995107720 5:108394048-108394070 CCAGGCTGGAGTGCAGTCACAGG + Intergenic
995848235 5:116517608-116517630 CCAGGCCCCTCTCCAGACAAAGG + Intronic
995875890 5:116789144-116789166 ACAGGATGCTCTGCAGAAAGAGG + Intergenic
996507372 5:124283177-124283199 CTATGCTCCTCTGCAAACACTGG - Intergenic
997250431 5:132384715-132384737 CCACAGTGCTCTGCAGACAAGGG - Intronic
997477406 5:134152579-134152601 CCAGGCTGGACTGCAGTCAGTGG + Exonic
998004353 5:138647346-138647368 GCAAGCTGTTCTGCTGACACTGG + Intronic
998041504 5:138953564-138953586 CCAGGCTGCTCTGCAGACACAGG - Intronic
998230378 5:140357749-140357771 CCCGGCAGGTCTGCAGCCACTGG + Intergenic
998491365 5:142550123-142550145 ACAAACTGCTCTGAAGACACTGG - Intergenic
999063646 5:148661354-148661376 CCAGGCAGCACTGCAGGCAGTGG + Intronic
999690512 5:154142129-154142151 CCAGGCTCCACTGCACAAACTGG - Intronic
1000139580 5:158388979-158389001 CCAGGCTGCTATGAAGATAATGG - Intergenic
1001120387 5:168975239-168975261 CCAGGAAGCCCTGCAGCCACCGG + Intronic
1001562274 5:172677507-172677529 GAAGGCTGGACTGCAGACACAGG - Intronic
1001997911 5:176176793-176176815 CCAGGAAGCTCTGCTGCCACAGG + Intergenic
1002125070 5:177036900-177036922 CCAGGCTGCAGTGCCCACACTGG - Intronic
1002495709 5:179610128-179610150 CCAGGCTGCCCTGCAGGCTCTGG - Intergenic
1002926082 6:1606473-1606495 CCTGGGGGCTCTGCACACACAGG - Intergenic
1003298322 6:4853830-4853852 CCATGCTGTTCTGCACACGCAGG - Intronic
1005268790 6:24141077-24141099 CCAGGTTGCTCTGCTGAGCCTGG + Intronic
1005808947 6:29501754-29501776 CCAGGCTGCTCTGGAGGCGTCGG + Intergenic
1006029638 6:31169976-31169998 CCAGGCTGCTCTGCCCTCACCGG + Intronic
1006087480 6:31606724-31606746 CCAGGCTGGTGTGCAGTGACAGG - Intergenic
1006812324 6:36827906-36827928 CCAGGCTGCTGTGCAGACAGCGG - Intronic
1006928601 6:37673646-37673668 CCAGCCAGCTCTGCAGAGAGCGG - Intronic
1008609038 6:53169010-53169032 CCAGGCTGCCCTGCAGATTTTGG + Intergenic
1008798417 6:55336151-55336173 CCAGGCTGGTCTGCAGCTCCTGG + Intronic
1009789770 6:68386421-68386443 CCAGGCTGCCAGGCAGAGACTGG + Intergenic
1011786355 6:90849846-90849868 CCAGGCTGTGGTGGAGACACAGG - Intergenic
1014412398 6:121142222-121142244 CAAGTCTGCCCTGCAGACACTGG - Intronic
1014542312 6:122692052-122692074 CCAGGCAGCTCAGCACAGACAGG - Intronic
1014765541 6:125401755-125401777 CCATGCTGCTATAAAGACACAGG + Intergenic
1016190767 6:141261492-141261514 ACAGGCTCCTCTGCAGAAAGGGG + Intergenic
1017050541 6:150389118-150389140 CCCAGCTGCTCTGGAGACAGAGG - Intronic
1017141541 6:151195212-151195234 CCAGGCTGGTCTGCAGACAGAGG - Intergenic
1017580096 6:155855061-155855083 CCATTCTGCTCTGAAAACACAGG - Intergenic
1017687905 6:156931607-156931629 CCAGGCTGGTCTCCAGCTACTGG - Intronic
1018007034 6:159631859-159631881 CCAGGATCCTCTGAAGACGCAGG - Intergenic
1019202300 6:170327915-170327937 GCAGGCTGCTCTGGTGACTCCGG + Intronic
1019471462 7:1223725-1223747 GCAGGCCGCACTGCAGAGACAGG + Intergenic
1019599490 7:1874149-1874171 TCAGGCTGCCCAGCAGACAGTGG + Intronic
1019816434 7:3204489-3204511 CCAGGCTCCTCTTCCAACACTGG + Intergenic
1020414275 7:7928331-7928353 CCTGGCTGCTATGCAGAGTCTGG + Intronic
1022011486 7:26311358-26311380 CCAGGCTGGTCTGGAGCCCCTGG + Intronic
1022106991 7:27203742-27203764 CCAGGGTGCCCTGCAGGGACTGG + Intergenic
1023402897 7:39803194-39803216 CGAGGCTGCACAGCAGAGACAGG + Intergenic
1023709632 7:42977797-42977819 CCAGGCTCCTCTTCTAACACTGG - Intergenic
1023841607 7:44101487-44101509 CCAGGCAGCTCTGGAGGCTCAGG + Intergenic
1024358032 7:48437770-48437792 CCAGGCTGATCTCAAGACCCAGG - Intronic
1024646735 7:51377442-51377464 CGAGGCTGCACAGCAGAGACAGG - Intergenic
1024979714 7:55147050-55147072 CTAGCCTGCCCTGCTGACACTGG + Intronic
1025026771 7:55522727-55522749 CAGGGCTGCTCCGCAGAGACAGG + Intronic
1026560121 7:71441751-71441773 CCATGCTTCTCAGCAAACACAGG - Intronic
1027550315 7:79584817-79584839 CCAGGCTGGTCTCCAACCACTGG - Intergenic
1027591344 7:80122879-80122901 CAAGGCATCTCTGCAGAGACAGG - Intergenic
1029215763 7:98948265-98948287 CCCGGCTGCTCCTCAGACACTGG + Exonic
1029392522 7:100285118-100285140 CCCGGCTGCTCTGAAGACTGAGG - Intergenic
1029732697 7:102448184-102448206 CCAGGCCTCTCAGCCGACACTGG + Exonic
1029954237 7:104620838-104620860 CCAGAGTGCTCTGCAGACAAAGG + Intronic
1030328989 7:108252952-108252974 GCAGGCTACTCTGCAGAGGCAGG + Intronic
1031625847 7:123991952-123991974 CCAGGCTGGAGTGCAGAGACAGG - Intergenic
1033119198 7:138652093-138652115 CCAGGCTGGAGTGCAGAGACAGG + Intronic
1033145252 7:138865654-138865676 AGAGGCTGCTCTGCACCCACAGG + Intronic
1033164986 7:139032052-139032074 CCAGGCTGGAGTGCAGAGACAGG - Intronic
1033776644 7:144619043-144619065 CCAGGCTCCACTGCAGAAATTGG - Intronic
1034262460 7:149765361-149765383 CCTCGCTGCGGTGCAGACACTGG + Exonic
1034474307 7:151273918-151273940 CCAGGCTGCTCTGAAGGCCAGGG - Intronic
1034561840 7:151885343-151885365 CAAGGCTGCCCGGCAGACGCTGG - Intergenic
1034669552 7:152847734-152847756 CTGAGCTGCTCAGCAGACACAGG + Intronic
1034990158 7:155542938-155542960 ACAGGCCGCTTTGCACACACTGG + Intergenic
1035275478 7:157745632-157745654 CCAGCCTGCCCTGCAGATGCTGG - Intronic
1035587848 8:789471-789493 CCAGGCCCCTCTTCCGACACTGG + Intergenic
1035724248 8:1814584-1814606 GCTGGCTGCTCTTCGGACACAGG + Intergenic
1037186973 8:16076548-16076570 CCAGGCTGGAGTGCAGTCACAGG + Intergenic
1037725140 8:21477143-21477165 GCAGGCTGCGCTGCAGCCGCTGG + Intergenic
1037909648 8:22736393-22736415 CCAGGCTGCTCTGCAACTCCTGG - Intronic
1038159449 8:25022892-25022914 CTAGTCTGCGCTGCAGAAACTGG + Intergenic
1038316958 8:26492981-26493003 CCAGACTGCAGTGCAGACAGAGG + Intronic
1038375094 8:27032425-27032447 CCCGGCTGCCCTGCAGAGAATGG + Intergenic
1038423000 8:27445559-27445581 CCAAGATGCTCTGCACACAGTGG - Intronic
1038731285 8:30130040-30130062 CCAGGCCCCTCTTCCGACACTGG + Intronic
1039399118 8:37253632-37253654 CCAGGCTGGTGTGCAGCCTCAGG + Intergenic
1039453279 8:37692756-37692778 CCAGGCTGCTGTGGGGACCCCGG - Intergenic
1039876062 8:41587195-41587217 CCAGTATGCTCTGCAGACACTGG + Intronic
1040959226 8:53013309-53013331 CTAGACTGCTGTGCAGACACAGG - Intergenic
1041380874 8:57253466-57253488 CCAGGCTGTCCTCCAGGCACTGG + Intergenic
1041702223 8:60803925-60803947 CCAGGCAGCACTGTAGAAACTGG + Intronic
1041770716 8:61469725-61469747 CCTGGCTGCTCAGAAGACAACGG - Intronic
1042327379 8:67542187-67542209 CTAGGCAGCTCTGCAGTCATTGG + Intronic
1042576317 8:70224063-70224085 CCAGGCACTGCTGCAGACACTGG + Intronic
1042615516 8:70644513-70644535 CCAGGCTGCAGTGCAGAGGCAGG + Intronic
1042986077 8:74584378-74584400 CCAGGCTGGTCTTGAGACCCTGG - Intergenic
1043197924 8:77323476-77323498 CCAGGGTGGTCTGTAGTCACAGG - Intergenic
1044078977 8:87860364-87860386 CCAGGCTGGTCTGGAGAAGCTGG + Intergenic
1045179612 8:99766117-99766139 CCAGGCTGGAGTGCAGTCACTGG + Intronic
1045483049 8:102608401-102608423 CCAGGCTGCTCTCCAACCTCTGG - Intergenic
1046935763 8:119883911-119883933 CCTGCCTGCTCTGCACACAAAGG - Intronic
1048586605 8:135779913-135779935 CCAGTCTGCTCTGTTGACTCTGG + Intergenic
1049139777 8:140942821-140942843 CCAGGCTGCACTTCCAACACTGG - Intronic
1049161947 8:141103451-141103473 CCTGGTAGCTGTGCAGACACAGG - Intergenic
1049612035 8:143560330-143560352 CCAGGCTGCTGTGAGGACAAGGG + Intronic
1050018716 9:1262001-1262023 CGAGGGTGGTTTGCAGACACTGG + Intergenic
1054829759 9:69610274-69610296 CCAGGCTGGACTGCAGTAACAGG - Intronic
1056074491 9:83024550-83024572 CCAGAATGCTCTACAGACTCTGG + Intronic
1056253451 9:84774161-84774183 CCAGACTGCTGGGCAGTCACTGG + Intronic
1056438103 9:86592751-86592773 CCAGTCAAATCTGCAGACACTGG - Intergenic
1058408332 9:104702928-104702950 CCAGGCTGGTCTCCAAACCCTGG - Intergenic
1058836466 9:108862379-108862401 CCAGGCCCCCCTGCAGACACAGG + Exonic
1059149546 9:111937042-111937064 CCTTGCAGCTCTGCAGAGACAGG - Intergenic
1059228176 9:112692491-112692513 CCAGGCTGCTCTCGAGCTACTGG + Intronic
1059308888 9:113375090-113375112 CCAGGCTGCTCTCCAACCCCTGG + Intronic
1059460572 9:114427053-114427075 CCAGGCTGGTCTGCAACTACTGG - Intronic
1060528337 9:124333015-124333037 CCGGGCTGCACTGCACACAGAGG + Intronic
1060830699 9:126713596-126713618 CCAGGCTGGTCTGGAGCCCCTGG + Intergenic
1061225923 9:129280967-129280989 CCAGGCTGCTCTGCTGACCCTGG + Intergenic
1061252675 9:129435957-129435979 CCCGCCAGCTCTGCAAACACGGG - Intergenic
1061457719 9:130711500-130711522 CCAGGCTGCGATGCAGTAACAGG - Intergenic
1062462090 9:136666301-136666323 CCTGGCTGCGCCGCAGGCACTGG - Intronic
1062476731 9:136731707-136731729 CTAGGCTGCTCTGCTGCTACGGG - Intergenic
1062667742 9:137685985-137686007 CCAGGCTGGTCTCCAGCCCCTGG + Intronic
1062697982 9:137885108-137885130 CCAGGCCCTGCTGCAGACACAGG - Intronic
1189898779 X:45684141-45684163 AGAGGCTGCTCTGTAGAGACAGG - Intergenic
1189988477 X:46574066-46574088 CCAGGCTGCGCTGCAGGCCGGGG - Exonic
1190104709 X:47551320-47551342 CCCAGCTGCTCAGGAGACACAGG + Intergenic
1190192990 X:48293164-48293186 CCAGGCTGGTCTGGATACACTGG - Intergenic
1190245954 X:48690355-48690377 CCAGGCTGCTCTGCAACTCCAGG + Intronic
1190781672 X:53602612-53602634 CCAGGCAGATATGCAGAAACTGG - Exonic
1193360292 X:80572774-80572796 CCAGGCTGTTCTGCTGGCAGGGG + Intergenic
1195277225 X:103293368-103293390 CCAGGCTTCTCTGAAAACAGAGG - Intergenic
1197466945 X:126816523-126816545 CCAGGCTGGTCTCCAACCACTGG + Intergenic
1199347955 X:146763696-146763718 CCAGGCTTCTCCTCTGACACTGG - Intergenic
1199742078 X:150745235-150745257 CCAGGTTGCGCAGCAGGCACTGG - Intronic
1199858094 X:151776783-151776805 AGAGGCTGTTCTGCAGACCCAGG - Intergenic
1201189231 Y:11432219-11432241 CCAGGCTGCTCCGGAAATACTGG + Intergenic