ID: 998041969

View in Genome Browser
Species Human (GRCh38)
Location 5:138956300-138956322
Sequence ACATTAAGGCATAAGCAAGG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 148
Summary {0: 1, 1: 0, 2: 0, 3: 13, 4: 134}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
998041969_998041973 -5 Left 998041969 5:138956300-138956322 CCACCTTGCTTATGCCTTAATGT 0: 1
1: 0
2: 0
3: 13
4: 134
Right 998041973 5:138956318-138956340 AATGTGTGGCCTCCATCATCTGG No data
998041969_998041974 -4 Left 998041969 5:138956300-138956322 CCACCTTGCTTATGCCTTAATGT 0: 1
1: 0
2: 0
3: 13
4: 134
Right 998041974 5:138956319-138956341 ATGTGTGGCCTCCATCATCTGGG 0: 1
1: 0
2: 2
3: 27
4: 120
998041969_998041977 14 Left 998041969 5:138956300-138956322 CCACCTTGCTTATGCCTTAATGT 0: 1
1: 0
2: 0
3: 13
4: 134
Right 998041977 5:138956337-138956359 CTGGGAAAGCAAGAATTTGCAGG 0: 1
1: 0
2: 1
3: 20
4: 253

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
998041969 Original CRISPR ACATTAAGGCATAAGCAAGG TGG (reversed) Intronic
902680058 1:18036998-18037020 ACATTTATCCATAACCAAGGTGG + Intergenic
903546717 1:24128707-24128729 CAATTAAGGCAGAAGCAATGAGG - Intronic
912237362 1:107866493-107866515 AACTAAAGGCAAAAGCAAGGAGG + Intronic
918368229 1:183832158-183832180 AAATTAAGGCAAAGGCAATGAGG + Intronic
923348405 1:233080018-233080040 ACATTAGGGCACAGGCAAGTGGG - Intronic
1064866735 10:19889142-19889164 ACTTTAAGTCATAAACAAGGAGG - Intronic
1064976555 10:21122859-21122881 AAATAAAGGCATATACAAGGAGG - Intronic
1065957934 10:30709594-30709616 ACATTATAGCATAAGCAACAAGG + Intergenic
1066013138 10:31212653-31212675 ACATTAAGGGGACAGCAAGGAGG + Intergenic
1066467833 10:35668890-35668912 ACACTCAGGCATAAGCAACCAGG + Intergenic
1070574485 10:77667167-77667189 ATTTAAAGGCATAAGTAAGGAGG - Intergenic
1074029886 10:109676668-109676690 ACCATAATGCATAAGGAAGGAGG + Intergenic
1075661023 10:124196575-124196597 ACATTATGCCATAAACAATGGGG + Intergenic
1077331644 11:1986619-1986641 ACAGTAAGGAATAAGGAAGCGGG - Intergenic
1077661544 11:4072986-4073008 ACATCATGGAACAAGCAAGGAGG - Intronic
1078404605 11:11059061-11059083 ACATTGAGGCTAAAGCAAGAAGG - Intergenic
1079206452 11:18419225-18419247 ACAATAATACATAAGCAAGTGGG + Intronic
1079427875 11:20360809-20360831 ACATTCTGGCCTAAGCAAAGGGG + Intergenic
1080125459 11:28728713-28728735 ACAGAAGGGGATAAGCAAGGTGG + Intergenic
1080300957 11:30784493-30784515 AAATCAAGGCATCAGCTAGGAGG + Intergenic
1085313520 11:75530078-75530100 ACATTGGAGCATTAGCAAGGAGG + Intergenic
1086899807 11:92354202-92354224 TCATTAAGGCAAAAGCAAATGGG + Exonic
1089023932 11:115248140-115248162 ACATTAAGGCTGAAGAACGGAGG + Intronic
1089100083 11:115955659-115955681 ACTTCTAGGAATAAGCAAGGTGG + Intergenic
1202814625 11_KI270721v1_random:41795-41817 ACAGTAAGGAATAAGGAAGCGGG - Intergenic
1096262569 12:50102319-50102341 GCATTTAGGCAAAAACAAGGGGG + Intergenic
1099121078 12:78689679-78689701 TCATTATGGCAAAAGGAAGGAGG - Intergenic
1099702387 12:86103531-86103553 AAATCAAGACATCAGCAAGGTGG - Intronic
1100680198 12:96910312-96910334 ACTTGAAGGCAGAAGCAAGTTGG + Intronic
1101182640 12:102236165-102236187 AGATTAAGGCATCAGCAGAGTGG + Intergenic
1102347074 12:112167244-112167266 GCATGGAGGCCTAAGCAAGGTGG + Intronic
1107789507 13:43987453-43987475 ACATAAAGGCTTAAGCACGAAGG + Intergenic
1113888173 13:113671895-113671917 TCATTCAGGCAGAAGGAAGGTGG - Intronic
1115304050 14:31915667-31915689 AGAGTAAGGCATTTGCAAGGAGG - Intergenic
1116528591 14:45937327-45937349 ACATTGAGGAATACACAAGGTGG + Intergenic
1117673907 14:58136887-58136909 ACATTTAGAAATAAGGAAGGGGG - Intronic
1118779181 14:68995030-68995052 AATTTTAGGCATTAGCAAGGTGG - Intergenic
1120649759 14:87118175-87118197 TCACAGAGGCATAAGCAAGGAGG - Intergenic
1125498664 15:40222428-40222450 AAAATAAGGCACTAGCAAGGAGG - Intergenic
1128896199 15:71376324-71376346 AAACTAGGGCATAAGGAAGGAGG - Intronic
1135235355 16:20750104-20750126 ACATTAAGGGATAATAAAGGGGG + Intronic
1136028700 16:27487093-27487115 AAATTAAGGCAGAAGAAAAGTGG + Intronic
1136681253 16:31964167-31964189 ACATTAAGGCAGGTGCAAGAGGG + Intergenic
1136781566 16:32905679-32905701 ACATTAAGGCAGGTGCAAGAGGG + Intergenic
1136888228 16:33948161-33948183 ACATTAAGGCAGGTGCAAGAGGG - Intergenic
1137273497 16:46918440-46918462 ACTTTCTGGAATAAGCAAGGAGG - Intronic
1137369588 16:47892584-47892606 AAATAAAGGCATAAGAAAGATGG + Intergenic
1140762755 16:78125770-78125792 ACATTAAGGAATAAGTCTGGGGG + Intronic
1203084220 16_KI270728v1_random:1169661-1169683 ACATTAAGGCAGGTGCAAGAGGG + Intergenic
1143566766 17:7726629-7726651 ACATTAAGGAAAAAGTGAGGAGG - Intronic
1147531826 17:41286313-41286335 TGATTAAGACATAAGAAAGGAGG + Intergenic
1152992560 18:376638-376660 CCATTTAGGCCTAAGCAGGGTGG - Intronic
1153304416 18:3619106-3619128 AGATCAAGGTATCAGCAAGGTGG - Intronic
1156549580 18:38001280-38001302 ACAATAAGGCATAGGCCAGAGGG + Intergenic
1158684096 18:59597370-59597392 AGAATAAGGCATGAGCAAGGAGG + Intronic
1167171174 19:47833223-47833245 ACAGTAAGGGCTAAGCAAGGCGG - Intronic
932879574 2:75488668-75488690 ACGTAAAGGAATGAGCAAGGAGG + Intronic
934970323 2:98758178-98758200 ACAGTAAAGCAACAGCAAGGTGG - Intergenic
938659489 2:133471035-133471057 ACATAAAAGCAAAAGCAGGGGGG - Intronic
941051440 2:160738559-160738581 ACATTTAGTCATATGCAGGGAGG - Intergenic
942378917 2:175367006-175367028 ACATGAAGACAGAAGCAAAGGGG + Intergenic
943673607 2:190693887-190693909 ACATTAAGTCACAAGCAAAATGG - Intergenic
948515310 2:238499847-238499869 TCATTAGGGGATGAGCAAGGCGG + Intergenic
948649584 2:239432470-239432492 ACATGGTGGAATAAGCAAGGGGG + Intergenic
1172890767 20:38262188-38262210 AGATCAAGGCACAAGCAAGTTGG - Intronic
1173385763 20:42586721-42586743 TCATTAAGAGAAAAGCAAGGTGG - Intronic
1175005580 20:55678808-55678830 ACAGTAAGGTATAAGGCAGGGGG + Intergenic
1182576711 22:31277903-31277925 ACATTTAAGCATAAACATGGAGG + Intronic
1183166343 22:36149874-36149896 ACATACAGGCAGAAGCAAGGGGG - Intronic
1184618660 22:45656361-45656383 TCATGGAGGCATAAGCAAGGGGG - Intergenic
1184732288 22:46377578-46377600 AAATTGAGGCAGAAGAAAGGAGG - Intronic
951093922 3:18606631-18606653 AGATTAAGGAAGAAGGAAGGAGG - Intergenic
957514041 3:81228224-81228246 AGAATAAGGAATAAGAAAGGAGG - Intergenic
958208541 3:90436252-90436274 ACTGCAAGGCATCAGCAAGGCGG - Intergenic
958829481 3:99069987-99070009 ATATTTTTGCATAAGCAAGGAGG + Intergenic
958973006 3:100634195-100634217 ACACTAGGGGACAAGCAAGGGGG + Intronic
960177946 3:114539463-114539485 ACCTTAGGACATAAGCAATGTGG + Intronic
962852012 3:139315056-139315078 ACATTAAGGCTAAAAAAAGGTGG + Intronic
963642210 3:147874825-147874847 ACAGTAACCCAGAAGCAAGGAGG - Intergenic
968540138 4:1164116-1164138 ACATTGAGGCTGGAGCAAGGAGG - Intergenic
970096848 4:12473283-12473305 ACATTAAGGCATTAGGAGGTGGG - Intergenic
971990391 4:33885612-33885634 TCTTTAAAGCATAAGCAAGGAGG + Intergenic
972273097 4:37531290-37531312 ACATTTAGTCATAAGCATGTGGG - Intronic
975849106 4:78553131-78553153 AGATTAAGGCAGAAGCATGGGGG + Intronic
977607709 4:98998745-98998767 TCATAAAGGAATAAACAAGGTGG - Intronic
980379387 4:131991840-131991862 AGATAAAGGCAAAAGTAAGGAGG - Intergenic
981876406 4:149551265-149551287 ATAGTAAGGGATAAGCCAGGTGG - Intergenic
982105292 4:152006643-152006665 ACATTCAAGCATCAGGAAGGAGG - Intergenic
982426152 4:155263863-155263885 AAATTAAGGCATAATCAAAACGG - Intergenic
982546887 4:156745030-156745052 ACATTAGGACATTATCAAGGAGG - Intergenic
986765198 5:10919259-10919281 ACATTATGACATAGACAAGGAGG - Intergenic
987962907 5:24833133-24833155 TCATTAAGGAATAAGTAAGTGGG + Intergenic
989995542 5:50824949-50824971 GCAGTAAGGGATGAGCAAGGGGG - Exonic
990236860 5:53778147-53778169 AGATTGAGGCATGAGCAGGGTGG - Intergenic
994159775 5:96544007-96544029 ACATTGAAGAAGAAGCAAGGTGG - Intronic
994804192 5:104421938-104421960 AGATTAAGGCACCAGCAAGTAGG - Intergenic
994904722 5:105824240-105824262 ATATTAAGGCATAAAAAGGGGGG + Intergenic
995014401 5:107293490-107293512 ACATAAATCCATGAGCAAGGAGG + Intergenic
995061748 5:107818668-107818690 ACATTTAGGCATATGCTATGTGG + Intergenic
995828266 5:116325703-116325725 ACAATAAGGCATGAGAAAAGGGG - Intronic
998041969 5:138956300-138956322 ACATTAAGGCATAAGCAAGGTGG - Intronic
998836297 5:146205296-146205318 ATAATAAAGCAGAAGCAAGGAGG - Intronic
1000458781 5:161486062-161486084 ACAAATAGGCATAAGCAAAGAGG - Intronic
1000641817 5:163712058-163712080 AGATAAAGGGATAAGCAAGGTGG + Intergenic
1002283414 5:178146605-178146627 ACATTAGGTCATGAGGAAGGCGG - Intronic
1002782637 6:379290-379312 ACATTAAGCCACATGCTAGGAGG - Intergenic
1007277851 6:40688856-40688878 ACATTAATGCAAAAGCCATGGGG - Intergenic
1010127727 6:72453026-72453048 ACCATAAGCCATAAGCAAGTGGG + Intergenic
1012767241 6:103383687-103383709 ACAGAAAGGCATAAGCCAGAAGG + Intergenic
1013994747 6:116295183-116295205 ACTTGAAGGCAGAAGAAAGGTGG + Intronic
1015242606 6:131042440-131042462 ACATTAGGGGAAAAACAAGGTGG + Intronic
1015755006 6:136598062-136598084 ATGTTAAGGAATCAGCAAGGAGG - Intronic
1016410813 6:143781908-143781930 ACTTTAATGCATAAGAAAGAAGG - Intronic
1017022795 6:150153990-150154012 ACATTATGGCAGAAGAATGGAGG + Intronic
1017505383 6:155064431-155064453 CAATTAAGGCATAGGCAAGCTGG - Intronic
1019814526 7:3189863-3189885 ACATCAAGGCATTGGCAAGGGGG - Intergenic
1020732984 7:11908241-11908263 AAATTAAGGCTTAAGGCAGGAGG + Intergenic
1021488668 7:21194478-21194500 TCATGAAGGCATGAGCAAAGTGG + Intergenic
1022228451 7:28388388-28388410 ACACTGAGGCCTAAGCAAGATGG - Intronic
1022329826 7:29367251-29367273 ACTTTCAGGCTTAGGCAAGGAGG - Intronic
1022831806 7:34074933-34074955 ACATAAAAGCATAAGGAAGGGGG - Intronic
1023752748 7:43387445-43387467 ACATACAGGCAGAAGCAAGAAGG - Intronic
1028077642 7:86535040-86535062 ACCTGAAGGCAGTAGCAAGGAGG + Intergenic
1029627271 7:101727810-101727832 ACACTGAGGCAGAAACAAGGGGG + Intergenic
1031099123 7:117457259-117457281 ATCTTAAGGAATATGCAAGGAGG - Intergenic
1035189361 7:157152281-157152303 ACACTAAGGCATATTCAGGGAGG + Intronic
1039053533 8:33515504-33515526 AAATTAAGGCACCAGCGAGGTGG - Intergenic
1040059888 8:43094881-43094903 ACATTAAGGAATAAAGATGGTGG - Intronic
1041556035 8:59157313-59157335 ACATTAAGCCAGAAGGCAGGTGG - Intergenic
1042804235 8:72754530-72754552 ACATTCAGGGCTAAGCAAGAGGG - Intronic
1045139271 8:99261874-99261896 GAATTATGTCATAAGCAAGGTGG + Intronic
1046014895 8:108592975-108592997 AAATTAAGGCAGAAGTAAAGAGG + Intergenic
1046405380 8:113765880-113765902 AAAGTAAGGCTTAAGCAAGAGGG + Intergenic
1046512643 8:115218781-115218803 ACAGTAAGGCAGAACAAAGGAGG + Intergenic
1047754923 8:127911231-127911253 ACACTACAGCATAAGCAAGGGGG - Intergenic
1050209693 9:3239689-3239711 CCATTAAGGCCAAAGCAAGAGGG + Intronic
1050461100 9:5878203-5878225 ACATTAAGGAATAATCAACATGG + Intergenic
1058553378 9:106139561-106139583 AAATCAAGGCATCAGCAGGGTGG - Intergenic
1060077314 9:120603657-120603679 ACATTTTGGGTTAAGCAAGGTGG - Exonic
1061578857 9:131524406-131524428 CCTTTAAGGCACAAGCAAGGGGG + Exonic
1061773532 9:132945274-132945296 ACTTGAAGGCAGAAGCCAGGGGG - Intergenic
1186335534 X:8582779-8582801 GCCTTAAGGCAGAAGCCAGGAGG + Intronic
1194140480 X:90202996-90203018 AAATAAAGGCAATAGCAAGGTGG + Intergenic
1199059346 X:143335782-143335804 AAAGTATGGCATAAGCCAGGTGG - Intergenic
1199233503 X:145466408-145466430 TTATAGAGGCATAAGCAAGGTGG + Intergenic
1200486225 Y:3771963-3771985 AAATAAAGGCAATAGCAAGGTGG + Intergenic
1201177046 Y:11315703-11315725 ACAACCAGGCATAAGCCAGGAGG + Intergenic
1201428022 Y:13875519-13875541 GCCTTAAGGCAGAAGCCAGGAGG - Intergenic