ID: 998046909

View in Genome Browser
Species Human (GRCh38)
Location 5:138995012-138995034
Sequence TGTCCTTTGCAGGACATGAA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 378
Summary {0: 1, 1: 11, 2: 31, 3: 61, 4: 274}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
998046909 Original CRISPR TGTCCTTTGCAGGACATGAA TGG (reversed) Intronic
902086951 1:13870280-13870302 TGTCCTTTGCAGGACACAGGAGG - Intergenic
904778543 1:32926818-32926840 CTTCCTTTGCAAGACATCAAGGG - Intergenic
905030994 1:34884642-34884664 TGTCCTTTCCAGGGGATGATAGG - Intronic
905154545 1:35964428-35964450 TGTACTCTGCAGAACATGTATGG - Intronic
906020290 1:42622240-42622262 TGTCATTTGCAATACATGGATGG - Intronic
906870900 1:49479607-49479629 TGTCCTTTGCATGACATGGATGG - Intronic
907642816 1:56208424-56208446 TTTCATTTGTAGGACATCAAGGG + Intergenic
909354007 1:74686273-74686295 ATTGCTTTGCAGGACTTGAAGGG + Intergenic
911710590 1:101067106-101067128 CCTCCTTTGCAGGACATGGATGG - Intergenic
911774232 1:101787188-101787210 CTTCATTTGCAGGACATCAAGGG + Intergenic
913715061 1:121525204-121525226 TGTCCTTTGTAGGAAATAGATGG + Intergenic
914994258 1:152527576-152527598 TGTCTTTTACAGAACATGGATGG - Intronic
915221548 1:154379055-154379077 CTTCATTTGCAGGACATCAAGGG + Intergenic
915763990 1:158344428-158344450 TGCCCTTTATAGGACATGGATGG - Intergenic
915961067 1:160267194-160267216 CTTCATTTGCAGGACATCAAGGG + Intergenic
916786862 1:168092848-168092870 TGTCCTTCGCAGGAGATAACGGG + Intronic
919204586 1:194405750-194405772 TGTTCTTTGCAGGACATGGATGG + Intergenic
919598744 1:199596594-199596616 TGTCCTTTGCAGGAAATGGATGG - Intergenic
921298846 1:213730075-213730097 TGTTCTTTACTGGACATGGATGG - Intergenic
921420172 1:214938074-214938096 TTTCATTTGCAGGAAATCAAAGG + Intergenic
923758737 1:236819646-236819668 TTTCATTTGCAGGACATCAGGGG - Intronic
924254247 1:242166357-242166379 TGTCCTAAACAGGAAATGAAGGG - Intronic
1062826520 10:572953-572975 TGTCCTTTGTAGGATATTCAGGG - Intronic
1063666465 10:8063591-8063613 TTTCCTTTGAGGGAAATGAATGG + Intronic
1064367821 10:14724023-14724045 CTTCATTTGCAGGACATCAAGGG + Intronic
1064440525 10:15349457-15349479 TGGCCTTTACAGGAATTGAAAGG - Intronic
1065700014 10:28415732-28415754 TGTCTTTTGCGGAACATGGATGG - Intergenic
1065702173 10:28436211-28436233 CTTCATTTGCAGGACATCAAGGG - Intergenic
1065760941 10:28982907-28982929 TGTCCCTTGGAGCACATGAAGGG + Intergenic
1068456271 10:57257792-57257814 TATCGTTTGCAAAACATGAAGGG - Intergenic
1068825862 10:61438168-61438190 TGGCTTTTGCAGGAAATCAAAGG - Intronic
1069935792 10:71915228-71915250 TGGCCTTAGCAGGACATGGGTGG - Intergenic
1070053985 10:72916476-72916498 TGTCCTTTGCAGGGAGTGGATGG - Intronic
1070215179 10:74371545-74371567 CTTCATTTGCAGGACATCAAGGG - Intronic
1070444253 10:76479533-76479555 TGTGCTCTGCAGGACATTAAAGG - Intronic
1070739857 10:78895667-78895689 TCTCATTTGCAGGACAAGAAGGG - Intergenic
1070762182 10:79030735-79030757 TGTCATTAGCAGGAGAGGAAAGG + Intergenic
1072316280 10:94206326-94206348 TAAGCTGTGCAGGACATGAAAGG + Intronic
1073292555 10:102420451-102420473 GGACCTTTGGAGGAAATGAAAGG + Exonic
1073597675 10:104817209-104817231 TTTCCTTTCCAGGAAATTAAGGG + Intronic
1073952948 10:108831848-108831870 TGTCCTTTCCAGGACATGGATGG + Intergenic
1074022718 10:109600824-109600846 CATCCTTTGAAGGACATGGATGG + Intergenic
1074534713 10:114320533-114320555 TCTCCTTGGCAGGACAGGCAGGG + Intronic
1074683760 10:115938690-115938712 AGTCATTTGCAACACATGAATGG + Intronic
1075187598 10:120277033-120277055 TGTCCTTTGAAGGACATGGATGG + Intergenic
1075772699 10:124953360-124953382 TGTCCTTTCCAAGACACAAATGG + Intronic
1076318167 10:129557927-129557949 TGTCTTCTGTAGGAAATGAAGGG + Intronic
1076356984 10:129860403-129860425 TGTCCTTTGGGGAAGATGAATGG + Intronic
1078118552 11:8481404-8481426 CGTCTTTTGCTGGACATAAATGG - Intronic
1078517753 11:12039156-12039178 TGTCCTTTGCAGCACATGGATGG + Intergenic
1078864670 11:15286185-15286207 TGTGCTTTGCAGGACATGAGAGG + Intergenic
1078975287 11:16467475-16467497 TGTCCTTTGCAGGACATGGATGG + Intronic
1079064937 11:17281485-17281507 TTTCCTTTTCAAGACAAGAAGGG + Intronic
1081236879 11:40657385-40657407 TGTTCTCTGTAGGGCATGAAAGG + Intronic
1081307330 11:41529538-41529560 TGTCCTTTGCATGAGATAGAAGG + Intergenic
1081986628 11:47309512-47309534 TGTCCCTTGGAGAACATGACCGG + Exonic
1082230859 11:49764239-49764261 TGTCTTGTGCAGGACTTCAAAGG - Intergenic
1082904093 11:58287185-58287207 TGTCTTTTGCAGAACATAGATGG + Intergenic
1083319802 11:61838690-61838712 TGGCCTTTGAAGGACCTGCAGGG - Intronic
1083677794 11:64336705-64336727 TGTCCTTCGTGGGACATGGATGG - Intergenic
1083919649 11:65775433-65775455 TGTCCTTTGAAGGATATGGATGG + Intergenic
1084440481 11:69169972-69169994 TGTCCTTCTGAGGACATGACAGG - Intergenic
1084765800 11:71307549-71307571 AGTCCTTTACAAGACATGGAAGG - Intergenic
1084944750 11:72632581-72632603 TTTCCTCTGCCGGACATGACTGG - Intronic
1085141304 11:74144754-74144776 TGTCCTTTGCAGGACATGGATGG - Intronic
1085156576 11:74300797-74300819 TGTCCATAGAAGGACATAAAAGG + Intronic
1086530457 11:87778686-87778708 GCCCCTTTGCAGCACATGAAAGG - Intergenic
1086701069 11:89900992-89901014 TGTCCTGTGCCGGGCCTGAAGGG - Intergenic
1086705098 11:89943535-89943557 TGTCCTGTGCCGGGCCTGAAGGG + Intergenic
1087337731 11:96865741-96865763 TAGCCTGTGCAGGACAGGAAGGG - Intergenic
1087585311 11:100112035-100112057 TATCCTTTCCAGCACATGGAGGG + Intronic
1088749844 11:112834393-112834415 TGTTCTTGGCAGGAAATGAGGGG - Intergenic
1088815173 11:113415678-113415700 TGTTCCTGGAAGGACATGAATGG - Intronic
1088852948 11:113720351-113720373 TGTCCTTAGCATGGCATGAAAGG + Intergenic
1089144038 11:116311319-116311341 TGTCCTTTTCAGACCATGGAGGG - Intergenic
1089494665 11:118902091-118902113 CGTCCTCTGCAGGACATGATGGG - Exonic
1090490053 11:127152411-127152433 TGTCATTTACAGGACATCTAAGG + Intergenic
1090586941 11:128223197-128223219 TGTCCTTTGCAGGACATGGATGG - Intergenic
1091348666 11:134874774-134874796 AGTCCTTGGAAGGACATGGAAGG + Intergenic
1097538359 12:60902502-60902524 TGTCATTTGCAACACATGGATGG + Intergenic
1097627840 12:62022231-62022253 AGTCTTTAGCAGGACATGTAAGG - Intronic
1097983577 12:65758966-65758988 CTTCATTTGCAGGACATCAAGGG + Intergenic
1098249466 12:68553850-68553872 CCTCATTTGCAGGACATCAAGGG + Intergenic
1099374867 12:81886782-81886804 AGTCCTTTACAAGACATGCAAGG - Intergenic
1102402192 12:112639336-112639358 TGTCCTTTGCAGGCTATGGATGG + Intronic
1102541475 12:113622477-113622499 TCTCCTTTGCAAGAGCTGAAGGG - Intergenic
1102806916 12:115790120-115790142 TGTCATTTGCAGAACATGGATGG - Intergenic
1104102104 12:125622472-125622494 AGTCCTTTCCAGCACAGGAAAGG - Intronic
1104796459 12:131523204-131523226 TATCCTTTGCAGGACATGGATGG + Intergenic
1104827594 12:131724703-131724725 ACTCCTTAGCAGCACATGAAGGG + Intronic
1105499727 13:20961322-20961344 CTTCATTTGCAGGACATCAAGGG - Intergenic
1107382824 13:39875645-39875667 TGTTTTCTGGAGGACATGAAGGG + Intergenic
1108713197 13:53054391-53054413 TGGCCTTTTCAGAACATGCATGG + Intergenic
1108760546 13:53557999-53558021 TGTCATTTGCAGGGCAGCAAGGG + Intergenic
1109792472 13:67267672-67267694 CTTCATTTGCAGGACATCAAGGG + Intergenic
1110290400 13:73799099-73799121 CGTCTTTTGCAGCACATGGATGG + Intronic
1111481196 13:88829200-88829222 TGACTTTTATAGGACATGAATGG + Intergenic
1111722638 13:91965649-91965671 TTTCCTTTGTAGGATATGACAGG - Intronic
1114829139 14:26118231-26118253 TGTCCTTTGCAGGACATGGATGG + Intergenic
1115764714 14:36611837-36611859 TGTTTTTTGCAGGACATGGATGG + Intergenic
1116035544 14:39622798-39622820 TGTCCTTGGCAGGACATGGATGG - Intergenic
1116943687 14:50816036-50816058 TGTCCTTTGCAAGACATAGATGG + Intronic
1117842462 14:59873976-59873998 TGTCATTTGCACAACATGGATGG - Intergenic
1119583492 14:75809869-75809891 TGTCATTTGCAGAACATAGATGG - Intronic
1120058955 14:79959374-79959396 TGTCCTTTGAGGGACATGGATGG + Intergenic
1120328240 14:83055500-83055522 TGTCCTTTTTAGAACATGAATGG - Intergenic
1121723471 14:96128936-96128958 TGCCCATAGCAAGACATGAAGGG - Intergenic
1122198320 14:100106577-100106599 TCTCCTTTGCAGTACATGTAAGG + Intronic
1122422809 14:101588114-101588136 TGTCTTTTGCAGGACACCACTGG + Intergenic
1124412680 15:29449517-29449539 TGTCCTATAAAGGACATAAAGGG - Intronic
1125764068 15:42121364-42121386 TGTCCTTTTCAGGACAGAAGGGG + Intergenic
1129688668 15:77700871-77700893 TGTCCTGTGGAAGACAGGAAGGG - Intronic
1130181045 15:81628909-81628931 TGTCCTTTGCAGGGCGCGGATGG + Intergenic
1130684251 15:86023068-86023090 TGTCCTTGGATGAACATGAAGGG + Intergenic
1132245293 15:100291679-100291701 TGTCCTCTGCAGCACATGGATGG + Intronic
1132248813 15:100318045-100318067 GGACATTTGCAGGACATGGAAGG + Intronic
1133450573 16:5900643-5900665 TGTCCTTTGCAGGAGCTAATAGG + Intergenic
1136068286 16:27773211-27773233 TATCCTTTGTAGGACAGGAGTGG + Intronic
1136098459 16:27975517-27975539 TGTCCTCTACAGGACGTGCAGGG + Intronic
1136528364 16:30848329-30848351 TGTCCTTTGTAGGCCAAGTAAGG + Intronic
1139311585 16:66032397-66032419 TGTCCTTTACAAGCCATGAGGGG - Intergenic
1139825729 16:69755764-69755786 TGTCTTCTTTAGGACATGAAGGG + Intergenic
1141419860 16:83906975-83906997 TCTCCTTTTCAGGAAATGAATGG + Exonic
1143280125 17:5747713-5747735 TGTGCATTGGTGGACATGAATGG - Intergenic
1143323229 17:6081205-6081227 TCTGCTCTGCAGGACAGGAAGGG + Intronic
1144239669 17:13297937-13297959 GGTCCTTTGTAGGAAATGAAGGG + Intergenic
1144655508 17:17032680-17032702 TTTCTTTTTCAGGACATGCAGGG - Intergenic
1144664490 17:17092672-17092694 TGTCCTTTCCAGAGCAGGAAAGG + Intronic
1145939650 17:28736077-28736099 TGTCCTTTGTAGGACATGGATGG - Intronic
1147625404 17:41896773-41896795 TGTCCATTGCAGAACAGGAGAGG - Intronic
1150144372 17:62755375-62755397 TCTCCTTTCCAGGACACGAAGGG - Intronic
1151052184 17:70990839-70990861 TGTCTATTGCAGGAGATGAAAGG + Intergenic
1151973777 17:77472474-77472496 GCTCCTTTGCAGGACCTGGAAGG - Intronic
1152398178 17:80047931-80047953 TGTCATTTGCAAGTAATGAAAGG - Intronic
1152592813 17:81222230-81222252 TGTCCCTCCCAGGACCTGAAGGG + Intronic
1153474841 18:5488260-5488282 TGTCCTTTTCAGGACATGGATGG + Intronic
1153779241 18:8479482-8479504 TCTCCTTTGCACCACATGCAGGG + Intergenic
1153837250 18:8974975-8974997 TGTCATTTGCAAAACATGGATGG + Intergenic
1154250617 18:12741306-12741328 TGTTCTTTGCAGGCCTTCAATGG + Intergenic
1154302811 18:13209246-13209268 TGTCCTTTGCAGGATGTGGATGG - Intergenic
1154340563 18:13498950-13498972 TGTCCACAGCAGGACATGTATGG - Intronic
1155630801 18:27889835-27889857 TGTCCTTTGCACAACATTCAAGG + Intergenic
1155999297 18:32367140-32367162 TGGGCTTTGCAGAAAATGAAAGG - Intronic
1156715364 18:40002561-40002583 TGTATTTTGCAGAACATGGATGG + Intergenic
1158123132 18:54072358-54072380 TGTCATTTGTAGAATATGAATGG - Intergenic
1160081765 18:75734559-75734581 TGTCCTTTGCAGGACATGGATGG - Intergenic
1160406005 18:78646813-78646835 TGTCCGTGGCAGGGCCTGAAGGG - Intergenic
1160849906 19:1185669-1185691 GGTCCTTTCCAGAACATCAACGG - Intronic
1161177352 19:2853123-2853145 AGTCCTTTCGAAGACATGAAAGG + Exonic
1161177363 19:2853207-2853229 AGTCCTTTCGAAGACATGAAAGG + Exonic
1161655245 19:5510421-5510443 TCTCCGTTGCAGGACACGACAGG + Intergenic
1161846875 19:6716770-6716792 TCTCATTTGCAGGACATGGCAGG + Intronic
1162593633 19:11610218-11610240 CGTTCTTTCCTGGACATGAAGGG + Intronic
1163494271 19:17636147-17636169 TGTCCATTTCAGGCCAAGAAGGG - Exonic
1164287096 19:23827172-23827194 CTTCATTTGCAGGACATCAAGGG - Exonic
1165478683 19:36048209-36048231 TGTCCTTTGCAGGTCATTTGTGG - Intronic
1165945797 19:39441461-39441483 TGTCCTTCACAGGACAGGCAAGG - Intronic
1166665170 19:44675408-44675430 TGTGTTTTGCAGGAGATGTAGGG - Intronic
926236405 2:11048397-11048419 TGACCTTTGCAGGAGTGGAATGG + Intergenic
926449040 2:12980045-12980067 TGGCCTTTTCAGGTCAAGAATGG - Intergenic
927085124 2:19667536-19667558 TGTCTTTTGCAGGCCTTGAATGG + Intergenic
928427952 2:31194088-31194110 TGGCCTTTTCAGGACAAAAAAGG + Intronic
928494932 2:31821936-31821958 TGTTATTTGCAGAACATGTATGG - Intergenic
928955419 2:36862072-36862094 TGTCCTTTGCAGGAAAATCATGG - Intronic
930191593 2:48465723-48465745 TGTCCTTTGCAGTACTTGGATGG - Intronic
931423114 2:62146387-62146409 CTTCATTTGCAGGACATCAAGGG - Intronic
931502148 2:62881080-62881102 TGTTCTTTGCAGCACATGGATGG + Intronic
931531605 2:63221005-63221027 TGTCCTTTGAGGGACAGGGATGG - Intronic
931779762 2:65568808-65568830 TGGCCTTTGCAGCACATGGGTGG - Intergenic
931798415 2:65734362-65734384 TTTTTTTTGCAGGACATGGATGG - Intergenic
931983075 2:67714760-67714782 TGTCTTTTGCACAGCATGAATGG - Intergenic
932647463 2:73518268-73518290 TGTCTTTTGCAGAACATGGATGG - Intronic
932977293 2:76618693-76618715 TGTCATTTGCAGTACATGGGTGG - Intergenic
937464304 2:122116921-122116943 TGTCATTTTCAGCACATGGATGG - Intergenic
937735966 2:125289750-125289772 TGTCCTTTGCGGGACATGGATGG - Intergenic
939700911 2:145389261-145389283 TGTCCTTGAAGGGACATGAATGG - Intergenic
940693257 2:156946639-156946661 TGGCCTTTGCTGGAAATAAAAGG - Intergenic
941169559 2:162120071-162120093 TGACCTTTGCATGACGTGACAGG - Intergenic
941989989 2:171546419-171546441 TGTCATCTGCAGGTCATAAAGGG - Intronic
942495291 2:176533819-176533841 CTTTCTTTGCAGGAAATGAAGGG - Intergenic
944183151 2:196918106-196918128 TTTCCTTTGAAGGGCAAGAATGG - Intronic
945300108 2:208208145-208208167 TTTCATTTGCAGGACATAAAGGG - Intergenic
945377472 2:209096304-209096326 TGCTCTTTGCAGAACATGGATGG - Intergenic
945947498 2:216008579-216008601 TGCCCTCTGCAGGCAATGAATGG + Intronic
1170282260 20:14663170-14663192 TGTTCTTTGTAGGACAGGGATGG + Intronic
1173306326 20:41853900-41853922 TGTCCTGGGCAGGAAATGAGAGG - Intergenic
1173930932 20:46817773-46817795 TTTCTTTTGCAGGGAATGAAGGG + Intergenic
1174431739 20:50475113-50475135 TGTCCTCTGCAGGGCATGGCAGG + Intergenic
1174521132 20:51131635-51131657 TTTCATTTGCAGGACATCAAGGG + Intergenic
1175668590 20:60881580-60881602 TGTCCTTTGCAGGAACACAATGG - Intergenic
1183492367 22:38123388-38123410 TGTCCTATGCAGGACAGCGAGGG + Intronic
1184300113 22:43553744-43553766 TGGCCTTGGAAGGCCATGAAGGG + Intronic
950317397 3:12015859-12015881 TGTGCTTGGGAGGACAGGAATGG - Intronic
950953877 3:17029910-17029932 TGTCCTTTGCAAAACATGCCAGG - Intronic
952559682 3:34576845-34576867 TATGCTTTAGAGGACATGAAGGG + Intergenic
952685296 3:36141063-36141085 TGTCCTTTGTCAGACGTGAAGGG + Intergenic
953058571 3:39407664-39407686 CTTCATTTGCAGGACATCAAGGG - Exonic
953816016 3:46157387-46157409 TGTCCTTTGCAAGGAATGGATGG - Intergenic
954704281 3:52470847-52470869 TGTTCTCTGCAGGAGATAAATGG + Exonic
955524824 3:59809260-59809282 TGTCCTTATAAGGACATCAACGG + Intronic
956536667 3:70284586-70284608 TGTCCTTTGCAAGGACTGAATGG + Intergenic
956687811 3:71847400-71847422 TATCATTTGCAGGAGATGGAGGG - Intergenic
959311230 3:104740278-104740300 TGGCCTCTGGAGGAGATGAATGG + Intergenic
959773740 3:110132074-110132096 TGTCCTTTGCAGGACATAGATGG + Intergenic
959816819 3:110683122-110683144 CTTCATTTGCAGGACATCAAGGG + Intergenic
960825996 3:121785169-121785191 TGTCCTTGGCAGGAAAAGAAAGG - Intronic
962089391 3:132227327-132227349 TGTCCTTTGCAGGGAATGGAGGG - Intronic
963532545 3:146489006-146489028 TGTCCTTTGCAGGACATGGATGG + Intronic
963747381 3:149138513-149138535 TGTAATTTGGAGGACATGGATGG + Intronic
965295383 3:166938716-166938738 TGTTTTTTGCAGAACATGTATGG - Intergenic
965993851 3:174854218-174854240 TATCTTTTGCAGTACATGGATGG + Intronic
966654800 3:182343833-182343855 TGTTCTTTGCAGCACATGGATGG - Intergenic
966815634 3:183887565-183887587 CTTCATTTGCAGGACATCAAGGG - Intergenic
967334257 3:188324925-188324947 AGGGCTTTGCAGGCCATGAAAGG - Intronic
967573674 3:191064102-191064124 AGTCCTGTGCTGGACATGAGGGG - Intergenic
967787605 3:193514384-193514406 TGTCCTTTTCAGGACATGGATGG - Intronic
968227948 3:196987526-196987548 CTTCATTTGCAGGACATCAAGGG + Intergenic
969051463 4:4376260-4376282 TGGCCTTTGCAGGACAGGACAGG - Intronic
969082570 4:4630667-4630689 TGTCCCCTGCAGGACATGGATGG + Intergenic
970643175 4:18090168-18090190 TCTCCTGGGCAGGACAGGAAAGG - Intergenic
970836104 4:20409373-20409395 TGTCCTTTTAGGGACATGGATGG - Intronic
971620199 4:28845786-28845808 TGTTCTTTGCAGGACATGGATGG - Intergenic
972910663 4:43812649-43812671 TGTCCTTTGCAGAGCGTGGATGG + Intergenic
972984854 4:44750733-44750755 TGTCCTTTCCGGGACATGGATGG - Intergenic
973066627 4:45802830-45802852 TGTCCCTTCCAGGACATGAGGGG + Intergenic
973123052 4:46546566-46546588 CGTCCTTTTCAGGGAATGAATGG - Intergenic
973692929 4:53457841-53457863 TGTCAGTTAAAGGACATGAAAGG + Intronic
973741699 4:53925045-53925067 TGTCATTTCTAGGACATGAGAGG + Intronic
973780857 4:54287185-54287207 ATTCCTTTGGAGGACATAAAAGG + Intronic
975889090 4:79003447-79003469 TGTCCTTTCAGGGACATGGATGG + Intergenic
975981159 4:80161139-80161161 CTTCATTTGCAGGACATCAAGGG - Intergenic
976519792 4:86013607-86013629 TTTCCTTGACAGGACATAAAAGG + Intergenic
976793270 4:88904456-88904478 TGTCCTTTCTAGGACATGGATGG + Intronic
977520153 4:98072248-98072270 TGTCCTTTGCGGGACATGAATGG + Intronic
979404169 4:120288523-120288545 TGTCCACTGCAGGTCAGGAAGGG - Intergenic
980282758 4:130741797-130741819 TATCCTTTGGAGAACATGGATGG - Intergenic
980857486 4:138456601-138456623 TGTGCTGTGCAGGACATGGATGG + Intergenic
981241305 4:142479649-142479671 TGTCCTAAGCAGCAAATGAACGG + Intronic
981323893 4:143425062-143425084 CTTCATTTGCAGGACATCAAGGG - Intronic
983155620 4:164344063-164344085 TGTCCTTTGCACAGCATGGATGG + Intronic
983419459 4:167499643-167499665 TTTTTTTTGCAGGACATGGATGG - Intergenic
983462341 4:168043008-168043030 TGTACTTTGCAGCACTTGGATGG + Intergenic
984628016 4:182030384-182030406 TGTCTTTTGCAGGACAGGGATGG - Intergenic
986284700 5:6350766-6350788 GCTCCTCTGCAGGACCTGAATGG + Intergenic
986466964 5:8035177-8035199 AGTCCTTTCCAGGTCATAAATGG - Intergenic
986706049 5:10455603-10455625 TATCCTGTGCAGGACAGGGATGG - Intronic
986818503 5:11439111-11439133 TGGCCTTTTCAGGAAATGAGAGG - Intronic
987015207 5:13810918-13810940 TGTCATTTGAACAACATGAATGG + Intronic
988630719 5:32928485-32928507 TGTTCTTTGGAGGAATTGAAGGG - Intergenic
988959186 5:36352113-36352135 TGTACTTTGCATAACATGACTGG + Intergenic
989327900 5:40221618-40221640 TGGCCTTTGCTGGAGATAAATGG + Intergenic
989962678 5:50435250-50435272 TGTCCTTTGTAGGAAATAGACGG - Intronic
993071139 5:83165787-83165809 TGTCCTTTGCAGGACATGGATGG - Intronic
993076084 5:83233505-83233527 TGTCCTTTTCTGGAGAAGAATGG - Intronic
993247684 5:85471655-85471677 TGTCCTTTGCAAAACATGGATGG + Intergenic
993568689 5:89508562-89508584 TGTCTTTTGCGGAACATGGATGG + Intergenic
993795118 5:92257490-92257512 TGTCCTTTGCAGCATACGGATGG + Intergenic
993820605 5:92611011-92611033 TATCCTTTGCAGGACATGGATGG + Intergenic
993889903 5:93461172-93461194 TGTCCTTTGCAAGACATGGATGG + Intergenic
994333555 5:98537401-98537423 TTCTCATTGCAGGACATGAACGG - Intergenic
994336263 5:98569688-98569710 TGTTCTGTTCAGGACAGGAAAGG + Intergenic
994541134 5:101099152-101099174 TGTCTTTTGCAGCATTTGAATGG + Intergenic
994543291 5:101128142-101128164 CGTCCTTTGCAGGGCATGGATGG + Intergenic
995059044 5:107794179-107794201 TGTCCTTTGCAAAACATGGATGG + Intergenic
995357641 5:111257835-111257857 TGTCCTTCGCAGGACATGGATGG + Intronic
995621904 5:114034868-114034890 TGTTCTTTGCAGAACATGGATGG - Intergenic
996202304 5:120691340-120691362 TGATCTTTGCAGAATATGAAAGG + Intergenic
996219331 5:120910407-120910429 TCTGCTTTGAAGAACATGAAGGG + Intergenic
996475437 5:123914534-123914556 TGTCTTTGCCAGGACATGCATGG + Intergenic
997785989 5:136714456-136714478 TGTCCTTTGCAGAAAATGGATGG - Intergenic
998046909 5:138995012-138995034 TGTCCTTTGCAGGACATGAATGG - Intronic
998604717 5:143621948-143621970 TGTCTTTTGCAGAACATGGATGG + Intergenic
999939221 5:156522423-156522445 TGCCCTTTTCAGGACATAGATGG + Intronic
1000189600 5:158897255-158897277 TGTCCTTTGCGGGACATGGATGG + Intronic
1000588463 5:163129143-163129165 TGTCCTTTGCAGAACATGGATGG + Intergenic
1000668121 5:164024329-164024351 TGTCCTTTGCAGGAACTGGATGG - Intergenic
1001448862 5:171808654-171808676 TGTCCTTTGCAGAACGTGGATGG + Intergenic
1001483821 5:172105817-172105839 TGTCCTTTGAGGGGCATGATTGG - Intronic
1001796180 5:174504218-174504240 CTTTCTTTGCAGGAAATGAAGGG + Intergenic
1002069790 5:176672338-176672360 TGTCCTCTGCAGGACCTGCAGGG - Intergenic
1002967748 6:1984058-1984080 TGTCCTTTGTGGGACATGGATGG + Intronic
1003586298 6:7392045-7392067 TGTCCTTTTCTGTACATGAGAGG + Intronic
1004249554 6:14012361-14012383 TGTTCTATGCAGGCCATCAAAGG + Intergenic
1005200407 6:23338189-23338211 TGTCCTTTTCTGGATATTAAGGG + Intergenic
1005919240 6:30384100-30384122 TGTCCTTTGCGGAACATGGATGG - Intergenic
1006910346 6:37559386-37559408 TGCCCTGTGCAGGGGATGAAGGG - Intergenic
1008208558 6:48692786-48692808 TGTCCTTTGCAGGACATAGATGG + Intergenic
1009564239 6:65291597-65291619 TGTTCTTTCCATGACATGAATGG + Intronic
1010610045 6:77943383-77943405 TGTCCATTGCAGGTAAGGAAGGG - Intergenic
1010802081 6:80188165-80188187 TGTCCTTTGCAGGACATATCTGG + Intronic
1013502441 6:110766282-110766304 TGTCATTTGCAGGCCAGGCATGG + Intronic
1013666706 6:112356685-112356707 CTTCATTTGCAGGACATCAAGGG + Intergenic
1013896723 6:115097553-115097575 TGTCCTCTGCAGGACGTGAACGG - Intergenic
1014012775 6:116495317-116495339 TGTCATTTGCAAAACATGGATGG - Intronic
1014162300 6:118184502-118184524 TGTCCTTTGGAGGACTGAAAGGG - Intronic
1014324610 6:119976943-119976965 TGACCTTTGAGGGAAATGAATGG + Intergenic
1014375300 6:120664774-120664796 TGTCCTTTGCAGGGCATGGATGG - Intergenic
1014723097 6:124942413-124942435 TGTCCTTGGCAGTAGAGGAAGGG - Intergenic
1015626457 6:135183731-135183753 TGACTTCTGCAGGACCTGAAGGG - Intronic
1018140301 6:160826956-160826978 TGTTCTTTCCACGACATGAAAGG + Intergenic
1019098427 6:169607465-169607487 TGTCTTTTGCAGCACATGGATGG + Intronic
1021199500 7:17712350-17712372 TGCCCTTTGCGGGACATAGATGG + Intergenic
1021364247 7:19756750-19756772 GGTCTTTTGCAGGACATGGATGG - Intronic
1022493870 7:30840950-30840972 TGTCTTCTGCAGGTCAAGAAAGG + Intronic
1022975121 7:35549656-35549678 CTTGCTTTGCAGGGCATGAAGGG - Intergenic
1023103991 7:36746200-36746222 AGTCCTTTCCAGGACACCAAAGG + Intergenic
1024771140 7:52724526-52724548 TGTATTTTTCAGGACTTGAATGG - Intergenic
1028170354 7:87588484-87588506 CGTCCTTTGCAGGGCATGGCTGG - Intronic
1028973757 7:96889465-96889487 ATTCCTTTGCAGGACATTCAAGG - Intergenic
1029160710 7:98549438-98549460 TGTCCATTGCAGGAGATGCAGGG - Intergenic
1029544728 7:101204463-101204485 CTTCATTTGCAGGACATCAAGGG + Intergenic
1032081547 7:128861002-128861024 TGGCCTGTGCAGCACATGGATGG - Intergenic
1033243261 7:139698656-139698678 TGACCTTTGTAGCTCATGAAAGG + Intronic
1033737207 7:144234309-144234331 TATCCTTTGATGGACATGGATGG + Intergenic
1033745850 7:144316637-144316659 TGTCCTTTGATGGACATGGATGG - Intergenic
1034202236 7:149289885-149289907 TGTCCTCTGCAGGCCTGGAAAGG - Intronic
1034894473 7:154867251-154867273 TGGCCATTTCAGTACATGAACGG + Intronic
1034937880 7:155211437-155211459 TGGCCTTTGCAGGTCATGGTGGG - Intergenic
1035414200 7:158669072-158669094 TGTTCTTTGCAGGGAATGGATGG - Intronic
1035628248 8:1089747-1089769 TTTCCTCTGGAGGACATTAAAGG + Intergenic
1039378517 8:37061834-37061856 TGACCATTGCGGGACATGTATGG - Intergenic
1040846306 8:51845290-51845312 TGTCCTCTTCAGGACATGAGAGG - Intronic
1041177025 8:55207411-55207433 TCTCCTGTGCAGGGAATGAATGG - Intronic
1041572043 8:59348747-59348769 TGTCCTTTGCAGAACATGGATGG + Intergenic
1043001536 8:74766019-74766041 TGTCCTTTGCAGGAACAGGATGG + Intronic
1043325044 8:79039759-79039781 TGTCATTTGCAGGACATGATTGG + Intergenic
1043470621 8:80558880-80558902 CTTCATTTGCAGGACATCAAGGG - Intergenic
1044530127 8:93298195-93298217 TGTACTTTGCAAGACCAGAATGG + Intergenic
1045102309 8:98857461-98857483 TTTCCTTTGAAAGACATGACAGG - Intronic
1046418965 8:113954180-113954202 TGTCCTTAGCTGGAGATGTAAGG + Intergenic
1048109350 8:131450838-131450860 TGTCTTTTGCAGGACATGGATGG - Intergenic
1049583794 8:143423908-143423930 TGACATTTGCAGGACAGGAAAGG - Intronic
1050308999 9:4333962-4333984 TGACCTCTGCAGGAGAGGAAAGG + Intronic
1050804030 9:9651545-9651567 TGTCCTTTGCAGGACATGGATGG - Intronic
1052572080 9:30239617-30239639 TGTCCTTCGTTGTACATGAATGG - Intergenic
1052618782 9:30878104-30878126 TGTCCTTTGCAGAACATGGATGG - Intergenic
1055447629 9:76398709-76398731 CTTCATTTGCAGGACATCAAGGG - Intergenic
1055556974 9:77484057-77484079 TTTTCTTTGGAGAACATGAAAGG + Intronic
1056054996 9:82812629-82812651 TATCCTTTGCAAAGCATGAATGG + Intergenic
1056485337 9:87051301-87051323 TGTCTTTTGCAGAGCATGGATGG + Intergenic
1056635024 9:88324464-88324486 CTTCATTTGCAGGACATCAAGGG - Intergenic
1056844702 9:90027133-90027155 TGTGATTTGCAGGACATAGAAGG - Intergenic
1056991207 9:91412981-91413003 TGTCTTTTCCAGGGAATGAAAGG + Intronic
1058234177 9:102468524-102468546 TGTCCTTTGAGGGACGTGGACGG + Intergenic
1058406463 9:104681056-104681078 TGTCATTTGCACAACATGGATGG + Intergenic
1058549369 9:106097549-106097571 TGTCCTTTGCAGGACATGGATGG + Intergenic
1059552225 9:115240739-115240761 TTTCAGTGGCAGGACATGAAGGG + Intronic
1059831700 9:118103394-118103416 TGTCCTTTGCAGGGCATGGGTGG + Intergenic
1062349173 9:136130803-136130825 TGAATTTTGAAGGACATGAAAGG - Intergenic
1186051300 X:5598504-5598526 CGTCTTTTGCAGAACATGGATGG - Intergenic
1187640241 X:21279763-21279785 TGTCTTTTGCAGGACATGAATGG - Intergenic
1187640561 X:21284263-21284285 TGTCCTTGGCAGGACGTGGATGG + Intergenic
1187724560 X:22189082-22189104 TGTCATTTGCAACACATGGATGG - Intronic
1188090620 X:25960196-25960218 TTTCTTTTGCAGGGCATGGATGG - Intergenic
1189806531 X:44741097-44741119 CTTCATTTGCAGGACATCAAGGG - Intergenic
1189926742 X:45962709-45962731 TGTACTTTGCAGCACATGCATGG + Intergenic
1189943582 X:46153499-46153521 TGACCTTTCCAGGCCATGATTGG - Intergenic
1190373915 X:49769975-49769997 TGTCCTTTGTGGGATATGGATGG - Intergenic
1191026762 X:55922302-55922324 TGTCCTTTGTAGGACATGGATGG + Intergenic
1192458924 X:71300799-71300821 TGTCTTCTTTAGGACATGAAGGG - Exonic
1192699430 X:73452142-73452164 TTTCCTTTTCTGGAGATGAAAGG + Intronic
1193877172 X:86874399-86874421 TGTCCTGTGCAGGACACAGATGG + Intergenic
1193943419 X:87704198-87704220 CTTCATTTGCAGGACATCAAGGG + Intergenic
1194172585 X:90605807-90605829 TTTCCTTTGCAGGACATGGAAGG - Intergenic
1195207668 X:102619246-102619268 TGTCCTTTGCAGCAAATTGATGG - Intergenic
1195213602 X:102674448-102674470 TGTCCTTTCAGGGACATGGATGG - Intergenic
1195374122 X:104209553-104209575 TGTCCTGTGCTGGCCATAAATGG + Intergenic
1196486568 X:116217303-116217325 TGTCTTTTGCAGAACATGGATGG + Intergenic
1196555678 X:117082350-117082372 TGTCCTTTGCATGTCAGAAAAGG + Intergenic
1198136957 X:133762806-133762828 TTTCATTTGCAGGACATCAAGGG - Intronic
1198998341 X:142602866-142602888 TGTCCTTTGCAGAACATGGATGG - Intergenic
1200518812 Y:4183544-4183566 TTTCCTTTGCAGGACATGGAAGG - Intergenic
1201369286 Y:13243777-13243799 TGTCATTTGGAGAAAATGAATGG + Intergenic
1201537193 Y:15063406-15063428 TGTAGCTTGCAGGACATGGATGG - Intergenic
1202275668 Y:23117094-23117116 TGTCTTTTGCAGGAAGTGGATGG + Intergenic
1202290360 Y:23303597-23303619 TGTCTTTTGCAGGAAGTGGATGG - Intergenic
1202428660 Y:24750813-24750835 TGTCTTTTGCAGGAAGTGGATGG + Intergenic
1202442131 Y:24919276-24919298 TGTCTTTTGCAGGAAGTGGATGG - Intergenic