ID: 998047484

View in Genome Browser
Species Human (GRCh38)
Location 5:139000319-139000341
Sequence TTAAACATGAATAAGGATGA AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 389
Summary {0: 1, 1: 0, 2: 0, 3: 24, 4: 364}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
998047476_998047484 7 Left 998047476 5:139000289-139000311 CCATCCTTGTATCCCTGACCCAA 0: 1
1: 0
2: 1
3: 42
4: 405
Right 998047484 5:139000319-139000341 TTAAACATGAATAAGGATGAAGG 0: 1
1: 0
2: 0
3: 24
4: 364
998047478_998047484 3 Left 998047478 5:139000293-139000315 CCTTGTATCCCTGACCCAAGGCA 0: 1
1: 0
2: 1
3: 22
4: 201
Right 998047484 5:139000319-139000341 TTAAACATGAATAAGGATGAAGG 0: 1
1: 0
2: 0
3: 24
4: 364
998047479_998047484 -5 Left 998047479 5:139000301-139000323 CCCTGACCCAAGGCAATTTTAAA 0: 1
1: 0
2: 0
3: 22
4: 267
Right 998047484 5:139000319-139000341 TTAAACATGAATAAGGATGAAGG 0: 1
1: 0
2: 0
3: 24
4: 364
998047480_998047484 -6 Left 998047480 5:139000302-139000324 CCTGACCCAAGGCAATTTTAAAC 0: 1
1: 0
2: 0
3: 7
4: 175
Right 998047484 5:139000319-139000341 TTAAACATGAATAAGGATGAAGG 0: 1
1: 0
2: 0
3: 24
4: 364

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
998047484 Original CRISPR TTAAACATGAATAAGGATGA AGG Intronic
905225297 1:36474832-36474854 TCACACATTAATAAGGATGGAGG - Intronic
907129516 1:52083340-52083362 GTGAACATGATTAAAGATGATGG + Exonic
908199478 1:61779680-61779702 TTAAAAATTATTAAGGATGGAGG - Intronic
908365013 1:63412649-63412671 TTAAAAATTACTATGGATGAAGG - Intronic
908450388 1:64248531-64248553 TTAAAAATGAACAAGCATTAGGG + Intronic
908562401 1:65319764-65319786 TAAAATAAGAATAAGGATCAGGG - Intronic
908779507 1:67676820-67676842 TTAAACTTGGAGAAGAATGAAGG + Intergenic
909480623 1:76125798-76125820 TTAAAAATGCATCAGGATGAAGG - Intronic
909518924 1:76544809-76544831 TTTCACAGGAATAAGCATGATGG + Intronic
911157325 1:94649876-94649898 TTGAACATGCAGAAGCATGATGG + Intergenic
912154382 1:106899338-106899360 TTAAACATAAAAGAGGAAGAAGG - Intergenic
912280857 1:108311874-108311896 TCAAACATGCGGAAGGATGATGG - Intergenic
913096842 1:115526165-115526187 TTAAACATAAAAAAGTGTGATGG + Intergenic
914814653 1:151054631-151054653 TTAGACATTATTTAGGATGAAGG + Intronic
916076709 1:161204437-161204459 ATAAATCTGAATAAGAATGATGG - Intronic
916279778 1:163036920-163036942 TAAGACATGACTAGGGATGAGGG - Intergenic
916926085 1:169522019-169522041 ACAAACATGAAAAAGGATAAGGG + Intronic
917169310 1:172152346-172152368 TTAAAGATTAAAAAGAATGAGGG - Intronic
917416906 1:174819999-174820021 TTAAACAGGATCTAGGATGAAGG + Intronic
918858608 1:189792116-189792138 TTGCACATGAATAATGTTGATGG + Intergenic
920285983 1:204880153-204880175 TTAAACATGGACAGGGATGAGGG - Intronic
920631756 1:207659393-207659415 GTAGACATGAAAAGGGATGAGGG - Intronic
920647659 1:207815216-207815238 TTAAAAATGAAAAATGATGACGG - Intergenic
921106675 1:211987820-211987842 TGAAACATAAATATGGATAAAGG + Intronic
922633385 1:227137912-227137934 CTACACATGAATATGGGTGAAGG + Intronic
923714912 1:236416599-236416621 TTCAGCATGAATAAGGACAAAGG - Intronic
924672171 1:246140194-246140216 TAAAACAGGTAAAAGGATGATGG + Intronic
924838722 1:247684205-247684227 TTCAACATTATTAAGCATGAAGG - Intergenic
1063201625 10:3789620-3789642 TTAAAAGTGTATAAGAATGATGG - Intergenic
1063539035 10:6913524-6913546 ATAGATATGAATATGGATGAAGG + Intergenic
1064566523 10:16645175-16645197 GTAAACATAAATAAGGATTTGGG + Intronic
1064619306 10:17198707-17198729 TTAGAAATGAACAAGGGTGATGG + Intronic
1065067359 10:21983836-21983858 TTAGAAATGAATAATGAAGATGG + Intronic
1066471559 10:35702668-35702690 AGAAACATGAATAAAGCTGAAGG - Intergenic
1066683107 10:37954705-37954727 TTAAAGATGCATAAATATGAAGG - Intronic
1068228982 10:54145122-54145144 TAAAATATGAATAAAGAAGAGGG + Intronic
1070684695 10:78472004-78472026 TTAAAAATGAAGAAAAATGAAGG + Intergenic
1070871352 10:79756320-79756342 ATAAACATTAATAAGGAATATGG + Intergenic
1071638288 10:87278528-87278550 ATAAACATTAATAAGGAATATGG + Intergenic
1071656956 10:87459424-87459446 ATAAACATTAATAAGGAATATGG - Intergenic
1073628803 10:105127099-105127121 TTAAACATGATTAACGTTCAAGG + Intronic
1074033430 10:109712618-109712640 TTTCACATGAATAATGATGTTGG + Intergenic
1074852489 10:117449847-117449869 CTAAACAGGAAAAAGGAGGAAGG + Intergenic
1074958966 10:118421489-118421511 TGAAAGATGAATAATGATGAAGG - Intergenic
1075000093 10:118790353-118790375 TTAAACATCACTAAGTATCAGGG + Intergenic
1078381646 11:10847679-10847701 TTAAACATAAGTAAAGATTAGGG - Intronic
1080186815 11:29498302-29498324 TAAAACAAAAATAAAGATGAAGG + Intergenic
1081058850 11:38447147-38447169 TTAAACAGGACAATGGATGAAGG - Intergenic
1082926974 11:58559096-58559118 TTAAAGATTAATGAGGTTGAGGG - Intronic
1083707398 11:64525880-64525902 TTAAACAGGAACCAGGCTGAGGG - Intergenic
1084536106 11:69758123-69758145 TTAAAAAAGAAAAAGGATGATGG - Intergenic
1085678695 11:78550020-78550042 TTTAACATGACTAAGGATGTTGG - Intronic
1086193238 11:84105857-84105879 GTAAACTTGAATATCGATGATGG - Intronic
1086198742 11:84174198-84174220 TTGAACATGAAATAGGATGGCGG - Intronic
1086443954 11:86854710-86854732 TTCCACATGCATAAGAATGAAGG - Intronic
1086623136 11:88912669-88912691 TTGAACATTAACAAGGATGTTGG - Intronic
1087209084 11:95427914-95427936 TTAAACTTGTATAGAGATGAAGG - Intergenic
1087654556 11:100906731-100906753 TTAAATGTAAATAAGGAAGAGGG - Intronic
1087766570 11:102161505-102161527 TTAAACATGGATATATATGATGG - Intronic
1088677589 11:112210793-112210815 TTAAACTAGAATAAGGTTGGTGG + Intronic
1089637408 11:119824217-119824239 TTATACATCAAAGAGGATGATGG + Intergenic
1091056713 11:132426025-132426047 TTTAACATTAAAAAGGGTGAAGG - Intronic
1092520728 12:9269952-9269974 TTAAACCAGTATAAGGCTGAAGG - Intergenic
1092955068 12:13542256-13542278 TTAAAGATGAACAAGGAGTAAGG + Exonic
1093792631 12:23271342-23271364 TGAAAAATGAATAAGAATGTAGG + Intergenic
1094692471 12:32783414-32783436 TTACACCTTAATAAAGATGAGGG - Intergenic
1094794288 12:33952478-33952500 TTGAAAATGAGTAAGGAAGATGG - Intergenic
1095335471 12:41019519-41019541 TTAAACATTAAATAGGATTATGG + Intronic
1098293632 12:68982241-68982263 TAAAAAATAAATAAGGAGGAAGG - Intergenic
1099210200 12:79776148-79776170 TAAAACATGTATCAGGAAGAAGG + Intronic
1099738796 12:86604027-86604049 TTAAACCTCAATAAAGCTGAGGG + Intronic
1100180627 12:92081854-92081876 ATAAATATGAGTAATGATGATGG - Intronic
1100938928 12:99703553-99703575 TGACACATGAATAAGGAGGGAGG - Intronic
1101023564 12:100578135-100578157 GTAAACCTGGAGAAGGATGATGG + Intronic
1102353424 12:112212059-112212081 TTAAATATGTATGAGGATGCTGG + Intronic
1103619210 12:122175961-122175983 TAAAATATGAATAAGGAGGCCGG - Intronic
1103850891 12:123932870-123932892 TTAAACATCAATGAGAAAGATGG - Intronic
1106465557 13:30011357-30011379 AGAATCATGAATAATGATGATGG + Intergenic
1106907741 13:34426251-34426273 GTAAACATGCAAAAGAATGACGG + Intergenic
1107679537 13:42834109-42834131 TTAAAAATGAAAAAAAATGAAGG + Intergenic
1108072080 13:46638505-46638527 TTAAACATAAAGTAGAATGAAGG - Intronic
1108732872 13:53253265-53253287 TTAACCATGAGGAAGGAGGAAGG + Intergenic
1108812141 13:54240315-54240337 TTAAAGCAGAATAAGGAGGATGG - Intergenic
1109550222 13:63886102-63886124 TTAAAAATACATAAGGATTAAGG - Intergenic
1109732537 13:66434275-66434297 TTAAACATTAATAAGGACCTGGG + Intronic
1109748909 13:66664487-66664509 CTAAACATGAATAAGAATTAAGG + Intronic
1110372543 13:74756167-74756189 AAAAACATGAAAAAGCATGAAGG + Intergenic
1111072299 13:83184415-83184437 TTTAACATGAAATACGATGATGG - Intergenic
1111349100 13:87002545-87002567 ATAAACATGAAGAATTATGATGG + Intergenic
1111553087 13:89841580-89841602 TTAGACATGAAAAAGGAAGCTGG + Intergenic
1113156689 13:107330815-107330837 TCAAACAAGAATAAAAATGAAGG + Intronic
1113509617 13:110842760-110842782 TTTAAAATGAATAAAGGTGAGGG - Intergenic
1113633937 13:111907239-111907261 TTAAACATGAAAAAGAAAAAAGG - Intergenic
1115005866 14:28483854-28483876 TTAAGCAGGAAAAAGAATGAGGG - Intergenic
1116034851 14:39615499-39615521 TTAACCATGAGTAAGGATATAGG - Intergenic
1116740430 14:48747360-48747382 TTAGACCTGTAAAAGGATGACGG - Intergenic
1117786496 14:59291516-59291538 TTACACATGATTATGAATGATGG - Intronic
1118251905 14:64170057-64170079 TTAAACATGATTAAGGCTTTGGG - Intronic
1120656252 14:87193585-87193607 TTCAACATGAATAAGATAGATGG + Intergenic
1124091642 15:26609574-26609596 GTAGACATGAATAGGGAAGATGG - Intronic
1125068457 15:35522050-35522072 TTAAACAGGAAAAGGGTTGAGGG + Intronic
1125762426 15:42105766-42105788 TTAAAGAAGTATAAAGATGAAGG - Intergenic
1126019492 15:44386471-44386493 TTAAAGATGAACAAAGTTGAAGG - Intronic
1127269126 15:57385189-57385211 TTAAACAGGAAAATGGATGGTGG - Intronic
1127279454 15:57476380-57476402 ATAAAAATGAATAAGGAAAATGG - Intronic
1127552437 15:60054059-60054081 CTTAACCTGAATCAGGATGAGGG - Intronic
1128294868 15:66509874-66509896 TTAAAAATCAATGAGGAAGATGG + Intronic
1128626293 15:69208564-69208586 TTTAAAATGAATAAAGTTGAAGG - Intronic
1129218901 15:74119738-74119760 TTATACTTTAATAAAGATGAGGG + Intronic
1129344854 15:74910704-74910726 TTAAACATTAAAAGGGATGGAGG + Intergenic
1131471611 15:92702474-92702496 ATAAAGATGAATAATGATAATGG + Intronic
1131678545 15:94697551-94697573 TCAAACATGAATATAGATGTGGG + Intergenic
1131850106 15:96532127-96532149 TTAAGTATGAATAAGAGTGAAGG - Intergenic
1132396128 15:101475798-101475820 TTTAACTTGAATAACAATGAGGG + Intronic
1133471975 16:6084220-6084242 ATAAAAATAAATAAGGAGGAAGG - Intronic
1134459531 16:14419414-14419436 TTAAACAGGAAAAAGGCTGCAGG - Intergenic
1135305199 16:21361928-21361950 ATAAACAAGAAGAAGTATGAGGG - Intergenic
1136301943 16:29341093-29341115 ATAAACAAGAAGAAGTATGAGGG - Intergenic
1140221267 16:73046278-73046300 TCAAACATGAAAAACAATGAAGG - Intronic
1140560715 16:75977609-75977631 TTAAACATGAAGGGTGATGACGG + Intergenic
1141287884 16:82689637-82689659 TTTAACATAAATCAGGATCATGG + Intronic
1146079858 17:29769624-29769646 TTAAACATCAAATAAGATGATGG - Intronic
1147043325 17:37734689-37734711 TTAAAGATGAATAAACATGGAGG + Intronic
1149194010 17:54097938-54097960 TTGAAAATGAATAAGTATAAAGG - Intergenic
1149200750 17:54183274-54183296 TTGAACATGCATAATGCTGATGG - Intergenic
1153437267 18:5080943-5080965 TTAGAAATGAATGAGAATGAAGG + Intergenic
1153763159 18:8351099-8351121 TTAAGCAGGCATAAGGAGGAAGG - Intronic
1155099065 18:22590537-22590559 TGAAACATCAATAATTATGATGG - Intergenic
1157238385 18:45985526-45985548 TTCAACAAGAATAAGGGTGCAGG + Intronic
1157313805 18:46572136-46572158 TTGGACAAGGATAAGGATGATGG - Intronic
1158134759 18:54195347-54195369 TTAAACATGACTAATGTTTAAGG - Intronic
1159258661 18:65981168-65981190 TTAAAAATGTGTAAGGATGCCGG - Intergenic
1159290182 18:66407507-66407529 TAAAACAGGTAAAAGGATGATGG - Intergenic
1159932005 18:74322377-74322399 TTAGGCATGAATAAGGAAAATGG - Intronic
1159979279 18:74756259-74756281 TTGAAAAAGAATAAGGTTGAAGG - Intronic
1160118618 18:76106779-76106801 TTATAAATGAAGGAGGATGAAGG - Intergenic
1160278317 18:77460926-77460948 TTATACATCAATGAGGCTGAGGG - Intergenic
1160310501 18:77785742-77785764 TTAAACATCATTTAGAATGATGG - Intergenic
1162633571 19:11947716-11947738 TTAAACGTGACTGAGGCTGAGGG + Intronic
1164449628 19:28349850-28349872 TTAAAAATGAAAAAGGATAATGG - Intergenic
1166608657 19:44168612-44168634 TTAATCATGAATAAATATTAAGG - Intronic
1168135774 19:54350051-54350073 TTAAACATGACTAAGAAAGCCGG - Intergenic
925008755 2:466775-466797 TTAACAGTGAAGAAGGATGAAGG - Intergenic
926381510 2:12295166-12295188 TTAAACATGAACCTGGATGTTGG - Intergenic
926442477 2:12904289-12904311 TGAAACATGAAAAAGATTGATGG - Intergenic
927224838 2:20753972-20753994 TTAAACATACATAAGAAGGAAGG + Intronic
927469826 2:23364977-23364999 TTAAAAATAAATAGAGATGAGGG - Intergenic
929976047 2:46635984-46636006 TAAAAAATGAAAAAGGATAATGG + Intergenic
930285222 2:49419633-49419655 TAAAACATCAATAGGGAGGAGGG - Intergenic
930338297 2:50079008-50079030 TTAATAATGTAGAAGGATGATGG - Intronic
930560468 2:52954233-52954255 TGAGACATGAAGAAAGATGAGGG - Intergenic
931004844 2:57837309-57837331 TTAAAAATAAATAGGGAAGAAGG + Intergenic
931059031 2:58505431-58505453 TTATGCATGAATAAGTATTAGGG - Intergenic
931517923 2:63061064-63061086 TTAAACATGAAAATGCATGGGGG - Intergenic
931559934 2:63549802-63549824 ATAAACAGGAATTAGGAAGACGG + Intronic
932393923 2:71425306-71425328 TTAAGCAGAAATAAGGATTATGG + Intronic
933283830 2:80362333-80362355 TAAAGCAAGAAAAAGGATGAGGG + Intronic
934879340 2:97960344-97960366 TTAAACATGAAGAAGGTGGATGG - Intronic
935252867 2:101280244-101280266 TAAAAGAAGAATAAAGATGAAGG + Intronic
935319944 2:101876773-101876795 TTAAACATAAGAAAGGATAAGGG - Intronic
936540692 2:113348428-113348450 ATGTACATGAATCAGGATGATGG - Intergenic
936761804 2:115794759-115794781 TTAAAAATGAATAAGGACTCCGG - Intronic
936800795 2:116262485-116262507 TCAAACATGAAGAAGGAGGCAGG + Intergenic
939225924 2:139364171-139364193 TTCAACATGAATTTTGATGAGGG - Intergenic
939857432 2:147376732-147376754 ATAAAAATGCATATGGATGAGGG + Intergenic
939874952 2:147567208-147567230 TAAAAAATAAATAAAGATGAGGG - Intergenic
940448434 2:153807077-153807099 TTGGGCATGAATAATGATGATGG - Intergenic
940625097 2:156165151-156165173 TTAAAAAAGAATAAGGGAGAGGG + Intergenic
940685621 2:156846856-156846878 TTAAAAATAAATAAGGATATGGG + Intergenic
940887708 2:159004014-159004036 GTGAACATGATTAAAGATGATGG + Intronic
943170577 2:184392885-184392907 TTAAAGTTGAAGAAGGAAGAGGG + Intergenic
943221988 2:185121394-185121416 TTCATCATGAACAAAGATGATGG + Intergenic
943492306 2:188570229-188570251 GTAAACATGGATAGAGATGAAGG + Intronic
944303672 2:198155376-198155398 ATTAACATGATTAAAGATGAGGG - Intronic
946073285 2:217052795-217052817 ATAGACATGAATAAGGAATAAGG + Intergenic
946913914 2:224495959-224495981 TTAAAAATGAAACAGGAAGATGG - Exonic
948699887 2:239752896-239752918 TAAAACCTGAATGAGAATGATGG - Intergenic
1173589372 20:44212066-44212088 TTAAACATGAAGCATGATGTTGG + Intergenic
1177158061 21:17518806-17518828 ATGAACATGATTAAAGATGATGG - Intronic
1177294919 21:19161593-19161615 GAAAAAATGAAGAAGGATGATGG - Intergenic
1177668155 21:24188718-24188740 TTGAACATGAACAAGCATGAGGG - Intergenic
1178047124 21:28708124-28708146 TTAAACATGATTAAAAATCATGG - Intergenic
1178663603 21:34527194-34527216 TTACAAAAGAAAAAGGATGAAGG + Intronic
1179003979 21:37493448-37493470 TTAAAGATGATAAAGAATGAAGG + Intronic
1179535840 21:42051338-42051360 TTCTATTTGAATAAGGATGATGG - Intergenic
1182133849 22:27881921-27881943 TTCAAAATGAAAAAGAATGATGG - Intronic
1183031165 22:35106253-35106275 TAAAACAAGAATAATGAGGAAGG - Intergenic
1183779074 22:39987146-39987168 TTAAAGATGAAGAAGGATTTCGG - Intergenic
1184912165 22:47543344-47543366 TTAAATATGTATATGCATGATGG + Intergenic
949200437 3:1371752-1371774 TGCAACATGAATAGGGAAGATGG - Intronic
949329522 3:2906532-2906554 TTAAACTTGAAAAAGAAAGATGG + Intronic
949672317 3:6413414-6413436 TAAAAAATGACTATGGATGAGGG + Intergenic
951093404 3:18600879-18600901 CTAAATGTGAATTAGGATGAAGG + Intergenic
951664154 3:25103381-25103403 TTAACCATGAAAGAGGAGGAAGG - Intergenic
951842579 3:27049806-27049828 AAAAACATGGATAAGGACGAAGG - Intergenic
952460896 3:33525297-33525319 TTAAAAATGAGAAAGGATAAAGG + Intronic
954829344 3:53406112-53406134 TAAAAAATGACAAAGGATGAAGG + Intergenic
955011578 3:55021733-55021755 TTAGAGATGAATAAGAATGAAGG - Intronic
955106523 3:55904036-55904058 TTAAACACGAAACAGGATTATGG - Intronic
955197555 3:56819339-56819361 TAAAACATGGAGAAGGATGAGGG - Intronic
955303047 3:57801694-57801716 TAAAAAATGAATAAAGATCACGG - Intronic
956542780 3:70361436-70361458 GGAAACATGAACAAAGATGACGG - Intergenic
957192932 3:77033407-77033429 TTAAACATGACTCAGAATGAGGG + Intronic
957230415 3:77506402-77506424 TTAAACATAAATAAGGCAAAGGG - Intronic
957248469 3:77742060-77742082 ATAAACCTGAATAAAAATGAGGG + Intergenic
957562253 3:81837474-81837496 TTCAACATGAAGAAAGATGAAGG - Intergenic
958457784 3:94354298-94354320 TTAGAAATGAAGAAGGAAGAAGG + Intergenic
958605401 3:96351648-96351670 ATAAGCATGAATATGTATGATGG - Intergenic
959127375 3:102306853-102306875 TTAAAAATGAAATATGATGATGG + Intronic
959280847 3:104336562-104336584 AGAAACATGAAAAAGTATGAAGG + Intergenic
959322453 3:104894555-104894577 CAAATCATGAATAAGAATGAAGG - Intergenic
959965226 3:112346553-112346575 AAAAACATGAATATGGTTGATGG - Intronic
959999972 3:112721181-112721203 TGAAATATGAAAGAGGATGAGGG - Intergenic
962467625 3:135674907-135674929 GGAAACAGGAATAAGGATGGTGG + Intergenic
962863941 3:139431005-139431027 TTAAACATGAATTTTGAAGAGGG - Intergenic
962874207 3:139523308-139523330 TGAGACATGAACAAGCATGATGG + Intronic
963385146 3:144583161-144583183 TTAAACATGTAGAAGCATAATGG + Intergenic
963954141 3:151234597-151234619 TTACACAGGAAGAAAGATGAAGG + Intronic
964787037 3:160408268-160408290 TTACATTTGAATAAGGATAAAGG + Intronic
965815809 3:172635598-172635620 TCAAACATGAAAAAGGAGCAGGG + Intronic
965994832 3:174868949-174868971 GAAGACATGAATAATGATGATGG + Intronic
966058882 3:175731832-175731854 TTAAAAAAGAAAAAGGAGGAGGG - Intronic
966366084 3:179188828-179188850 CTAAACATTAATAAAGGTGAAGG - Intronic
967263034 3:187663405-187663427 TTATACATGGATTAGCATGACGG - Intergenic
967314875 3:188142815-188142837 ATAAAAATGAATAAGGCTCAGGG + Intergenic
967420308 3:189265143-189265165 TTGTATATGAATAAGGAGGAAGG + Intronic
967800284 3:193650974-193650996 TAAAACATGAATAAGTGTTAAGG + Intronic
970313026 4:14802276-14802298 GTAAAGATGAATAAGTATTAAGG - Intergenic
970807443 4:20053066-20053088 TTATAAATGAATAAATATGAAGG - Intergenic
971216334 4:24665563-24665585 GAAAACATAAATGAGGATGAGGG - Intergenic
971436849 4:26635864-26635886 TTAGACAAGAATAAGAATGTTGG + Intronic
971617011 4:28803838-28803860 TTTAGCATGCATAAGCATGAGGG + Intergenic
972443870 4:39124369-39124391 TTGAACAAGAATAAAGTTGAAGG + Intronic
973106321 4:46342957-46342979 TTAAACATGAATAAACAGGCAGG - Intronic
973121585 4:46526842-46526864 GTAATCATGAATAATCATGAGGG + Intergenic
973833706 4:54788550-54788572 TTATGCATGCATAAGGAAGAGGG + Intergenic
975335683 4:73172331-73172353 TTAAACATGAAGGAGAAAGAGGG + Intronic
975408461 4:74019830-74019852 TTAAAAGTGAATAAGCATCATGG - Intergenic
975778554 4:77817088-77817110 TTAAACATTAAAAAGGATCAAGG - Intronic
976015600 4:80549269-80549291 ATAAACATAAATGATGATGATGG + Intronic
976654413 4:87473103-87473125 TTAAACTTACATAATGATGAAGG + Intergenic
976879584 4:89903391-89903413 TTGAACATAAATGATGATGATGG + Intronic
977436441 4:97001688-97001710 TTAAAGAGGAATTAGGAGGATGG + Intergenic
977607551 4:98997122-98997144 AAAAATATGAATAAGAATGAAGG + Intronic
977809483 4:101343705-101343727 TTAAAAATGAAAGAGAATGATGG - Intronic
978891237 4:113830750-113830772 TTAAGCAAGCATAAGAATGATGG - Intergenic
979283739 4:118897424-118897446 TTAAACAGGATGAAGGAAGAGGG - Intronic
980081166 4:128345567-128345589 TTAAATAGGGATAATGATGATGG + Intergenic
980097094 4:128502262-128502284 TTAAATAAGTAAAAGGATGATGG - Intergenic
980490686 4:133524042-133524064 ATAAGGATGAATAAGGTTGAGGG + Intergenic
981634164 4:146855856-146855878 TTAAACAGGAATAAGTGTGTGGG - Intronic
984543452 4:181070133-181070155 TAAAACGTGGAGAAGGATGATGG + Intergenic
985277023 4:188246947-188246969 CTAAACTTGAAGAATGATGATGG + Intergenic
986887601 5:12258885-12258907 TTAAATAATAATAAAGATGATGG + Intergenic
987191419 5:15482430-15482452 TTCAACATGAAGAAACATGAAGG + Intergenic
987368070 5:17167743-17167765 ATATGCATGAAAAAGGATGAGGG + Intronic
988705478 5:33722328-33722350 TTTAATATCAATAATGATGATGG + Intronic
988932685 5:36052434-36052456 TTACACATGGATAATGAAGAAGG - Intronic
989098372 5:37801852-37801874 TTAAACATGTATCTGGATGACGG + Intergenic
989953465 5:50329417-50329439 ATAAATAAAAATAAGGATGATGG - Intergenic
990422743 5:55652911-55652933 CTAAAAATAAATAAGGGTGAGGG + Intronic
990544922 5:56814196-56814218 TGAAACATGATTAAGGAGGGGGG - Intergenic
992821293 5:80499143-80499165 TGAAGCATGAACAAGGATTAGGG + Intronic
994253257 5:97562299-97562321 CTATACATGAATAAAGAAGAGGG - Intergenic
994704959 5:103192425-103192447 TGAAACATCATTAAGGGTGAAGG - Intronic
994798471 5:104338194-104338216 CTTAACATGATTAAGGATAACGG - Intergenic
994945095 5:106377539-106377561 ATATACATGAAGAAGGCTGAAGG - Intergenic
996081985 5:119267430-119267452 TCAAGCCTGAATAAGGATGGAGG - Intergenic
998047484 5:139000319-139000341 TTAAACATGAATAAGGATGAAGG + Intronic
998283862 5:140839039-140839061 TTCAACGTGAATAAGGATAGAGG + Intronic
998362166 5:141597942-141597964 TTCAACAGGAATAAGGTTGAGGG - Intronic
999571214 5:152921781-152921803 TTAAACATGCTTTTGGATGATGG - Intergenic
999936439 5:156491621-156491643 ATAAACATAAATAAAGATAAAGG + Intronic
1000263268 5:159610721-159610743 GGAAACATAAATAAAGATGAGGG + Intergenic
1000476811 5:161718717-161718739 TTTAACATCACTAACGATGAGGG - Intergenic
1001113658 5:168920560-168920582 TTAAAACTGAATAAGGAAGTCGG - Intronic
1003995359 6:11535254-11535276 TTAAAAATGACTAAGGCTAATGG + Intergenic
1004439539 6:15635859-15635881 TTAAACGTGAGTAAGGAAGAAGG - Intronic
1004597035 6:17109731-17109753 TTAAACATGAGCAAAGATGGTGG - Intronic
1005095215 6:22107143-22107165 TTACACATGAATAAGCAAGATGG + Intergenic
1005267413 6:24126431-24126453 TTATGCATGAAGAAGGAGGAAGG - Intronic
1005915750 6:30349274-30349296 TTAAACATGAAAAAGGAAAGAGG - Intergenic
1006244791 6:32722361-32722383 TTAATACTGAATAATGATGATGG + Intergenic
1007005027 6:38353380-38353402 TGAAAAATGAATAAGGGAGAGGG + Intronic
1007137830 6:39539915-39539937 TTTTACATGTATCAGGATGAAGG - Intronic
1007338286 6:41171120-41171142 TTAAAAATGGGTAAGGATAAGGG - Intergenic
1008369081 6:50713238-50713260 TTAAAAATAAATAATGGTGATGG - Intergenic
1009458590 6:63886638-63886660 TAAGACATCAATAAGGATAATGG - Intronic
1009559265 6:65218813-65218835 TTAAAGAGGAATAAGGAGTAGGG + Intronic
1009620624 6:66071287-66071309 TTAAACATCTATAAGGAGGTTGG + Intergenic
1010134862 6:72539512-72539534 TTCAACATCAGTAAGCATGAGGG - Intergenic
1010707167 6:79128456-79128478 TGGAATATGAATAAGAATGAAGG + Intergenic
1011099087 6:83701777-83701799 TTAAAAATGAATAATAAAGAAGG + Intronic
1012165279 6:95941997-95942019 TTAAACATGAAGAGTGATCAGGG - Intergenic
1013845734 6:114448725-114448747 TTAAACATGAAAGAGGCTGATGG + Intergenic
1014469069 6:121792851-121792873 TTTTCCATGGATAAGGATGAGGG + Intergenic
1014682422 6:124448291-124448313 TTAAACATCAAGTAGGCTGAGGG - Intronic
1015104465 6:129519982-129520004 ATAAACAGGAATAAAGATGTTGG + Intergenic
1015757712 6:136624815-136624837 TTTAACATGAATAAGTTTAATGG + Intronic
1016587103 6:145701441-145701463 CTAACCATGAAGAAGGGTGAAGG + Intronic
1016991402 6:149931834-149931856 ATAAAAATGAATAAATATGATGG + Intergenic
1017092334 6:150771111-150771133 TTAAAGAAAAATAAGAATGAGGG + Intronic
1017160825 6:151364181-151364203 CTATACATGAAATAGGATGATGG + Exonic
1017546256 6:155453790-155453812 AAACACATGAATGAGGATGATGG - Intronic
1017981728 6:159406695-159406717 TTAGACAAGAGTAAGGAGGAGGG + Intergenic
1018976044 6:168566955-168566977 TTAATCATAAATAAGGATAGCGG - Intronic
1020648173 7:10841498-10841520 TGAAACATTAAAAAGGAAGAAGG + Intergenic
1021397388 7:20167169-20167191 TAAAAAAAAAATAAGGATGATGG - Intronic
1021533875 7:21680727-21680749 CTAAACAAGAATAAGAATAAAGG + Intronic
1022081140 7:27022808-27022830 TTAAAAAGAAATTAGGATGAAGG - Intergenic
1022120472 7:27303228-27303250 CTAAACATGAACAAGGATTCTGG + Intergenic
1022222569 7:28328224-28328246 CTAAAACTGAATGAGGATGATGG - Intronic
1023307525 7:38846748-38846770 AAAGACATGAACAAGGATGATGG + Intronic
1023628594 7:42140803-42140825 TTATACAAGAAAAAGGAGGAGGG + Intronic
1024333108 7:48176548-48176570 TTAGTCATGAATAAGAATTATGG + Intronic
1024640517 7:51324927-51324949 ATAAAACTGAATAAGTATGAAGG - Intergenic
1024847078 7:53658903-53658925 TTAAATTTGAAGAAGCATGAAGG + Intergenic
1026499949 7:70935635-70935657 TTAACACTGAATAAGGAAGAGGG - Intergenic
1026580016 7:71607841-71607863 TTAACCATCAAGAAGGAAGAAGG - Intronic
1028050802 7:86183336-86183358 TAAAACAAAAGTAAGGATGAGGG + Intergenic
1028067735 7:86408611-86408633 TTAAATATGAATAATAATAATGG + Intergenic
1028172103 7:87610685-87610707 TTAAACAGTAACAAAGATGATGG - Intronic
1028892464 7:96003390-96003412 TGAAGCAAGAATAAGGATGATGG + Intronic
1029047713 7:97647454-97647476 TTAAAAATGCATCATGATGAAGG - Intergenic
1029190537 7:98768738-98768760 TCAAAAATTAATAAGGTTGAGGG + Intergenic
1029208923 7:98888982-98889004 TTAAACAAGAAAAAGGATTTGGG + Intronic
1030236222 7:107265565-107265587 ATAAACATGAATAAAAATTAAGG - Intronic
1030351878 7:108498593-108498615 TTAAAAATGAATAAAGAAAAGGG - Intronic
1030778782 7:113571326-113571348 TTAAACAAGAAAAAGGAGGTGGG + Intergenic
1030815026 7:114025022-114025044 TTACACAGGATCAAGGATGAGGG + Intronic
1031132877 7:117853273-117853295 TAAAAAATGAAAAAGGAAGAGGG - Intronic
1032446195 7:131985750-131985772 TTAGACATGAACCAGGAAGAGGG - Intergenic
1032625055 7:133582679-133582701 ATAAATATGAATAATGATCATGG + Intronic
1033272142 7:139941791-139941813 TAAAACTTTATTAAGGATGAGGG + Intronic
1034221467 7:149449751-149449773 TTAAAAATTGATGAGGATGAGGG - Intronic
1038126815 8:24683580-24683602 ATAAATATGAATACGTATGATGG + Intergenic
1040508643 8:48074233-48074255 TTAGACATGAGTAAGAATTACGG + Intergenic
1040882863 8:52226889-52226911 TTAAAGATGGATAAGGAAAATGG - Intronic
1041991287 8:63995043-63995065 TTGAAGATGAATAAGTATGAAGG + Intergenic
1042366005 8:67936973-67936995 TTAAATATGATAAAGGATGTGGG - Intergenic
1042416767 8:68528782-68528804 TTAGTTAAGAATAAGGATGATGG - Intronic
1043022622 8:75023311-75023333 TTTAACAGCCATAAGGATGACGG + Intronic
1043395209 8:79828740-79828762 TTAAAAAAAAATAAGCATGAAGG - Intergenic
1043735455 8:83736270-83736292 TTAATCATAAATAAGTAGGAAGG - Intergenic
1044560265 8:93605719-93605741 TTAAAAATGAATACGGGAGAAGG - Intergenic
1045167328 8:99621291-99621313 TTCTCCATAAATAAGGATGAAGG + Intronic
1045216414 8:100153237-100153259 TTAAACATTATTAAGACTGAAGG - Intronic
1045656859 8:104395956-104395978 TCAAACATTAAGAAGGATGGAGG + Intronic
1046155504 8:110284511-110284533 GGAAAAATGAATAAGGATAATGG - Intergenic
1046468634 8:114638502-114638524 TTATTAATGAATAAGGAAGAGGG + Intergenic
1047997401 8:130349889-130349911 TTAAACATGAGTAAGGTTTGGGG - Intronic
1050025719 9:1332725-1332747 TTTAACATGCAAAAGAATGAAGG + Intergenic
1050377304 9:4985829-4985851 TTAAAAAGGAATAAGGAGGCGGG - Intronic
1050914148 9:11109827-11109849 TTAAACATGAAGATGGAATAAGG + Intergenic
1053239053 9:36481621-36481643 TTAAACATGATTGAGGGTGGTGG - Intronic
1055449558 9:76418596-76418618 TTTAACATGCATAAACATGAGGG + Intergenic
1055628631 9:78200533-78200555 TTAACCATGAAAAAGGATTGAGG - Intergenic
1055957166 9:81785131-81785153 TTACTCATGAACAAGGAAGAGGG - Intergenic
1056169382 9:83968677-83968699 ATAAGCATGAATATGTATGATGG + Exonic
1056781005 9:89551109-89551131 TTAAAGATTAATAAGGAAGGGGG + Intergenic
1058094086 9:100839311-100839333 TTAAACATCAATCAAGATGATGG + Intergenic
1060010410 9:120038765-120038787 TTAAAAATAAAAAAGGAAGAAGG + Intergenic
1060373802 9:123100356-123100378 TTAAACATTAATTATGACGAAGG - Intronic
1060868853 9:127022831-127022853 AAAAGCATGAATGAGGATGAAGG - Intronic
1061473712 9:130848175-130848197 TTTAACATGAAAAAGCATGCTGG - Intronic
1185922062 X:4104296-4104318 ATAAAAATGAAAAAGAATGAAGG + Intergenic
1186020683 X:5251567-5251589 TTCAACATGAAGAAAGAAGATGG + Intergenic
1186082412 X:5947367-5947389 TTAAAGATTCATAGGGATGAAGG + Intronic
1186359367 X:8823397-8823419 TTAAAGATGAATAATGATATGGG - Intergenic
1186856970 X:13636014-13636036 TTAAGCATGAATTAAGATGGAGG - Intergenic
1186997565 X:15140012-15140034 ATAAAGATGAATAAGCAGGAGGG + Intergenic
1187689188 X:21847315-21847337 TTATACATGAATATGCATGGTGG - Intronic
1188063001 X:25623991-25624013 ACAGACATGAATAATGATGATGG - Intergenic
1188141865 X:26560102-26560124 TTAAACATGCATATTTATGAGGG - Intergenic
1188410246 X:29863236-29863258 TTAAACAATAATAATGATGATGG + Intronic
1190828561 X:54040989-54041011 TTAAACATGAATTTGGATACGGG + Intronic
1192103756 X:68293345-68293367 TTAAACAAAAATCAGGATCAGGG + Intronic
1192402104 X:70846368-70846390 TTCAACATGAATCAGGATAGTGG - Intronic
1193324462 X:80163380-80163402 TTAAACATGACTAATCATCAAGG + Intergenic
1194532030 X:95061605-95061627 TAAAACAGGATTATGGATGAAGG + Intergenic
1194864239 X:99046689-99046711 AAAAACAGGAATAAAGATGAAGG - Intergenic
1195495983 X:105533913-105533935 GTAAAAATGAATGAGGATGGAGG - Intronic
1195520980 X:105828272-105828294 TTAAACATGAGTATGAAAGATGG + Intronic
1198187253 X:134265608-134265630 TGAAACATTGGTAAGGATGAGGG + Intergenic
1198207699 X:134483626-134483648 TTAACCATAATTAAAGATGAGGG + Intronic
1198224783 X:134635250-134635272 TTTAATTAGAATAAGGATGAAGG + Intronic
1199047178 X:143188467-143188489 TTAAATATGTCTAAGGATTAGGG - Intergenic
1200334196 X:155331486-155331508 TTAAACATGAAAAATAATAATGG + Intronic
1201991016 Y:20026246-20026268 TTAAATTTGAGTAAGGATGGGGG + Intergenic