ID: 998048728

View in Genome Browser
Species Human (GRCh38)
Location 5:139012460-139012482
Sequence ATGGGTAAAAGATAGGATGT CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 266
Summary {0: 1, 1: 0, 2: 2, 3: 25, 4: 238}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
998048728_998048732 9 Left 998048728 5:139012460-139012482 CCGACATCCTATCTTTTACCCAT 0: 1
1: 0
2: 2
3: 25
4: 238
Right 998048732 5:139012492-139012514 AGCATACTTCTTCTCTAAAAAGG 0: 1
1: 0
2: 1
3: 36
4: 254

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
998048728 Original CRISPR ATGGGTAAAAGATAGGATGT CGG (reversed) Intronic
903081144 1:20814392-20814414 ATGAGTAAAGGATAGGCAGTGGG - Intronic
906867454 1:49438043-49438065 AAGATTAAAAGATATGATGTGGG - Intronic
906926267 1:50120454-50120476 ATAGGTAAAAGCTATGATTTAGG + Intronic
907841484 1:58162078-58162100 TTCGGTGATAGATAGGATGTAGG + Intronic
908956145 1:69630690-69630712 AAGGGTAAAAGATAGAAAATAGG - Intronic
912674113 1:111661321-111661343 AGGGGGAAAAGATTGGATGTAGG + Intronic
913177297 1:116286534-116286556 ATGGGCCAAAGATAAGGTGTGGG + Intergenic
913340054 1:117749753-117749775 CTTGGTAATAGATTGGATGTGGG - Intergenic
916190381 1:162172088-162172110 ATGGGTAAAAGATAGTGGGTAGG - Intronic
918735137 1:188052042-188052064 ATAAGTAAAAGAAAGGAGGTTGG - Intergenic
918841960 1:189552601-189552623 ATGGGTCAAAAATATGATGGGGG - Intergenic
920780570 1:208987238-208987260 ATGCATGAAAGAGAGGATGTGGG - Intergenic
921780735 1:219159819-219159841 ATGGCAAAAAGATAGAATTTGGG + Intergenic
921929866 1:220746483-220746505 ATGGGTAAAGGAGAGGATTCTGG - Intergenic
922074155 1:222226309-222226331 TTTGGTAAAAGGTAGGATTTTGG - Intergenic
922715955 1:227872156-227872178 ATGGGAAAAACATAGTATCTGGG - Intergenic
924178095 1:241413223-241413245 ATGGGTATATGATAAGATATGGG + Intergenic
924670934 1:246124512-246124534 ATGGGTACATGTTAGGAAGTTGG - Intronic
924696170 1:246402102-246402124 ATTGGAAAAAGAGAGGATGAAGG - Intronic
1064819471 10:19309788-19309810 ATAGGTAAAGGCTAGGATGGGGG + Intronic
1067383561 10:45797379-45797401 ATGGGTGCAATATATGATGTAGG + Intergenic
1067880617 10:50041421-50041443 ATGGGTGCAATATATGATGTAGG - Intergenic
1068341426 10:55709122-55709144 ACGGGAAAATAATAGGATGTAGG + Intergenic
1068930700 10:62586265-62586287 ATGGGTAAAAGAATGGACTTTGG - Intronic
1068951511 10:62782270-62782292 ATGGGAAAAGCATAGTATGTGGG - Intergenic
1068966396 10:62916155-62916177 ATTGGTAAAACAAAGGAGGTTGG + Intronic
1069407022 10:68112428-68112450 ATTGGTAAAAGTAAGAATGTAGG - Intronic
1072926408 10:99620598-99620620 AAGGGGAAAAGGTGGGATGTAGG - Intronic
1073992274 10:109275662-109275684 CTGCGTTAAAGGTAGGATGTGGG + Intergenic
1074885907 10:117693497-117693519 ATGGGGAGGAGATAGGATGATGG + Intergenic
1078740355 11:14060314-14060336 CTGGGTATTAGATAGTATGTAGG - Intronic
1079251028 11:18788108-18788130 ATTGGTAACTGATTGGATGTAGG - Intronic
1080505094 11:32904557-32904579 AGAGGTAAATGAGAGGATGTGGG + Intronic
1080581320 11:33646171-33646193 ATGGGTGGAAGATGGGATGATGG - Intronic
1081526017 11:43928297-43928319 ATGGTGAAAAGAAAAGATGTCGG + Intronic
1081711651 11:45220473-45220495 ATGGGTAAAAGAATGCATGTGGG - Intronic
1082253965 11:50011986-50012008 ATGGGTAAATGGTATGTTGTGGG - Intergenic
1082663262 11:55941677-55941699 ATGAGTAAGAGATAGAACGTGGG + Intergenic
1083882262 11:65554410-65554432 AGGGGAAAGAGACAGGATGTGGG - Intronic
1085063117 11:73466880-73466902 AGGGGTAGGAGATAGGCTGTGGG + Intronic
1085129244 11:74023637-74023659 AGGGGGAAAAGAAAGGGTGTGGG - Intronic
1086515987 11:87613880-87613902 ATGGGGAAAAACTAGAATGTGGG - Intergenic
1086644976 11:89209233-89209255 ATGGGAAAAACATAGTATTTGGG - Intronic
1087514201 11:99136585-99136607 ATTGGTAAAAGAATGGATGTTGG - Intronic
1087845211 11:102964631-102964653 ATGGGTACAAGATTGGGGGTGGG - Intergenic
1090713285 11:129407538-129407560 ATGAGTAAAACATGGGATTTGGG - Intronic
1091422136 12:350914-350936 ATTGGAAAAAGCTAGGATCTCGG - Intronic
1092569116 12:9702452-9702474 ATGGGTAGAGGATGGGGTGTGGG + Intergenic
1094559898 12:31542363-31542385 AAGGGTAGAAGGTAGGATGGGGG + Intronic
1096929944 12:55196706-55196728 ATGGATACATGATTGGATGTGGG + Intergenic
1097895767 12:64824003-64824025 ATGGATGAAAGAAAGGGTGTGGG - Intronic
1098126512 12:67300352-67300374 CTGGATTAAAGATAGGATGTGGG - Intronic
1098454587 12:70657786-70657808 AGTGGTAACAGATTGGATGTGGG - Intronic
1098706696 12:73700753-73700775 ATGGGAAAAAGGGGGGATGTTGG + Intergenic
1098986348 12:77016365-77016387 AAGTGTAAAAGATAAAATGTTGG + Intergenic
1099029428 12:77506788-77506810 ATGGGAGAAAGAAAGGATGGAGG - Intergenic
1099425508 12:82518494-82518516 ATGGGTACAGGATGGGGTGTGGG + Intergenic
1099589300 12:84567117-84567139 ATGGAGAAAATATAGGAGGTTGG - Intergenic
1102995703 12:117348488-117348510 ATGGTGCAAAGATATGATGTTGG - Intronic
1103169547 12:118804319-118804341 ATGGGTAAATTATATGTTGTGGG + Intergenic
1103653366 12:122450829-122450851 ATGGGCCAAAGATATGAAGTCGG - Intergenic
1103963187 12:124622136-124622158 ATGGGAAAAAACAAGGATGTGGG + Intergenic
1104060031 12:125259838-125259860 AAGGTTAAAAGAGAGGATGGGGG + Intronic
1104575198 12:129960249-129960271 CTGGGGAAAAGAGAAGATGTGGG - Intergenic
1106285020 13:28310793-28310815 ATGGGGAAAAGAAAAGATGGGGG + Intronic
1106601675 13:31192824-31192846 GTGGGTAAGAGAAAGGATTTTGG + Intergenic
1107364793 13:39658532-39658554 AGGGGTACAAGAAAGGAGGTAGG - Intronic
1108149311 13:47515578-47515600 CTGGGTAGAAGGTAGGGTGTGGG - Intergenic
1110235892 13:73217883-73217905 AATGGGAAAAGATAGAATGTGGG + Intergenic
1111251175 13:85603217-85603239 AGGAGTAAAAAATAGCATGTGGG - Intergenic
1111579883 13:90209057-90209079 ATAGGTAAAAAGTAAGATGTTGG - Intergenic
1112227948 13:97558801-97558823 AGGGGCAAAAGATGGGATGGCGG - Intergenic
1112588461 13:100741202-100741224 ATGGGCAAAAAAAAGGAGGTTGG - Intergenic
1114004682 14:18299535-18299557 ATGGGTAAATCATATGAGGTCGG - Intergenic
1114614032 14:24059014-24059036 ATGGGTGAATGATGGGATGAGGG - Intronic
1115862645 14:37705847-37705869 ATGGATAGAAGATAGGAAGGAGG + Intronic
1116666045 14:47776949-47776971 ATAGGGGAAAGATAGGATATGGG + Intergenic
1116876309 14:50115536-50115558 AAGGGAAAAAGAGAGGATTTTGG + Intronic
1117490292 14:56240358-56240380 CTGGGTAAATGATTGGATGTGGG + Intronic
1118596460 14:67439016-67439038 AGTGGGAAATGATAGGATGTGGG + Intergenic
1119518846 14:75270601-75270623 TTGTGTAAAAGAAAGGATCTGGG + Intergenic
1120167499 14:81217366-81217388 ACAGGTTAAAAATAGGATGTGGG - Intronic
1120773909 14:88411543-88411565 ATGGGTAAAGCATAGTATCTGGG + Intronic
1121195126 14:92065104-92065126 GTGGGTAAAAGATAGGTGGGTGG - Intronic
1123218717 14:106837381-106837403 ATGGGCACAAGATGGGATGCAGG - Intergenic
1126106631 15:45151090-45151112 AATGGTAAGAGATAGGATGCTGG - Intronic
1126714424 15:51499443-51499465 TTGGGTAAGAGATGGGATATTGG - Exonic
1128011435 15:64300341-64300363 TTGGCAAGAAGATAGGATGTGGG - Exonic
1129001717 15:72341171-72341193 AAGGGTGAAAGAAAGGATGTAGG - Exonic
1131385124 15:91999425-91999447 ATGGGTATAAAATAGGAAGAGGG + Intronic
1132091342 15:98950173-98950195 ATGGGTGAGAGATAGGAGCTGGG - Intronic
1133476857 16:6131874-6131896 AGAGGTTAAAGATAGGATGAAGG + Intronic
1133488709 16:6246366-6246388 ATGCTTAAAAGATAAAATGTTGG - Intronic
1134557945 16:15182416-15182438 AGGGTTAAAAGAGAAGATGTCGG - Intergenic
1134918482 16:18094019-18094041 AGGGTTAAAAGAGAAGATGTCGG - Intergenic
1135484645 16:22853465-22853487 ATGGGTAAAAGAGAGAATTTAGG + Intronic
1136734354 16:32450332-32450354 CTGGGTAAGAAATAGCATGTTGG - Intergenic
1138047094 16:53736633-53736655 TTGGCAAAAAGAGAGGATGTTGG - Intronic
1138751674 16:59430205-59430227 ATGAGTAAAAGACATGATATAGG + Intergenic
1203018725 16_KI270728v1_random:379270-379292 CTGGGTAAGAAATAGCATGTTGG + Intergenic
1203037060 16_KI270728v1_random:652428-652450 CTGGGTAAGAAATAGCATGTTGG + Intergenic
1143249648 17:5513736-5513758 GTGGGGATAAGATAGGAGGTTGG + Intronic
1148798253 17:50207860-50207882 ATGGGAAAAGGATAGGAGGCAGG + Intergenic
1149031404 17:52087007-52087029 AGGGGAAAGAGATAGGTTGTAGG - Intronic
1149284367 17:55145989-55146011 AAGGGAAAAAGATAAGAAGTTGG - Intronic
1153767895 18:8391994-8392016 ATGAGAAAAATCTAGGATGTGGG + Intronic
1153832799 18:8938111-8938133 ATGGTTAAGCTATAGGATGTGGG - Intergenic
1153859722 18:9189485-9189507 ATTGGAAAAAGATACCATGTAGG + Intronic
1155355350 18:24947024-24947046 TTGGGTAAAAGCAAGGATGTTGG + Intergenic
1155655140 18:28183830-28183852 ATGGTCAAACGATAGGATCTGGG + Intergenic
1158029687 18:52948233-52948255 ATTGGTAAAAGATAGGACTCAGG - Intronic
1158384763 18:56976742-56976764 ATGGGTAAGTGATATGATTTTGG - Intronic
1159852612 18:73543697-73543719 TTGGGTAAAAAATAGATTGTTGG - Intergenic
1160406363 18:78649128-78649150 ATTGGTAAAAGGCAGAATGTGGG + Intergenic
1161934658 19:7364264-7364286 ATGGATAAATGAAAGGATGAAGG + Intronic
1168683842 19:58335996-58336018 ATTGGCAACAGATAGGAGGTGGG + Intronic
925706364 2:6687283-6687305 ATGGGTACAGGATGGGAGGTGGG + Intergenic
928228004 2:29470914-29470936 AAGGATAAAAGAAAGGATGGTGG + Intronic
929747965 2:44678897-44678919 ATGGGAGAAAAATAGGATTTGGG - Intronic
932298462 2:70646007-70646029 ATGGCTAACAGATACGATGAAGG + Intronic
934311380 2:91869113-91869135 CTGGGTAAGAAATAGCATGTTGG + Intergenic
937699527 2:124848164-124848186 TTGGGGAAACGAGAGGATGTTGG - Intronic
937840363 2:126518873-126518895 ATGGGTACAGGATGGGAGGTGGG - Intergenic
938847229 2:135222022-135222044 ATGTTTAAAAGATAATATGTTGG - Intronic
939357682 2:141125344-141125366 ATGGATAGAAGATAGAATGCAGG + Intronic
939437171 2:142192873-142192895 ATTGGTAAAAGATGGTATCTTGG + Intergenic
939793082 2:146605275-146605297 ATGGGTAAATGACAAGAAGTAGG - Intergenic
939992885 2:148892146-148892168 ATGGTTAAAAGCAAGGATGCTGG - Intronic
941143244 2:161811627-161811649 ATGGTGAAAAGAGAGGATGTTGG - Intronic
941908780 2:170742485-170742507 ATTGGTGAATGATTGGATGTGGG + Intergenic
942732533 2:179075867-179075889 ATGGGTAAAGCATAGTATCTGGG - Intergenic
942762233 2:179412815-179412837 GTGAGTCAAAGATAGAATGTTGG - Intergenic
943610370 2:190026185-190026207 ATGGGTAAACTACAGCATGTGGG + Intronic
944692264 2:202168955-202168977 ATGTGTAGTAGATAGGATGTTGG + Intronic
945119286 2:206442368-206442390 ATGATTAAAAGAAAGAATGTGGG - Intergenic
945121169 2:206458766-206458788 TTGGGGAAAAGAGAGGAGGTGGG - Intronic
946002905 2:216497997-216498019 GTGGGTAAAGGGTAAGATGTTGG + Intergenic
946203432 2:218085418-218085440 ATGGAGAATAGATAAGATGTGGG - Intronic
948458349 2:238117626-238117648 ATGGGGAAATGAGAGGCTGTGGG - Intronic
1169367006 20:5000676-5000698 ATGGGTGGCTGATAGGATGTCGG - Intronic
1169830299 20:9817767-9817789 ATGGGTAAGAGATTGGATTATGG - Intronic
1170353616 20:15469259-15469281 ATGAGCAAAAGAAAGGAGGTGGG + Intronic
1171540748 20:25953183-25953205 AGGGGCAAAAGATGGAATGTTGG - Intergenic
1173071643 20:39774026-39774048 GTGGGTAAAGAATAAGATGTGGG - Intergenic
1173480932 20:43398815-43398837 GTGGGTGAAAGTTAGGAAGTGGG - Intergenic
1174032068 20:47637189-47637211 AAGGCTTAAAGTTAGGATGTGGG + Intronic
1174850650 20:53990927-53990949 ATGGGGAAAAGACAGGATTCTGG - Intronic
1175039988 20:56039855-56039877 ATCTTTAAAAAATAGGATGTGGG - Intergenic
1177718355 21:24870378-24870400 AAGGGTAAAAAATAGGATCGTGG + Intergenic
1178938593 21:36885745-36885767 ATGGGGAATAGAGAAGATGTGGG - Intronic
1180429196 22:15230325-15230347 ATGGGTAAATCATATGAGGTCGG - Intergenic
949343577 3:3055015-3055037 ATGGCTAAAAGTCAGGATGGTGG - Intronic
949399616 3:3652178-3652200 ATGGGTAAAAGCCCTGATGTAGG - Intergenic
949488311 3:4563096-4563118 AAGGGTAAAAGCTATGATGTAGG + Intronic
950937368 3:16853278-16853300 ATGGGTAAAAGATAGTTTGCGGG - Intronic
951388803 3:22076420-22076442 ATGATTAAAAAATAGGATGTGGG - Intronic
952401004 3:32964074-32964096 ATAGGTACAAGATAGCATGCTGG + Intergenic
952478881 3:33739282-33739304 ATGGGTAAAATATGGGATATGGG + Intergenic
952688557 3:36176745-36176767 ATGGGTAAAAAACAAAATGTAGG + Intergenic
956975845 3:74577711-74577733 ATGGGTAAAAGTTAAGGTCTTGG + Intergenic
957282793 3:78175043-78175065 ATGAGTAAAAGAAAGAAAGTGGG - Intergenic
958644748 3:96855422-96855444 ATGAGTTAAGGATAGGATATTGG + Intronic
959101732 3:102017658-102017680 ATGGATAAAAGCTGGGAGGTGGG + Intergenic
959220506 3:103513074-103513096 ATGGGTAATAGCTAGGTTGATGG - Intergenic
962103120 3:132363605-132363627 CTGTGGAAAAGATAGGATGGTGG - Intronic
962156791 3:132956670-132956692 ATGGGAAAAGCATAGTATGTGGG - Intergenic
962884109 3:139607739-139607761 AGGGGTAGAAGATAGGATGAGGG - Intronic
963496597 3:146071237-146071259 ATGGGTAAGAAATAGGCTGGAGG + Intronic
966074256 3:175918308-175918330 ATGGATAACAGATAGGATAATGG - Intergenic
966492428 3:180542868-180542890 ATGGCTAAAATATGGGATGTGGG + Intergenic
967350140 3:188505792-188505814 ATGTGAAAAAGATAGAATGAAGG - Intronic
968344816 3:197993161-197993183 ATGAGTATAAGATTGGTTGTGGG - Intronic
968715101 4:2151810-2151832 ATGGGTAAAAGATGAGGAGTGGG + Intronic
968930979 4:3578634-3578656 ATGGGCAAAGGGAAGGATGTGGG - Intronic
971850798 4:31984336-31984358 AAGGCTAAGAGATAGGACGTTGG + Intergenic
971929704 4:33064513-33064535 TGGGGTAAAAGATAAAATGTGGG + Intergenic
972830068 4:42804138-42804160 ATGGGAAAAAGATGTGATGCTGG - Intergenic
973170935 4:47142733-47142755 ATTGGTAATTGATAGGATGTGGG + Intronic
976367465 4:84246680-84246702 AAGGAGAAAAGACAGGATGTGGG - Intergenic
977814030 4:101392638-101392660 ATTAGAAAAAAATAGGATGTAGG - Intergenic
978473204 4:109094242-109094264 ATGGATAAAAGATAGTATTTAGG + Intronic
978598116 4:110400600-110400622 ATGGGGAGAAGAGAGAATGTTGG + Intronic
978702066 4:111659716-111659738 ATGGGTAAAAGATGGATTGGAGG + Intergenic
978980650 4:114940953-114940975 ATGGGTACAGGATGGGGTGTGGG + Intronic
982863671 4:160484108-160484130 ATGGGTAAAATAAATTATGTAGG + Intergenic
983141842 4:164159457-164159479 ATGGGTAAAAGACACAATGGAGG + Intronic
984227532 4:177052931-177052953 ATGGGAAAAAGTTAGGAGGGGGG + Intergenic
985944743 5:3170157-3170179 ATGGGTTAAAGAAATGATGATGG + Intergenic
986221360 5:5771691-5771713 CTAGGTTAAAGTTAGGATGTTGG + Intergenic
986703483 5:10434502-10434524 GTGTGGAAAAGAGAGGATGTGGG - Exonic
987517523 5:18932408-18932430 ATGGCTAAGAGAGAGGATGATGG + Intergenic
987924135 5:24318143-24318165 ATGGGAAAAGCATAGTATGTGGG + Intergenic
989687684 5:44108726-44108748 ATGGGAAAAGCATAGTATGTGGG + Intergenic
989710789 5:44394600-44394622 AGGAGTAAAAGAGAGGAGGTCGG - Intergenic
990088218 5:52005446-52005468 AGGGGTAAAAGAGAGGAGTTGGG - Intergenic
992516039 5:77492849-77492871 ATGTGTAAAATAGAGGATATAGG - Intronic
993017033 5:82545625-82545647 ATGGGCAAGAGAGAGAATGTAGG - Intergenic
993265415 5:85721256-85721278 ATGGGAAAAACATAGCATCTGGG - Intergenic
993462737 5:88204465-88204487 CTGGGTAAACCATCGGATGTGGG + Intronic
994850877 5:105053546-105053568 ATGGGAAAAACATAGTATCTGGG + Intergenic
994914328 5:105953936-105953958 TTGGGTAAAATATAGGATGTCGG + Intergenic
998047934 5:139004947-139004969 TGGGGTAAAAGATAGGATGTCGG + Intronic
998048728 5:139012460-139012482 ATGGGTAAAAGATAGGATGTCGG - Intronic
998856351 5:146398675-146398697 ATGGGCAAAGGATTGGAGGTGGG - Intergenic
999435480 5:151560005-151560027 ATGGGTCTGAGATAGGGTGTTGG - Intronic
999755293 5:154659683-154659705 ATGGGACAAAGCCAGGATGTGGG + Intergenic
1000063938 5:157679258-157679280 ATGCATAAGACATAGGATGTTGG + Intronic
1002664562 5:180813351-180813373 GTGGGCAAAAGATATGCTGTAGG - Intronic
1003166985 6:3688331-3688353 ATGGGGAACAGAGAGGAAGTGGG + Intergenic
1004417658 6:15439190-15439212 TGGGGTAAAAGATAAGATTTTGG + Intronic
1005831741 6:29676584-29676606 AAGGGAGAAAGATAAGATGTGGG + Intronic
1009209824 6:60848843-60848865 ATTAGTAAAAGATGGGATGATGG - Intergenic
1011184491 6:84659096-84659118 AAGGGTAGAAGATGAGATGTGGG + Intergenic
1011898343 6:92260539-92260561 AGGGGTAAAAGATAGCATTAGGG - Intergenic
1019758820 7:2793580-2793602 ATGGGTAAAAGATATGAATAGGG + Intronic
1020081574 7:5288880-5288902 GTGGGTAAAGGATGGGAGGTAGG - Intronic
1021073546 7:16273304-16273326 ATGGGTACAAGATGGGAGGCAGG - Intronic
1021167652 7:17360334-17360356 ATGGGTACAGGGTAGGAAGTGGG + Intergenic
1021233263 7:18110906-18110928 ATGGGGAAGAGTTTGGATGTTGG + Intronic
1021330626 7:19334806-19334828 ATGGGTAAAAGACAAGAGATAGG + Intergenic
1021399552 7:20194107-20194129 ACGGTGACAAGATAGGATGTGGG - Intronic
1022051614 7:26679414-26679436 ATGGGTACTAAATAGGAGGTTGG + Intronic
1023121207 7:36910699-36910721 AGGGTTAAAAGAGAGAATGTTGG + Intronic
1024189327 7:46989462-46989484 ATGTCTAATAGATAAGATGTGGG + Intergenic
1027478153 7:78659623-78659645 AAGGGTAAAGGAGAGGATGCAGG + Intronic
1030344334 7:108415563-108415585 ATGGGTAGAAATTAGGATGTAGG - Intronic
1030495403 7:110292682-110292704 ATGGGTAAAAGTTAATATATTGG - Intergenic
1030931901 7:115535067-115535089 ATGGGTAAAAGAGTAGATGGTGG - Intergenic
1033889046 7:145985715-145985737 ATGGGTCATAGATAGGAATTTGG + Intergenic
1034735334 7:153424039-153424061 GTAGGTAAATGGTAGGATGTGGG + Intergenic
1035078451 7:156197027-156197049 ATGGGTAGATGCTTGGATGTGGG - Intergenic
1038388798 8:27175490-27175512 AAGGGTAAAAGATAGGCAGGTGG - Intergenic
1038853053 8:31299116-31299138 ATCGGTGACTGATAGGATGTGGG - Intergenic
1039006921 8:33049627-33049649 ATGGGTCAGAGATAGGAGTTGGG + Intergenic
1039152655 8:34524464-34524486 CAGGGTAAAGGATAGGATTTAGG - Intergenic
1041157238 8:55000880-55000902 ATGGGTAAAAGCTCAGACGTAGG + Intergenic
1041172567 8:55159957-55159979 TTGGATAAAAGTCAGGATGTGGG + Intronic
1042528577 8:69792041-69792063 ATGGGTAATAGCTAGGATATTGG - Intronic
1045401841 8:101827073-101827095 CTGGGTCAAAGATATGATGTTGG + Intronic
1046786168 8:118268999-118269021 GAGAGTAAAAGAAAGGATGTGGG + Intronic
1048045082 8:130765425-130765447 ATGGGGGAAAGATGGGATGAGGG + Intergenic
1048353732 8:133636530-133636552 ATGGTAAGAAGATGGGATGTAGG + Intergenic
1049374966 8:142285074-142285096 ATGGGTAGATGAAAGGATGATGG + Intronic
1052052777 9:23866776-23866798 ATGGGGAAAGTATAGTATGTGGG + Intergenic
1052075962 9:24140914-24140936 ATGGGTGAATGGTAGGATGACGG - Intergenic
1052289339 9:26824141-26824163 ATGGGTACAGGATGGGGTGTGGG + Intergenic
1053088024 9:35244976-35244998 ATGAAGAAAAGTTAGGATGTTGG - Intronic
1054459143 9:65453312-65453334 ATGGGTAAAGGGAAGGATGTGGG + Intergenic
1055723135 9:79197979-79198001 AAGGGGAAAAGAAAGGAGGTAGG - Intergenic
1056807400 9:89739602-89739624 ATGAGAGAAAGAAAGGATGTGGG - Intergenic
1058441781 9:105015738-105015760 TTGGGTCAAAAATAGGATATAGG - Intergenic
1061644571 9:131990325-131990347 ATAGGTAAAACAGAGGATGAAGG - Intronic
1061768997 9:132903153-132903175 ATGGTTAAAAGAAATTATGTCGG - Intronic
1062724919 9:138066645-138066667 ATGGGTAAAAGATGAAATGATGG + Intronic
1187974887 X:24694946-24694968 CTGGATTACAGATAGGATGTTGG + Intronic
1188550745 X:31361990-31362012 ATGGTTAAAAGATAGGAGGATGG - Intronic
1191117570 X:56867465-56867487 ATGGGTGAAAGGTGAGATGTTGG - Intergenic
1191153199 X:57242726-57242748 ATGGGAAAAGCATAGTATGTGGG - Intergenic
1192450175 X:71239894-71239916 ATGGGGAAGAGAGAAGATGTAGG + Exonic
1193852091 X:86550651-86550673 ATGGGTAAAAGACAGTCTGTGGG + Intronic
1195700878 X:107704718-107704740 CTGGGTAATGGATTGGATGTAGG + Intergenic
1196695663 X:118608555-118608577 ATGTGTAAAAGAAAGAATTTTGG + Intronic
1198470899 X:136946019-136946041 TTGGGTAAACTACAGGATGTAGG - Intergenic
1198745463 X:139885573-139885595 ATGGATAAAAGAAATGAAGTAGG - Intronic
1199219922 X:145306119-145306141 ATGGGTACAAGATTGGGGGTGGG + Intergenic
1201963568 Y:19707893-19707915 ATGGGGAAAAGATGGGTTCTGGG - Intronic