ID: 998050315

View in Genome Browser
Species Human (GRCh38)
Location 5:139026983-139027005
Sequence CTGCTCTCCTTAGGCAAGGC AGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 205
Summary {0: 1, 1: 0, 2: 1, 3: 15, 4: 188}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
998050315_998050321 26 Left 998050315 5:139026983-139027005 CCTGCCTTGCCTAAGGAGAGCAG 0: 1
1: 0
2: 1
3: 15
4: 188
Right 998050321 5:139027032-139027054 ACATCTGCCCAAGATGTCTGTGG 0: 1
1: 0
2: 1
3: 59
4: 426
998050315_998050319 -3 Left 998050315 5:139026983-139027005 CCTGCCTTGCCTAAGGAGAGCAG 0: 1
1: 0
2: 1
3: 15
4: 188
Right 998050319 5:139027003-139027025 CAGCAAAGAGGTGATTAAATTGG 0: 1
1: 0
2: 0
3: 15
4: 218
998050315_998050320 1 Left 998050315 5:139026983-139027005 CCTGCCTTGCCTAAGGAGAGCAG 0: 1
1: 0
2: 1
3: 15
4: 188
Right 998050320 5:139027007-139027029 AAAGAGGTGATTAAATTGGTTGG 0: 1
1: 0
2: 1
3: 28
4: 229

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
998050315 Original CRISPR CTGCTCTCCTTAGGCAAGGC AGG (reversed) Exonic
900337815 1:2173402-2173424 CTGCTGTCCTTGGGCAAAACGGG + Intronic
900733292 1:4277431-4277453 CTGAGCTCCTGAGGCAAGTCAGG + Intergenic
901666930 1:10831377-10831399 TGGCTCTCCTGAGGCAGGGCAGG + Intergenic
903383234 1:22910716-22910738 CTGCACCCCTAAGGCAGGGCAGG - Intronic
907298788 1:53472179-53472201 CTCCTCTCCTTGGCTAAGGCTGG + Intergenic
909466162 1:75976565-75976587 CTGCTCTGCCTAGGCTAGCCGGG - Intergenic
909561997 1:77017420-77017442 GAGCTCTCCATGGGCAAGGCTGG + Intronic
910223917 1:84917079-84917101 CTGCTTCCCTTAGGCTAGGGCGG - Intergenic
913213772 1:116603164-116603186 CTGCTCTCTTTCAGGAAGGCTGG + Intronic
914195434 1:145445930-145445952 CTGCTGTCCTCAGGCAAGTGGGG - Intergenic
915236450 1:154486761-154486783 CTTCTTTCCTGAGCCAAGGCAGG - Intronic
917632375 1:176903129-176903151 CAACTCACCATAGGCAAGGCTGG + Intronic
917927720 1:179803105-179803127 CGGCAATCCTCAGGCAAGGCTGG - Intronic
918145474 1:181752284-181752306 CTTCTCTCTTTAGCCATGGCTGG + Intronic
922028257 1:221773679-221773701 CTGTTCTCCTTAGGAAGGGTGGG + Intergenic
1063161047 10:3419087-3419109 CTGCTCCACTGAGGCAGGGCTGG + Intergenic
1069628662 10:69883635-69883657 CTGCCCTCCTTCCACAAGGCTGG - Intronic
1070806552 10:79274330-79274352 CTGCTCTAATTAGGCGGGGCTGG - Intronic
1074366051 10:112858518-112858540 CTGCTCGCCTTAGCCAAGCATGG - Intergenic
1074772660 10:116743375-116743397 CTGCCCTCGTTTGCCAAGGCAGG - Intergenic
1075864857 10:125709074-125709096 CCTCTCTTCTTAGGGAAGGCGGG - Intergenic
1076130444 10:128010318-128010340 CTGCTGTCTTTAGCAAAGGCTGG - Intronic
1076519291 10:131070727-131070749 CAGCACTCCATGGGCAAGGCTGG + Intergenic
1076589747 10:131574881-131574903 CTGCTCTGCTGAGTCAAGGTTGG + Intergenic
1077116005 11:884933-884955 CAGCTCTCCCTGGGCCAGGCGGG - Intronic
1077366126 11:2162076-2162098 CTGCTGTCCTAAGGCAGGGTGGG - Intergenic
1081657759 11:44868569-44868591 CTGCTTTCCTAGGGCCAGGCGGG + Intronic
1082697907 11:56392849-56392871 CTGCTCTGCTTAAGAAATGCAGG + Intergenic
1088532762 11:110828608-110828630 ATGCTCTCCTTATGGGAGGCTGG + Intergenic
1090259965 11:125312475-125312497 CTGCTCTCCTGGGGCACAGCAGG - Intronic
1091229011 11:133975722-133975744 CTCCTCTCTCTGGGCAAGGCCGG - Intergenic
1091357929 11:134952265-134952287 CTGCTCACCGTAGCCAAGACAGG - Intergenic
1093004475 12:14036373-14036395 CTGCTCTCTTTAGAGCAGGCAGG - Intergenic
1093590594 12:20897180-20897202 CTGCTGTCCTTTGTCAAAGCAGG + Intronic
1095635985 12:44434385-44434407 CTGCTCTCCTTAAGCAATTCAGG + Intergenic
1096239732 12:49953429-49953451 GTTCTCTCCTTACCCAAGGCAGG + Intronic
1099813991 12:87621733-87621755 ATGCTTTCCTCAGGCAATGCAGG + Intergenic
1103003769 12:117406013-117406035 CTGCTCTGCATGGGCCAGGCTGG - Intronic
1104998745 12:132675079-132675101 CTGCTCTGCCCAGGCAAGGTTGG - Intronic
1105217004 13:18293715-18293737 CTGCTCTCTTTCAGGAAGGCTGG + Intergenic
1115172094 14:30520156-30520178 CTTCTCTCCTTTGTAAAGGCAGG - Intergenic
1117834761 14:59792006-59792028 CTGCTCTACTGAGGCAGGGGAGG - Intronic
1120858198 14:89231407-89231429 CTCCTCTCCTGAGGCTGGGCCGG - Intronic
1121278695 14:92685255-92685277 CTGCTCCCCTAAGGCAGGGCTGG - Intronic
1122010992 14:98746828-98746850 CTGCTATCCTGTGGCATGGCAGG + Intergenic
1122219045 14:100223684-100223706 ATGGTTACCTTAGGCAAGGCAGG - Intergenic
1122633490 14:103118923-103118945 CTGCTCCTCTTGGGGAAGGCTGG + Intergenic
1122723972 14:103738616-103738638 CTGTTTTCCTTATGCAAAGCAGG + Intronic
1123000901 14:105293597-105293619 CTGCTCCACTGAGGCAAGGCGGG - Intronic
1124872754 15:33559265-33559287 CTTCTCTACTTAGCCAAAGCTGG - Intronic
1126702161 15:51378111-51378133 TTGCACTCCTAATGCAAGGCAGG - Intronic
1129454945 15:75671757-75671779 CTCCTCTCCTTAGAGAAGGCTGG - Intergenic
1132846916 16:2004908-2004930 CTGGTCACATCAGGCAAGGCTGG + Intronic
1133344735 16:5062329-5062351 GGGCTCTCCTGGGGCAAGGCTGG - Intronic
1135009665 16:18864037-18864059 GTGCTCACCTTAGCCAATGCTGG - Exonic
1136224418 16:28849061-28849083 CAGTTCTGCTTAGGAAAGGCTGG + Intronic
1136313366 16:29431664-29431686 GTGCTCACCTTAGCCAATGCTGG - Intergenic
1136326808 16:29533430-29533452 GTGCTCACCTTAGCCAATGCTGG - Intergenic
1136441499 16:30273414-30273436 GTGCTCACCTTAGCCAATGCTGG - Intergenic
1137043895 16:35638925-35638947 CCCCTCTCCTCAGGCAGGGCAGG + Intergenic
1139888292 16:70227153-70227175 GTGCTCACCTTAGCCAATGCTGG - Intergenic
1140479122 16:75253114-75253136 CTCCTCTTCTGAGGCGAGGCGGG - Intronic
1141389821 16:83655211-83655233 CTGCTATCCAAAGGCCAGGCTGG - Intronic
1141549333 16:84794831-84794853 CTGCTCTCCGTTGGAAATGCGGG + Intergenic
1143094847 17:4473289-4473311 CATCTCTCCTTGGGCAAGGAGGG - Intronic
1143747916 17:9006905-9006927 CTTCTCTTCTTAGGGAAGACAGG - Intergenic
1145843687 17:28018807-28018829 CTTTTCTCCTTAGCCATGGCTGG + Intergenic
1146564515 17:33900886-33900908 CTGCTGTCTTTAGCCAAGGCTGG - Intronic
1147949335 17:44098245-44098267 CTGCTCTGCTCATGCCAGGCTGG - Intronic
1148074632 17:44928318-44928340 ACCCTCTCCTTAGGCAGGGCAGG + Exonic
1148320719 17:46749867-46749889 CTGCTCTCCTGTGGCAATGTTGG - Exonic
1149875780 17:60231594-60231616 CTGTTCTCCTTAGCCAAGGCTGG - Intronic
1152738634 17:82009364-82009386 CTGCTCTCCCCACACAAGGCAGG - Intronic
1153825997 18:8875494-8875516 CAGCTCCCCTTAGGAAAGGCTGG - Intergenic
1156112875 18:33748544-33748566 CTGCTTTCCTCGGGTAAGGCTGG - Exonic
1158845374 18:61436776-61436798 CTGATTTGCTTAGCCAAGGCTGG - Intronic
1160072999 18:75644883-75644905 CTGGTGTCCTTATACAAGGCAGG + Intergenic
1160384806 18:78489150-78489172 TAGCTCTCCTTAGGGAGGGCAGG - Intergenic
1161198483 19:3000719-3000741 CTGCTCTCCTTCCCCAAGGACGG - Exonic
1161816599 19:6502947-6502969 CTCTCCTCCTTAGGCCAGGCTGG - Intergenic
1162050199 19:8028365-8028387 CTGCTCTCCTGGGTCAATGCAGG + Intronic
1166309677 19:41955958-41955980 CTGCTGTCCTTAGACAGGCCTGG + Intergenic
1168634890 19:57988585-57988607 CTGCTCTCTGTGGGTAAGGCAGG - Exonic
925109528 2:1322289-1322311 CTGCTCTCCAGAGGCAACCCTGG + Intronic
925187839 2:1861329-1861351 CAGCTTGCCTTAGGAAAGGCAGG + Intronic
925250713 2:2434839-2434861 GTGCTCTCCTCAGGCACTGCGGG + Intergenic
926151424 2:10427664-10427686 CTGCACTCTCCAGGCAAGGCGGG + Intergenic
926178142 2:10615830-10615852 CTGGTCTCTTTAGGCATGGTGGG - Intronic
927700687 2:25266579-25266601 CTGCTCTCCTCAGGGCAGACAGG + Intronic
930904503 2:56549850-56549872 CAGCTCTCTGTAAGCAAGGCAGG + Intergenic
931209992 2:60183653-60183675 CTTCTCTCCTTAGGTGAGACAGG - Intergenic
931232096 2:60383574-60383596 TTGTTCTCCTTAGGCCAGACAGG - Intergenic
932303750 2:70686978-70687000 CTGCTCTGCCTAGGCCAGCCAGG + Intronic
932764424 2:74460974-74460996 CTGCTGTCCTCAGGGAAGGTGGG - Intergenic
933653085 2:84864807-84864829 ATCCTCTCCTTAGGCCTGGCAGG + Intronic
934117620 2:88811809-88811831 TTGCTCCCCTCAGGCCAGGCAGG - Intergenic
934297321 2:91752967-91752989 CTGCTCTCTTTCAGGAAGGCTGG - Intergenic
934572639 2:95382493-95382515 CTCCCCTCCCTAGGCAGGGCTGG - Intronic
935401104 2:102661295-102661317 CAGCTCTCCTTAACCAAGCCCGG - Intronic
936088529 2:109486377-109486399 GTGCTCTCCCAAGGCAAGGCAGG + Intronic
937008004 2:118535689-118535711 CTTGTGTCCTTCGGCAAGGCAGG - Intergenic
938109727 2:128555732-128555754 CTGCCCTCCTTGGGCTGGGCTGG - Intergenic
940734873 2:157439483-157439505 CTGCTCGCCCTAGGGAAAGCGGG - Intronic
943670957 2:190659717-190659739 CTGCTCTCCTTTGGGGACGCGGG - Exonic
944126886 2:196304210-196304232 CTGCACTTCCTTGGCAAGGCAGG + Intronic
945169064 2:206977105-206977127 CTGCTCTGATTTGGGAAGGCTGG + Intergenic
948167304 2:235872993-235873015 CTGCCCTCCTGGGGCACGGCTGG - Intronic
948782034 2:240327763-240327785 CTGCTCGCCTTTGGCAGGCCTGG + Intergenic
1169315029 20:4583306-4583328 CTTCCATCCTTAGGCTAGGCAGG + Intergenic
1171053430 20:21883128-21883150 CTGCACTCCTTGGGCAATGGTGG + Intergenic
1171293294 20:23994777-23994799 CGGCTCTCCTTCTGCAATGCAGG - Intergenic
1173342056 20:42161612-42161634 CTGCCCTCCTCAGGCCAAGCTGG - Intronic
1173549739 20:43924287-43924309 CTGCTCTGCGTAGGAAAGGCAGG + Intronic
1177234898 21:18375832-18375854 CTGCTCTCCGTAGGCACAGGAGG - Intronic
1178157387 21:29871099-29871121 CTGCTCTCCCTGGATAAGGCTGG + Intronic
1178614479 21:34119220-34119242 CTTATGTCATTAGGCAAGGCTGG + Intronic
1178920866 21:36737344-36737366 CGGCTTTCCTGAGGCCAGGCTGG - Intronic
1180147693 21:45930437-45930459 CTGCTCTCCTGGGGCAGGGCTGG - Intronic
1180824355 22:18852492-18852514 CGGCTCTCCTTCTGCAATGCAGG - Intronic
1181188379 22:21122056-21122078 CGGCTCTCCTTCTGCAATGCAGG + Intergenic
1181210819 22:21288437-21288459 CGGCTCTCCTTCTGCAATGCAGG - Intergenic
1181464060 22:23101410-23101432 CCACTCTCCTGAGGGAAGGCTGG - Intronic
1181668717 22:24415690-24415712 CTGCCCTCCGTGGCCAAGGCAGG + Exonic
1184439608 22:44500954-44500976 CTGCACTCTTTAGGCAGGCCTGG + Intergenic
1203216128 22_KI270731v1_random:6993-7015 CGGCTCTCCTTCTGCAATGCAGG + Intergenic
949572909 3:5310764-5310786 CTGCTTTCCTTAGCAAATGCTGG + Intergenic
950261708 3:11546875-11546897 CTGCTCTCCGCTGGCAAGGGTGG - Intronic
951259502 3:20490185-20490207 CTCCTCTCTTTAAGGAAGGCAGG + Intergenic
952942788 3:38456031-38456053 CCTCCCTCCTTAGGCAGGGCAGG + Intronic
954106234 3:48411181-48411203 CTGCTGTCCCTGGGGAAGGCAGG - Intronic
954982451 3:54758780-54758802 CTTCCCACCTTAAGCAAGGCAGG - Intronic
957608845 3:82441046-82441068 CTGTTCTCCTTACCCAAGGTAGG - Intergenic
962395829 3:135014711-135014733 ATGCTCTCATCAGGCAAGGCAGG - Intronic
967621713 3:191642158-191642180 CTGCTGTCCTCAGGCTAGGCAGG + Intergenic
967888145 3:194346993-194347015 CTGCTTTCTTGAGGCCAGGCTGG - Intronic
968318310 3:197742964-197742986 TTGCCCTCCCTAGGGAAGGCAGG - Intronic
968789197 4:2647705-2647727 CTGCTCTCCTAAAGCAGGGTTGG + Intronic
974827309 4:67147990-67148012 CAGCTGTCCCCAGGCAAGGCAGG - Intergenic
978021536 4:103819536-103819558 CTGCTTTCCTTGGGAATGGCAGG + Intergenic
983216539 4:165007619-165007641 CGGCTCTCGTTAGGCAGAGCGGG - Intergenic
985171398 4:187153884-187153906 CTCCTCTCCTTAGGACAAGCTGG - Intergenic
985752124 5:1686698-1686720 CTGCTCTCCCTGGGCAGGGTCGG + Intergenic
986703280 5:10432543-10432565 CTGCTCACATTAAGTAAGGCAGG + Intronic
988126680 5:27048697-27048719 CTGACCTCCTTAGGCCAGCCTGG - Intronic
991435402 5:66593093-66593115 CTCCTCGCCTTAGGCTAGTCTGG + Intergenic
991978108 5:72202916-72202938 CTTCTTTCCCTAGACAAGGCTGG - Intronic
992066972 5:73118228-73118250 CTTCTCTCCTAAGGCTAGGTGGG + Intergenic
992124802 5:73628776-73628798 CATCTCTACTTAGGCAAAGCTGG + Intronic
993960919 5:94295967-94295989 CTGCTCTCTTTAGGGCTGGCAGG + Intronic
995676473 5:114668192-114668214 CAGCTCTCCTTAAGCCTGGCTGG + Intergenic
996542700 5:124647072-124647094 CTGCTGTCTATAGGCAGGGCTGG + Exonic
998050315 5:139026983-139027005 CTGCTCTCCTTAGGCAAGGCAGG - Exonic
998070469 5:139193930-139193952 CAGCATTCCTGAGGCAAGGCTGG + Intronic
999013660 5:148072039-148072061 CTGCTCTCCTCAGCCTAGCCTGG - Intronic
999671669 5:153964272-153964294 ATGCTCTCCTGCGGCAAGCCTGG + Intergenic
1000560595 5:162783610-162783632 CACCTCTCCTTAGGCAATGTGGG - Intergenic
1001097530 5:168787316-168787338 CTGCTATCCCAAGGCATGGCGGG - Intronic
1001248454 5:170124573-170124595 ATTCTCCCCTCAGGCAAGGCTGG + Intergenic
1003504567 6:6729144-6729166 CTGCTCTCCGTAGTCAGGGCTGG - Intergenic
1004553560 6:16673464-16673486 CTCCTCACCTTTGTCAAGGCAGG + Intronic
1007250145 6:40489865-40489887 CTGCACTCCGTAGGCATGCCCGG + Intronic
1008441330 6:51535012-51535034 CTGCTATCAGTGGGCAAGGCTGG - Intergenic
1013215178 6:108020652-108020674 CTGGTCCCCTAAGACAAGGCAGG - Intergenic
1013616929 6:111851848-111851870 CTGCTATCATTAGAGAAGGCAGG + Intronic
1014510163 6:122310746-122310768 CTGATCTCCATAGGGATGGCAGG - Intergenic
1015500817 6:133931284-133931306 CTGCTCTCCTTAGAGCTGGCAGG - Intergenic
1015624369 6:135165113-135165135 AAACTCCCCTTAGGCAAGGCAGG + Intergenic
1017644642 6:156527616-156527638 CTGCTCTCCAGTGACAAGGCGGG - Intergenic
1018269113 6:162056742-162056764 CTTCTCACCCTCGGCAAGGCTGG + Intronic
1019181012 6:170187325-170187347 CAGCTCCTCTTTGGCAAGGCTGG - Intergenic
1020687307 7:11311488-11311510 GTGCTCTCCCTAGGGAAGTCTGG - Intergenic
1020769674 7:12373432-12373454 CTGCTCTCCTTGAGCAGGGCAGG + Intronic
1023135055 7:37043112-37043134 CTGCTCTCCGCAGACAATGCCGG + Intronic
1024505757 7:50159747-50159769 GTGCTCTCTTTGGTCAAGGCCGG - Exonic
1028671556 7:93406986-93407008 CTGCTCTGCTGAGTCAAGCCTGG + Intergenic
1029241626 7:99167267-99167289 CTGCTGTGCTAAGGCAAGGCTGG - Intergenic
1033243392 7:139699573-139699595 CTGCTATCAGGAGGCAAGGCTGG + Intronic
1035605371 8:926814-926836 CTGCCCTCCTCCGGCAAGGACGG + Intergenic
1036587365 8:10136697-10136719 CAGCTGCCCTGAGGCAAGGCAGG + Intronic
1037966595 8:23138943-23138965 CAGCTGTGCTTAGGGAAGGCAGG - Intronic
1038780705 8:30566594-30566616 ATGTCCTCCTTAGGTAAGGCTGG + Intronic
1040549901 8:48429736-48429758 CTGCTTCCCTTAGGCGGGGCTGG - Intergenic
1041985290 8:63915574-63915596 CTGCTCTACTTGGCCAAGCCTGG - Intergenic
1047834001 8:128668027-128668049 CTGTTCTTCTCAGGAAAGGCGGG + Intergenic
1048986160 8:139736172-139736194 CTGCCCTCCTTCTGCAATGCTGG - Intronic
1049202403 8:141346738-141346760 CTGCACTCCATCTGCAAGGCTGG + Intergenic
1051369420 9:16345528-16345550 CTGCCCTCCTTAGGAAGGGTAGG - Intergenic
1051469679 9:17423610-17423632 CTGCGGTCCTTGGGCAAGTCTGG - Intronic
1053291624 9:36883124-36883146 CGGCTGACCTGAGGCAAGGCTGG + Intronic
1054896596 9:70320385-70320407 CTCATCTCTTTAGGCAGGGCAGG + Intronic
1055689602 9:78815567-78815589 CTGCACTCCTTGAACAAGGCTGG - Intergenic
1057350398 9:94292455-94292477 CTGGTCTCCCTGGGTAAGGCTGG + Exonic
1061041977 9:128145610-128145632 CAGCTCTCCTTGGTCACGGCAGG - Intergenic
1062107397 9:134763430-134763452 CAGCTCTCCAGAGGAAAGGCTGG - Intronic
1062699230 9:137890420-137890442 CTGCTGTCCTCAGGCAAGTGGGG + Intronic
1186307058 X:8273245-8273267 ATGCTCTCCATGGGCAAGACTGG - Intergenic
1187790723 X:22947189-22947211 CTGCTTTCCTTGGTCAAGACTGG + Intergenic
1188586376 X:31780876-31780898 GTACTCTACATAGGCAAGGCCGG + Intronic
1192748625 X:73964798-73964820 CTGCTTTCCTTCCGCAAGCCTGG - Intergenic
1192780869 X:74292842-74292864 CTACTCGCATTAGGGAAGGCTGG - Intergenic
1194206823 X:91019893-91019915 CTGCTATCCATGGGCCAGGCAGG - Intergenic
1194576301 X:95618462-95618484 CTGCTCTCTTTAGGCCCGGCAGG + Intergenic
1195275709 X:103278182-103278204 CTGCACTTTTTAGGCTAGGCGGG - Intergenic
1200552574 Y:4594682-4594704 CTGCTATCCATGGGCCAGGCAGG - Intergenic
1201400924 Y:13603021-13603043 CTTTTTTCCTTAGGCAATGCAGG + Intergenic