ID: 998051012

View in Genome Browser
Species Human (GRCh38)
Location 5:139035486-139035508
Sequence TTGCCAAGGCAGCCGGTGAC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 146
Summary {0: 1, 1: 1, 2: 17, 3: 18, 4: 109}

Found 9 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
998051012_998051020 14 Left 998051012 5:139035486-139035508 CCAGTCACCGGCTGCCTTGGCAA 0: 1
1: 1
2: 17
3: 18
4: 109
Right 998051020 5:139035523-139035545 TTTTTCGGAGACAGACCCAGGGG 0: 1
1: 16
2: 7
3: 15
4: 124
998051012_998051015 -1 Left 998051012 5:139035486-139035508 CCAGTCACCGGCTGCCTTGGCAA 0: 1
1: 1
2: 17
3: 18
4: 109
Right 998051015 5:139035508-139035530 ATGTCATCACCAACCTTTTTCGG No data
998051012_998051022 25 Left 998051012 5:139035486-139035508 CCAGTCACCGGCTGCCTTGGCAA 0: 1
1: 1
2: 17
3: 18
4: 109
Right 998051022 5:139035534-139035556 CAGACCCAGGGGGCCAATCTTGG No data
998051012_998051018 12 Left 998051012 5:139035486-139035508 CCAGTCACCGGCTGCCTTGGCAA 0: 1
1: 1
2: 17
3: 18
4: 109
Right 998051018 5:139035521-139035543 CCTTTTTCGGAGACAGACCCAGG 0: 1
1: 14
2: 8
3: 8
4: 119
998051012_998051021 15 Left 998051012 5:139035486-139035508 CCAGTCACCGGCTGCCTTGGCAA 0: 1
1: 1
2: 17
3: 18
4: 109
Right 998051021 5:139035524-139035546 TTTTCGGAGACAGACCCAGGGGG 0: 1
1: 14
2: 5
3: 23
4: 753
998051012_998051023 26 Left 998051012 5:139035486-139035508 CCAGTCACCGGCTGCCTTGGCAA 0: 1
1: 1
2: 17
3: 18
4: 109
Right 998051023 5:139035535-139035557 AGACCCAGGGGGCCAATCTTGGG 0: 1
1: 15
2: 10
3: 14
4: 100
998051012_998051019 13 Left 998051012 5:139035486-139035508 CCAGTCACCGGCTGCCTTGGCAA 0: 1
1: 1
2: 17
3: 18
4: 109
Right 998051019 5:139035522-139035544 CTTTTTCGGAGACAGACCCAGGG 0: 1
1: 14
2: 6
3: 11
4: 100
998051012_998051024 27 Left 998051012 5:139035486-139035508 CCAGTCACCGGCTGCCTTGGCAA 0: 1
1: 1
2: 17
3: 18
4: 109
Right 998051024 5:139035536-139035558 GACCCAGGGGGCCAATCTTGGGG 0: 1
1: 15
2: 6
3: 20
4: 139
998051012_998051025 28 Left 998051012 5:139035486-139035508 CCAGTCACCGGCTGCCTTGGCAA 0: 1
1: 1
2: 17
3: 18
4: 109
Right 998051025 5:139035537-139035559 ACCCAGGGGGCCAATCTTGGGGG 0: 1
1: 15
2: 4
3: 17
4: 164

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
998051012 Original CRISPR TTGCCAAGGCAGCCGGTGAC TGG (reversed) Intronic
900224947 1:1528625-1528647 TTCCCGAGGCAGCCGGTGTGTGG - Intronic
900493814 1:2967095-2967117 CTGCCTTGGCAGCCGGTGCCTGG + Intergenic
902342461 1:15792928-15792950 TTGCCAAGGCAACGGGTTACCGG + Intergenic
903322910 1:22553315-22553337 TTTCCTAGGCTGCTGGTGACAGG - Intergenic
903948601 1:26980301-26980323 TTGCCAAGGCAACGGGTGACTGG + Intergenic
904214145 1:28906153-28906175 TTTCCAAGACTTCCGGTGACTGG - Intronic
906196978 1:43935702-43935724 TGGCCTAGGCAGCAGGTGAGTGG + Exonic
906794198 1:48683808-48683830 TTGACAAGTCAGCTGTTGACTGG - Intronic
915274686 1:154780042-154780064 TTGTCAAGGCAGCCTGTCCCAGG - Intronic
918043748 1:180928559-180928581 TACCCAGGGCAGCCGGTGAGTGG + Exonic
919745880 1:201008941-201008963 TTGCCAATGCAGACGGGGGCCGG - Exonic
920059191 1:203215952-203215974 TTGGGAAGGCAGCTGGGGACTGG - Intronic
1064038213 10:11934065-11934087 GTGCCAAGAAAGCCGGTGATGGG + Intronic
1068574535 10:58670449-58670471 TTGCCATGGCAGATGGGGACAGG - Intronic
1069384816 10:67874556-67874578 TTGCCAAGGCAACGGGTGACTGG + Intergenic
1069706621 10:70462745-70462767 TTGCCATGGCAGCAGGTGACTGG + Intergenic
1072652942 10:97309800-97309822 TTGCCAAGGCAACAGGTGACTGG - Intergenic
1072871405 10:99124567-99124589 GGGCCAAGGCAGCAGGGGACTGG + Intronic
1074786806 10:116849082-116849104 TTGCTAAGGCCGCCCGTGCCAGG - Intergenic
1076638946 10:131901133-131901155 CTGCCATGGCAGCCGGCGGCGGG - Exonic
1077328067 11:1972192-1972214 TTTCCAGGGCATCCGGGGACGGG - Intronic
1080262829 11:30368285-30368307 TTGCCAAGGCAATCGGTGACTGG + Intergenic
1080704057 11:34671880-34671902 TTGTGAAGGTAGCTGGTGACGGG + Intergenic
1080842448 11:35997520-35997542 CTGCCAAGGCAACCGGTGACTGG - Intronic
1081789415 11:45772191-45772213 TTGCCCTGGCGGCTGGTGACAGG - Exonic
1082086851 11:48057512-48057534 TACCCAAGGCTGCCCGTGACTGG - Intronic
1082687768 11:56260662-56260684 ATGCCAAGGCAGCAGGGGGCTGG + Intergenic
1083718862 11:64594094-64594116 ATGCCAAGGCAGGCAGGGACAGG - Intronic
1084529009 11:69715785-69715807 TTTCCGAGGCAGCCGGTCCCTGG + Intergenic
1084888894 11:72226912-72226934 TTGCCAAGGGAGGCTGTGAATGG + Intronic
1087131333 11:94671816-94671838 GGGCCAAGGCAGCAGGGGACTGG - Intergenic
1089762519 11:120738754-120738776 TTGCCAAGGCAGGTGGTGATGGG - Intronic
1090863118 11:130672253-130672275 ATGGCAAGGCAGCCAGTGCCCGG - Intergenic
1091097782 11:132840348-132840370 TTCCCAGGGCAGCAGCTGACGGG + Intronic
1202811046 11_KI270721v1_random:27372-27394 TTTCCAGGGCATCCGGGGACGGG - Intergenic
1103434863 12:120916878-120916900 TTGCCAAGGCAACAGGTGACTGG + Intergenic
1105809320 13:23980292-23980314 TTGCCATGGCAGCGGGGGAGGGG + Intronic
1109233923 13:59792537-59792559 TGGCCAAGGAAGTCGGTGATGGG - Intronic
1115115000 14:29869886-29869908 TTGCCATGGCAGGGGGTGACTGG + Intronic
1115579072 14:34740675-34740697 TTGCCAAGGCAACGGGTGACTGG - Intergenic
1118682974 14:68262351-68262373 CTCCCAAGGTAGCAGGTGACAGG - Intronic
1118824884 14:69371132-69371154 TTGCCTGAGCAGCTGGTGACTGG + Intergenic
1129006664 15:72379552-72379574 TTGCCAAGGCAACGGGTGACTGG - Intergenic
1132814829 16:1820734-1820756 GTGCCAAGGCAGGCGGTTTCTGG - Intronic
1134862793 16:17575547-17575569 TTTACAAGGAAGCCGGTGCCAGG + Intergenic
1136607333 16:31345156-31345178 TTGCCATGGCAGCAAGTGAGAGG - Intergenic
1137592482 16:49702307-49702329 AGGCCAAGGCAGCCAGGGACGGG + Intronic
1137921186 16:52490098-52490120 ATGCCAAGGTAGGAGGTGACTGG + Intronic
1138697244 16:58826026-58826048 TTGCGAAGGCAACTGGTGACTGG + Intergenic
1141895784 16:86957874-86957896 TTATCAGGGCAGCCGGTGAGGGG - Intergenic
1142077876 16:88130956-88130978 GTGCCCGGGCAGCCGGGGACGGG + Intergenic
1149896726 17:60434063-60434085 TTGCCAAGGCAACGGGTGACTGG - Intergenic
1151200676 17:72465657-72465679 TTCCCAAGGGAGCCAGTGCCTGG - Intergenic
1152165816 17:78704900-78704922 TTCCTAAGGCAGCTGTTGACAGG - Intronic
1152288921 17:79427906-79427928 TTTCCAAAGCAGCTGTTGACTGG + Intronic
1152541159 17:80976589-80976611 TTGCCAAGGCAACCGGTGACTGG + Intergenic
1153420832 18:4903018-4903040 TAGCCAAGGCAGCAGGTCCCTGG - Intergenic
1159339803 18:67119853-67119875 TTTCCAATGCAGCCGCTGCCAGG + Intergenic
1160083634 18:75754021-75754043 GGGCCAAGGCAGCAGGGGACTGG + Intergenic
1160116687 18:76085225-76085247 GTGCCAAGGCAGCAGGGGGCTGG + Intergenic
1160264093 18:77323801-77323823 TTGCCAAGGGAGCACGTGCCAGG + Intergenic
1160519522 18:79496469-79496491 TTGCCAGGGCAGCCAGGGCCGGG + Intronic
1161136966 19:2625631-2625653 TTGCCAGGGAAGCCAGTGAAGGG + Intronic
1161612928 19:5253390-5253412 TTGCCAGAGCAGCCAGTCACAGG - Intronic
1164309744 19:24035201-24035223 TTGCCTAGGCAGGCGGGCACTGG + Intronic
1165764341 19:38341322-38341344 TTGCCCAGGCAGGAGATGACGGG + Intronic
1166919503 19:46219559-46219581 TTGACAAGGCAATAGGTGACTGG + Intergenic
926416847 2:12657763-12657785 TTTTCAAGGCAACCAGTGACTGG - Intergenic
927633474 2:24793868-24793890 TTGTCTAGGCAACCGGTGATAGG - Exonic
929711426 2:44270757-44270779 TTGCCAAGGTAACGGGTGACTGG + Intergenic
933654255 2:84874745-84874767 TTGCCAAGCCAACCAGTGACTGG + Intronic
934300717 2:91774607-91774629 TGGCTATGGCAGCAGGTGACAGG - Intergenic
935500976 2:103838110-103838132 GTGGTAAGGAAGCCGGTGACAGG + Intergenic
937409256 2:121658815-121658837 TTGCCAAGACAACGGGTGACTGG - Intergenic
938754630 2:134368398-134368420 TTGCCAAGGCAGGCGAGGGCTGG - Intronic
938961362 2:136344572-136344594 TTGGCAAGTCAGCTGGTGGCTGG - Intergenic
941130996 2:161650744-161650766 TGGCCAAGGCAGCAGGGGGCTGG - Intronic
944796479 2:203190916-203190938 TTGCCAAGGCAACGGGTGACTGG + Intronic
945283254 2:208057587-208057609 TTGCCAAGGCAATGGGTGACTGG - Intergenic
947821286 2:233072891-233072913 ATGGCAAGGCAGCCAGTGGCTGG + Intronic
949005409 2:241644006-241644028 TTGCTGAGGCAGCTGGTGTCAGG + Intronic
949041277 2:241851042-241851064 TGGCCAAGGAAGCCGGTCAGAGG + Exonic
1168831414 20:847086-847108 CAGCCAAGGCAGCCTGTGAAAGG - Intronic
1170829013 20:19823785-19823807 TTGCCAAGGCAATGGGTGACTGG - Intergenic
1173272206 20:41547558-41547580 TTGCCAAGGCAACTAGTGACTGG + Intronic
1174544452 20:51314886-51314908 TTGCCACTGCAGCAGATGACAGG + Intergenic
1178087601 21:29128026-29128048 TTGCCAAGGCAGTCAGTGACTGG - Intronic
1180113592 21:45679956-45679978 TTGCAAAGGCAACTGGTGAGAGG - Intronic
1180816445 22:18792530-18792552 TGGCTACGGCAGCAGGTGACAGG + Intergenic
1181202632 22:21226862-21226884 TGGCTACGGCAGCAGGTGACAGG + Intronic
1181699071 22:24609743-24609765 TGGCTATGGCAGCAGGTGACAGG - Intronic
1182739708 22:32558787-32558809 TAGCCAAGGCAGACTGTGCCAGG + Intronic
1183444506 22:37844221-37844243 TTGCCATGGCAGCCGCCGCCGGG - Exonic
1185221789 22:49632720-49632742 CAGCCAAGGGAGCCGGTGTCGGG + Intronic
1203224281 22_KI270731v1_random:68551-68573 TGGCTACGGCAGCAGGTGACAGG - Intergenic
1203266545 22_KI270734v1_random:18241-18263 TGGCTACGGCAGCAGGTGACAGG + Intergenic
951415695 3:22418965-22418987 TTAACAAGGCAGCCGCTGAGAGG + Intergenic
951445199 3:22771244-22771266 TTGCCAAAGCAGCAGGTAGCAGG - Intergenic
953667702 3:44937813-44937835 TTGCCAAAGCAATTGGTGACTGG + Intronic
957724113 3:84042491-84042513 TAGCCAAGGCTGTCTGTGACTGG + Intergenic
967132741 3:186487678-186487700 ATGCCAAGGCAGCAGGTCATTGG + Intergenic
968944235 4:3655208-3655230 GTGCCACGGCAGCCGGTGCCTGG + Intergenic
976192490 4:82501464-82501486 TTGCCAAAGCAGGAGGTGTCCGG - Intronic
978848369 4:113302990-113303012 TTGCCATGGCAGCGGGGGCCGGG + Intronic
979381179 4:120008638-120008660 TTGCCAAGACAACCTGTGAATGG - Intergenic
982639481 4:157939778-157939800 TTGGGAAGGCAGCCTGGGACAGG + Intergenic
990846238 5:60142844-60142866 TTACCAAGGCAGGAGGTAACAGG + Intronic
997110318 5:131067169-131067191 TTTCCAAGCCAGCCTGTGTCTGG - Intergenic
998051012 5:139035486-139035508 TTGCCAAGGCAGCCGGTGACTGG - Intronic
998228023 5:140341861-140341883 TTGCCAAGGCAGCCGTTTGCTGG + Intronic
1001739497 5:174040081-174040103 TTGCCAAGAAAGCTAGTGACTGG - Intergenic
1002188421 5:177466740-177466762 TTGCCAAGGCTCCCGGTCTCTGG - Intronic
1003067748 6:2918039-2918061 TTGGCAGGGCAGCCGGTTTCAGG + Intergenic
1004271261 6:14197839-14197861 TTGCCAAGGCACATGGTGCCTGG + Intergenic
1004489552 6:16101198-16101220 TTGCCAAGGCAATGGGTGAAAGG - Intergenic
1006191237 6:32210832-32210854 ATTCCAAGGCAGCCTGTGCCAGG - Exonic
1006332252 6:33400398-33400420 TTGCCAAGGCAACGGGTGACTGG - Intronic
1006787758 6:36679594-36679616 TTCCCAAGGAAGCCGGGCACTGG + Intronic
1006849992 6:37091448-37091470 TTGCCAAGGCAACGGGTGACTGG + Intergenic
1007510981 6:42374205-42374227 ATGCCCAGGCAGCCGGGGGCGGG + Intronic
1013306248 6:108849038-108849060 TTGTCTAGGCAGGCGGTGACCGG + Intronic
1019913023 7:4113043-4113065 AGGCCAAGGCAGGCGGTGGCGGG - Intronic
1022026712 7:26454632-26454654 TTGCCAAGGCAGCAGCCCACAGG - Intergenic
1022284969 7:28948361-28948383 TTGCCAAGGAAAAGGGTGACCGG - Intergenic
1024673867 7:51620842-51620864 TTTCCAAGGAAGCTGGTGACTGG - Intergenic
1025105076 7:56163881-56163903 TTCCCAAGGCAGCAGGGGAAAGG + Intergenic
1030228093 7:107175014-107175036 TTGCAAAGGAAGCTGGAGACGGG + Intronic
1032079007 7:128849385-128849407 ATGCCAAGGCAGCCGGTGAGGGG + Exonic
1033218467 7:139511516-139511538 TTGCCAAGGGAGCCGGGGAAGGG + Intergenic
1034873691 7:154706192-154706214 GGGCCAAGGCAGGCGGTGAGAGG - Intronic
1035110207 7:156475556-156475578 TCCCCAAGGCAGCTGGTCACTGG + Intergenic
1035705413 8:1670944-1670966 TTGCCAGGGCAGGAGGTGACAGG + Intronic
1038218005 8:25580596-25580618 TTGCCAAGGGACCCGGTGTTAGG - Intergenic
1038305020 8:26392518-26392540 TTGCCAAGGCAGCGGGGGACTGG + Intronic
1039496305 8:37983196-37983218 TTGCCAAGGCAATCAGTGACTGG + Intergenic
1048553079 8:135452074-135452096 TTACCAAGTCAGGCAGTGACGGG + Intergenic
1050260805 9:3838850-3838872 TTTCCAAGGCAGCAGGTCAAGGG - Intronic
1059758193 9:117313322-117313344 GTTCCAAGGCAGCCAGAGACAGG + Intronic
1060924927 9:127449661-127449683 TTGCCAAGGCAACGGGTGACTGG - Exonic
1061925688 9:133805076-133805098 CTGTCCAGGCAGCCGGGGACAGG - Intronic
1062021574 9:134322027-134322049 CAGCCAAAGCAGCCGGTGCCAGG - Intronic
1185468987 X:371402-371424 TTGTCAAGGATGCCGGTGACAGG + Intronic
1187190267 X:17027969-17027991 TGGCCAAGCCTGCCTGTGACTGG - Intronic
1192156790 X:68752890-68752912 TTGCCAGGCCAGCAGGTGAGAGG + Intergenic
1196628228 X:117903528-117903550 TTGAAAAGGCATCCAGTGACTGG - Intronic
1197591769 X:128418600-128418622 TTGCCAAGTCAGCAGGTATCAGG - Intergenic