ID: 998055043

View in Genome Browser
Species Human (GRCh38)
Location 5:139067531-139067553
Sequence CAATATTACTAGAGACCAGC TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 111
Summary {0: 1, 1: 0, 2: 0, 3: 8, 4: 102}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
998055038_998055043 28 Left 998055038 5:139067480-139067502 CCTAGTTCATCAAGCAGAAGTGG 0: 1
1: 0
2: 0
3: 18
4: 172
Right 998055043 5:139067531-139067553 CAATATTACTAGAGACCAGCTGG 0: 1
1: 0
2: 0
3: 8
4: 102

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
998055043 Original CRISPR CAATATTACTAGAGACCAGC TGG Intronic
911992149 1:104712339-104712361 CAAGATTTCTAGGGATCAGCTGG - Intergenic
915274880 1:154781613-154781635 CCTTACAACTAGAGACCAGCTGG - Intronic
918908720 1:190535531-190535553 GAATATTACTAGAGTCCAAGAGG + Intergenic
924695148 1:246391658-246391680 ACATATTACTAGAGACAAGGAGG + Intronic
1064033407 10:11897495-11897517 CAAGATTACAAGTGACCAGCCGG + Intergenic
1064766323 10:18677206-18677228 CAATCTTACTAGATACAAGAAGG - Exonic
1064952624 10:20871024-20871046 CAATATCCCCAGGGACCAGCTGG + Intronic
1066073900 10:31852545-31852567 CAATATTACTACAGTGCAGACGG - Exonic
1072905422 10:99448832-99448854 CAAGATTAGGAGGGACCAGCAGG - Intergenic
1073499661 10:103924611-103924633 AAATATTACTAGAGACAAAGAGG - Intergenic
1073785217 10:106881672-106881694 TAATGTCACTAGAGACCAACGGG + Intronic
1076063731 10:127432104-127432126 CAATTTTTCCACAGACCAGCAGG - Intronic
1081392088 11:42541017-42541039 AATTATTAAAAGAGACCAGCTGG - Intergenic
1084236201 11:67789301-67789323 TAATATTTCTAAAGACTAGCTGG - Intergenic
1092741665 12:11636408-11636430 CAATTTTTCTACAGACCAGGAGG - Intergenic
1093562613 12:20560341-20560363 TGATCTTACTAGAGACCAGGTGG + Intronic
1093604797 12:21076923-21076945 CCATATAACCAGAGCCCAGCTGG - Intronic
1094505255 12:31055814-31055836 CAACATTTCTGGAGACCACCAGG + Intergenic
1095086007 12:38057902-38057924 CATTTTTAGTAGAGACAAGCAGG - Intergenic
1095389729 12:41691231-41691253 CAATATTTATAGAAACCACCAGG - Intergenic
1096929170 12:55185606-55185628 CAATTATACTTGAGACCAGCGGG - Intergenic
1097362496 12:58673185-58673207 TATAATTGCTAGAGACCAGCTGG + Intronic
1097819004 12:64108402-64108424 CAATATTAGGAGAGCCCACCAGG - Intronic
1101274474 12:103184304-103184326 GAAAATTACTAGAGACCAAGTGG - Intergenic
1101275169 12:103191649-103191671 GAGGATTACTAGAGACCAGGAGG + Intergenic
1110789417 13:79570573-79570595 GAATGTTACTAGAGAGAAGCAGG + Intergenic
1113123355 13:106948589-106948611 TAATATTACAACAGCCCAGCTGG - Intergenic
1118335450 14:64849974-64849996 GATTATTACTATAGACCAGGAGG + Intronic
1121684186 14:95820178-95820200 CAATATCACTAGAGACCATGTGG + Intergenic
1122224315 14:100264813-100264835 AGAAATTACAAGAGACCAGCTGG + Intronic
1124089045 15:26580331-26580353 CAACATTCCTCGAGACCAGACGG + Exonic
1124635840 15:31364852-31364874 TAACATTTCTAGAGACGAGCAGG + Intronic
1127675102 15:61230576-61230598 TAATATTATTAGAGGCCAGAAGG + Intergenic
1127701957 15:61509837-61509859 CAATCTTTTTAAAGACCAGCAGG + Intergenic
1127912988 15:63433795-63433817 CAATATTTCCAGAGAGCTGCAGG + Intergenic
1128190691 15:65692759-65692781 AAATATTACTAAAGACCTGGAGG + Intronic
1130654786 15:85784949-85784971 CATTATGACTAGAGGCCAGGTGG - Intronic
1135484093 16:22848694-22848716 CACTTTTCCAAGAGACCAGCAGG - Intronic
1148350711 17:46940134-46940156 CAACATGACTACAGAGCAGCGGG - Intronic
1149076978 17:52607416-52607438 CAATTTTACTAGAAAAGAGCAGG - Intergenic
1149603030 17:57905196-57905218 CGGTACCACTAGAGACCAGCAGG + Intronic
1150031866 17:61746816-61746838 GAACAATACTAGAGACCAGATGG + Intronic
1150794155 17:68224627-68224649 GAAGATTACTTGAGCCCAGCAGG - Intergenic
1156356353 18:36344915-36344937 AAATATTACTAGAGAGAAGGAGG + Intronic
1156594952 18:38538151-38538173 CATTATTAATAGAGACCACATGG - Intergenic
1157780291 18:50432393-50432415 CAATTTTTCTACAGACCAGGAGG - Intergenic
1162600814 19:11667178-11667200 CAAGATTACCAAGGACCAGCGGG - Intergenic
925862077 2:8188689-8188711 CAATTTTTCTACAGACCAGGAGG + Intergenic
926836321 2:17026219-17026241 CAACAAGACAAGAGACCAGCAGG - Intergenic
926894873 2:17674771-17674793 AAATATTACTAGAGGCCAAAAGG - Intronic
929983526 2:46702518-46702540 CTAGAGTACTAGAGACCTGCTGG + Intronic
930528794 2:52565161-52565183 GAATATTCTTAAAGACCAGCAGG - Intergenic
937626962 2:124054750-124054772 CAATTTTACTAACGAACAGCAGG - Intronic
938557970 2:132443297-132443319 CAATATTACTAAAGTACAGATGG + Intronic
938805017 2:134798026-134798048 CAATTTAAGTAGAAACCAGCAGG - Intergenic
939436701 2:142186087-142186109 CAAGAGTGCCAGAGACCAGCAGG + Intergenic
940686922 2:156863202-156863224 CTATATTACAAGTGACCTGCTGG - Intergenic
944748907 2:202687497-202687519 GAATATTGCTTGAGCCCAGCAGG - Intronic
946303255 2:218838961-218838983 GAGTATTACTAGGGACCAGCAGG - Intergenic
947690702 2:232133264-232133286 CAGTACCAGTAGAGACCAGCGGG + Intronic
1170856238 20:20058191-20058213 CAATTTTACTAGAGGGCAGTAGG + Intronic
1171195214 20:23191781-23191803 CAATATAACCAGTGACCATCAGG + Intergenic
1172886979 20:38237857-38237879 CAAGATCACTAGAGAAGAGCAGG + Intronic
1173096547 20:40035620-40035642 CAATATTACTAGTAATCATCAGG + Intergenic
1173400549 20:42722260-42722282 AAATCTTGCTGGAGACCAGCAGG - Intronic
1177917773 21:27111988-27112010 CAATAATACTAGTGAATAGCAGG - Intergenic
1182144556 22:27989389-27989411 CAATAATACTAGAGTCTAGCAGG + Intronic
1184831027 22:46987323-46987345 CAAGATTACTAGATACAAGTAGG - Intronic
949229481 3:1733878-1733900 CTTTATTTCTAGAGTCCAGCAGG + Intergenic
949582032 3:5398179-5398201 CTAAATACCTAGAGACCAGCAGG + Intergenic
951779211 3:26344444-26344466 AAACATTACAAGAGATCAGCAGG - Intergenic
958535818 3:95401578-95401600 CAGTATTACTACAGACGACCAGG + Intergenic
958583728 3:96059679-96059701 CAAACTTACCAGAGACCAGTAGG + Intergenic
959341092 3:105132606-105132628 CAATATTATTTGAAATCAGCAGG + Intergenic
961347377 3:126272931-126272953 GAATATCACTTGAGACCAGGAGG - Intergenic
965636305 3:170784701-170784723 GAATGTTACTAAAGACCATCTGG + Intronic
966646649 3:182253029-182253051 TAAAATTACTAGAGAACAGAGGG - Intergenic
970300705 4:14678878-14678900 CAAGATTATTAGAGTCCAACAGG - Intergenic
972872754 4:43320533-43320555 CAATGTTACCAGAGCTCAGCAGG - Intergenic
975924262 4:79430061-79430083 AAATATTACTTTAGAGCAGCAGG - Intergenic
978434731 4:108671736-108671758 CAACACTACTGTAGACCAGCGGG + Intergenic
987017898 5:13838744-13838766 CAATTTTTCTACAGACCAGGGGG - Intronic
992070553 5:73144752-73144774 CAAAAATACTAGAGACCAGGTGG - Intergenic
993506888 5:88720050-88720072 CAATATCAGTAGATACCAGTGGG - Exonic
994357779 5:98813427-98813449 GAATATTGCTTGAGACCAGGAGG + Intergenic
996630640 5:125627590-125627612 AAATATTACTAGAGACAAAGAGG + Intergenic
996878461 5:128266178-128266200 CAATTTTATTAGAGACAAGCTGG + Intronic
998055043 5:139067531-139067553 CAATATTACTAGAGACCAGCTGG + Intronic
1000520946 5:162293851-162293873 GAATATCACTTGAAACCAGCAGG - Intergenic
1001397089 5:171425192-171425214 CAATATTCATAGTGACCACCAGG + Intronic
1013711893 6:112910643-112910665 CAATATGAATACAGACCAGAAGG + Intergenic
1016391845 6:143582366-143582388 CTAAATTACCAGAGACAAGCAGG + Intronic
1016640380 6:146341517-146341539 CAAAATAACTAGAAACCATCAGG + Intronic
1017590278 6:155972058-155972080 CAATATAAGTAGAGACCTGAAGG + Intergenic
1020250758 7:6466525-6466547 CAATTTTTCCACAGACCAGCAGG + Intronic
1020705415 7:11537895-11537917 CAGCATTACTAGAAGCCAGCCGG + Intronic
1033008216 7:137590459-137590481 CAATATTACTAGAAACCAAAGGG + Intronic
1037009836 8:13827594-13827616 ATATATTACTAGAGACAAACAGG - Intergenic
1039147836 8:34469075-34469097 CACTATTATCAGAAACCAGCAGG - Intergenic
1040446309 8:47498531-47498553 CAATCTTCCTAGAGACTATCTGG - Intronic
1040634100 8:49252420-49252442 CAATATTCCCAGAACCCAGCTGG - Intergenic
1046008882 8:108521419-108521441 GAATAATACTATAGACCAACTGG - Intergenic
1046793633 8:118347390-118347412 CAAGTTTTCTAGACACCAGCAGG + Intronic
1050077172 9:1877342-1877364 CAATATTACTGGTGATCACCTGG - Intergenic
1052127608 9:24797198-24797220 CCATATTACTTGAGAACAGAAGG + Intergenic
1058269202 9:102948633-102948655 CAATATTTCTGAAAACCAGCAGG + Intergenic
1058586886 9:106517357-106517379 AAACATTACTAGAGACGAACAGG + Intergenic
1187593730 X:20747307-20747329 CACTAAAACCAGAGACCAGCTGG - Intergenic
1188647119 X:32583197-32583219 CAATATTACCAGATACAGGCTGG + Intronic
1189669994 X:43398173-43398195 AAATATTACTAGAGATAAACAGG + Intergenic
1195401398 X:104464994-104465016 GAATATTGCTAGAAACCATCAGG - Intergenic