ID: 998055057

View in Genome Browser
Species Human (GRCh38)
Location 5:139067717-139067739
Sequence TTAGGATGCCGGTTGCTGCA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 73
Summary {0: 1, 1: 0, 2: 0, 3: 1, 4: 71}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
998055057_998055065 23 Left 998055057 5:139067717-139067739 CCTTGCAGCAACCGGCATCCTAA 0: 1
1: 0
2: 0
3: 1
4: 71
Right 998055065 5:139067763-139067785 GTGCAAGGCTTTTGGGCATCTGG 0: 1
1: 0
2: 0
3: 12
4: 117
998055057_998055062 8 Left 998055057 5:139067717-139067739 CCTTGCAGCAACCGGCATCCTAA 0: 1
1: 0
2: 0
3: 1
4: 71
Right 998055062 5:139067748-139067770 GGTAAGGATAAATTAGTGCAAGG 0: 1
1: 0
2: 0
3: 17
4: 114
998055057_998055060 -8 Left 998055057 5:139067717-139067739 CCTTGCAGCAACCGGCATCCTAA 0: 1
1: 0
2: 0
3: 1
4: 71
Right 998055060 5:139067732-139067754 CATCCTAATAACTGTAGGTAAGG No data
998055057_998055063 15 Left 998055057 5:139067717-139067739 CCTTGCAGCAACCGGCATCCTAA 0: 1
1: 0
2: 0
3: 1
4: 71
Right 998055063 5:139067755-139067777 ATAAATTAGTGCAAGGCTTTTGG 0: 1
1: 0
2: 0
3: 14
4: 275
998055057_998055064 16 Left 998055057 5:139067717-139067739 CCTTGCAGCAACCGGCATCCTAA 0: 1
1: 0
2: 0
3: 1
4: 71
Right 998055064 5:139067756-139067778 TAAATTAGTGCAAGGCTTTTGGG 0: 1
1: 0
2: 0
3: 12
4: 209

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
998055057 Original CRISPR TTAGGATGCCGGTTGCTGCA AGG (reversed) Intronic
904309176 1:29614853-29614875 TGAGGATGCCCGTTGCTGGCAGG - Intergenic
905609023 1:39332427-39332449 TTAGGGTGGCTCTTGCTGCACGG - Intronic
906947395 1:50306580-50306602 TTAGGATGCCCATCTCTGCATGG - Intergenic
916056298 1:161070874-161070896 TTAGGATGCCTGTAGCTGGGAGG - Intergenic
917570768 1:176263071-176263093 TTAGGGTGCAGGGTGCTTCATGG + Intergenic
918123782 1:181564084-181564106 TTAGGGTGCTGGTTGCTAAAGGG + Intronic
918757483 1:188356365-188356387 TGAGGATGCTGGCTGCAGCACGG - Intergenic
919685386 1:200479360-200479382 TTAGGCTCTCGGTTCCTGCAAGG + Intergenic
923741268 1:236657223-236657245 TTAGGATGCCAGTCGCAGTAAGG - Intergenic
1064229845 10:13520385-13520407 TTAGGAAGCCGGTTGGCTCAAGG + Intronic
1067186560 10:44033544-44033566 TTAGGGTGGTGGTTGCTGAAGGG + Intergenic
1070922260 10:80195389-80195411 TTAGGATGCCAGCTGCAGAAGGG - Intronic
1076512929 10:131025220-131025242 TTAGGAAGCTGGGTCCTGCAGGG - Intergenic
1076778639 10:132711661-132711683 TGAGGATGCCAGCTGCTGGAAGG - Intronic
1077520515 11:3030579-3030601 TTAGGATGTCGGTTCTTGCTGGG - Intronic
1078475068 11:11622544-11622566 TCAGGAGGCCGGTGGCTGAAGGG - Intergenic
1078919465 11:15815852-15815874 TTAAGATGCAGGTTGTTCCAGGG - Intergenic
1080014638 11:27491573-27491595 TTAGGTTGTCAGTTACTGCATGG - Intergenic
1080485585 11:32704030-32704052 TGAGGATGCCAGCTGCAGCAAGG + Intronic
1081237043 11:40658888-40658910 TGGGGATGCCGGCTGCAGCAGGG + Intronic
1087546068 11:99584898-99584920 TGAGTAGGCCTGTTGCTGCAAGG + Intronic
1091782625 12:3223480-3223502 TTTCTATGCCGTTTGCTGCAAGG + Intronic
1098790437 12:74816368-74816390 TGAAGATGCCAGTTGCAGCAGGG + Intergenic
1100433521 12:94551516-94551538 TTGGGAGGCAGGTGGCTGCAGGG - Intergenic
1101149449 12:101871105-101871127 TTAGGGTGGTGGTTGCTGAAGGG - Intergenic
1103624549 12:122207958-122207980 TTGGGATGCCAGTTGTGGCAGGG - Exonic
1105301802 13:19141989-19142011 TTAGAATGCCAGCTGCAGCAGGG + Intergenic
1113751960 13:112782771-112782793 CCAGGATGACGGTTACTGCATGG + Intronic
1114767919 14:25395436-25395458 TGAGGTTTCCTGTTGCTGCAAGG + Intergenic
1119141068 14:72267684-72267706 TTAGGAAGCCATTTGCTCCATGG - Intronic
1120592190 14:86389978-86390000 TGAGGATGCCAGCTGCAGCAGGG + Intergenic
1121461590 14:94083567-94083589 TTAGGGTGGTGGTTGCTGAAAGG - Intronic
1125537037 15:40447103-40447125 TTAGGGTGCCGCTTGATGCCAGG + Intronic
1125612351 15:40980122-40980144 TCAGGATGCAAGATGCTGCACGG + Exonic
1138582716 16:57952097-57952119 TTGGGATGCCAGTTCCTGCCTGG + Intronic
1203089233 16_KI270728v1_random:1202326-1202348 CCAGGATCCCGGATGCTGCAGGG - Intergenic
1142856194 17:2731635-2731657 TGAGGAGGCCGGTTGTTGCTTGG + Intergenic
1145737857 17:27245599-27245621 TTAGGATGTTGGTTGTTGCCTGG + Intergenic
1151544869 17:74786575-74786597 CTAGGATGCCGGCTGAAGCAGGG + Intronic
1165016293 19:32882653-32882675 TTAGGTTACCAGTTGATGCAGGG - Intronic
1167901385 19:52624750-52624772 TTAGGGTGGTGGTAGCTGCACGG - Intronic
926700402 2:15799748-15799770 TTGGGAACCAGGTTGCTGCAAGG - Intergenic
929045499 2:37785087-37785109 TTGGGATGCAGGTTGCTGTGTGG - Intergenic
935327127 2:101947396-101947418 TTAGGATGCTGGGAGCTGCCAGG - Intergenic
943345786 2:186735147-186735169 TGAGGATGCCAGCTGCAGCAGGG - Intronic
945103164 2:206282356-206282378 CCAGGAGGCCGGTGGCTGCATGG + Intronic
1172448691 20:35006710-35006732 TGAGGATGCTGGTGGCTCCAAGG + Intronic
1181515949 22:23413233-23413255 TGAGGATGGCGGTTGCTGAAGGG - Intergenic
953068816 3:39499611-39499633 TTAGAATGCCTGTTTCTTCATGG + Intronic
953477706 3:43219875-43219897 GTTGGTTGCCGCTTGCTGCACGG - Intergenic
958121473 3:89295358-89295380 TCAGGATGGTGGTTGCTGAAGGG + Intronic
968563665 4:1298024-1298046 TGAGGAACCCGGTTGCTGCCTGG + Intronic
969634347 4:8357892-8357914 TTTGGGTCCCGGTGGCTGCAAGG - Intergenic
995339408 5:111040704-111040726 TTAGGGTGGTGGTTGCTGAAAGG + Intergenic
998055057 5:139067717-139067739 TTAGGATGCCGGTTGCTGCAAGG - Intronic
1000922092 5:167150224-167150246 TTATGATGATGGTTGCTGAAAGG - Intergenic
1002776746 6:334427-334449 TTAGCATGCCTGTTGTAGCATGG + Intronic
1019716253 7:2540818-2540840 TCACGATGCAGGTGGCTGCATGG - Intronic
1021279118 7:18695021-18695043 TTAGTCTGAAGGTTGCTGCATGG + Intronic
1022108505 7:27213638-27213660 TTCGGGTCCCGGGTGCTGCAGGG + Intergenic
1022227991 7:28383142-28383164 TGAGCATGCCAGTGGCTGCAAGG + Intronic
1038627778 8:29210859-29210881 TTAGCATGTCAGTTGCTGAAGGG - Intronic
1044935415 8:97289169-97289191 TTAGGATGATGTTTGCTGAACGG + Intergenic
1046103340 8:109639863-109639885 TTAGGAGGCCGGTTGGTGGGTGG - Intronic
1047318480 8:123755630-123755652 TGAGGATGCCAGCTGCAGCAGGG - Intergenic
1048840146 8:138558488-138558510 TTAGCATGCAGGGTTCTGCAGGG + Intergenic
1050808758 9:9718371-9718393 TGAGGATGCCAGCTGCAGCAGGG + Intronic
1056749671 9:89338907-89338929 TTAGGATGCTGGCTTTTGCAGGG + Intronic
1060583343 9:124770970-124770992 TCAGGAAGCCGGTTCCTGCCTGG + Intronic
1060791609 9:126489167-126489189 TTCAGATGCCGGTGTCTGCAGGG + Intronic
1191246147 X:58229845-58229867 TTAGGATGCCTGTGGCGGCCAGG - Intergenic
1193270023 X:79517881-79517903 TTAGAGTGGCGGTAGCTGCATGG - Intergenic
1199931575 X:152528815-152528837 GTAGAATGGTGGTTGCTGCAGGG - Intergenic