ID: 998056074

View in Genome Browser
Species Human (GRCh38)
Location 5:139078615-139078637
Sequence ATCGGGAAGAGTTGACATGC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 75
Summary {0: 1, 1: 0, 2: 0, 3: 4, 4: 70}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
998056074_998056082 25 Left 998056074 5:139078615-139078637 CCTGCATGTCAACTCTTCCCGAT 0: 1
1: 0
2: 0
3: 4
4: 70
Right 998056082 5:139078663-139078685 CACTGCACACATCAAATGCCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
998056074 Original CRISPR ATCGGGAAGAGTTGACATGC AGG (reversed) Intronic
910410822 1:86942809-86942831 TGGGGGAAGAGTTGAGATGCTGG - Intronic
913461643 1:119092515-119092537 ATCGGGGAGAGTTGACCTGAAGG - Intronic
915976543 1:160394500-160394522 ATTTGGAAGAGATGACCTGCAGG - Intergenic
916372141 1:164110050-164110072 ATAGGGATGAGTGGACATGGAGG - Intergenic
917331993 1:173890377-173890399 ATCAGGAAGAGTTGGAATCCTGG + Exonic
918582230 1:186144950-186144972 ATCATGAAGAGTTAGCATGCAGG - Intronic
923432760 1:233939011-233939033 ATTGGGAAGAATGGATATGCTGG - Intronic
923752340 1:236757424-236757446 AAGAGGCAGAGTTGACATGCTGG + Intronic
924013923 1:239698896-239698918 TTCTTGATGAGTTGACATGCAGG + Intronic
924531482 1:244897511-244897533 TTCGGGAACAGCTGACATTCTGG - Intergenic
1063030674 10:2231840-2231862 GTTGGGAAGAGTGGTCATGCAGG + Intergenic
1068462965 10:57351196-57351218 ATGGGGAAAAGTTGCCAGGCTGG + Intergenic
1080016045 11:27507598-27507620 ATCATGAAGTGTTGAAATGCTGG - Intergenic
1080454168 11:32403240-32403262 ATTGGGAAGTGTTGAATTGCAGG - Intronic
1091592684 12:1854332-1854354 ATGAGGAAGAGTTGAGATGGGGG - Intronic
1093625312 12:21339698-21339720 AAAGGGAAGGGCTGACATGCAGG + Intronic
1096747242 12:53737136-53737158 ATGGGGAAAAGTTGAAACGCTGG - Intergenic
1106136893 13:26980179-26980201 ACCGGGAAGAGGTGACCAGCAGG + Intergenic
1115064674 14:29243499-29243521 ATCTAGAAGTGTTGAAATGCTGG + Intergenic
1119872170 14:78027304-78027326 ATCTGGAAGAGTTGATTTGTAGG + Intergenic
1131581070 15:93644447-93644469 ATGGAGAAGAATTGACAGGCAGG - Intergenic
1131864090 15:96688346-96688368 ATCGGGGAGAGTAGACAGGGAGG + Intergenic
1132176634 15:99721153-99721175 ATGGGGAAGCATTGACCTGCAGG + Intronic
1136098334 16:27974799-27974821 ATGGGGATGAACTGACATGCTGG + Intronic
1141491676 16:84378088-84378110 AGAGGGAAGAGATGACAGGCAGG + Intronic
1142008395 16:87701198-87701220 ATCGGGAAGCGCTGGCCTGCAGG - Intronic
1149628448 17:58097741-58097763 ATCTGGAAAAGTGGACATGGTGG - Intergenic
1150020031 17:61602201-61602223 GACGGGAAGAGTAGACAGGCAGG - Intergenic
1152995407 18:401911-401933 TTCTGGAGGAGTTGACATGTGGG + Intronic
1155550991 18:26964869-26964891 ATGAGGAAGAGGTGACATGAGGG + Intronic
1158444654 18:57508896-57508918 ATGCAGAAGAGTTGAGATGCTGG + Intergenic
1164413438 19:28024903-28024925 GTGGGGAAGAGATGACATTCAGG - Intergenic
1164517940 19:28952304-28952326 GTGGGGAAGAGATGACATTCAGG - Intergenic
926690330 2:15728831-15728853 TTCAGGAAAAGTTAACATGCAGG + Intronic
927216725 2:20671621-20671643 CTTGGGAAGAGATGACCTGCCGG + Exonic
932472842 2:71973864-71973886 ATTGGTAAGAGTTAAAATGCAGG - Intergenic
936066471 2:109336230-109336252 CTGGGGAAGAGGTGTCATGCTGG + Intronic
1171012507 20:21516249-21516271 ATCGGGGAGCGTCGACATGAAGG - Intergenic
1177813428 21:25949681-25949703 ATCTGGAAGAGTTCACAGGATGG + Intronic
1179137483 21:38692964-38692986 AGAGGGAAGAGATGAAATGCAGG - Intergenic
1179925159 21:44530089-44530111 ACTGGGAAGAGTTTACATGATGG + Intronic
950355513 3:12404993-12405015 ATGGGGAACAGTGGACATGATGG + Intronic
955178930 3:56647595-56647617 AAGAGGAAGAGATGACATGCAGG - Intronic
955339956 3:58117552-58117574 CTCGGGAAGAGTTGGCACGTTGG + Intronic
958919851 3:100092252-100092274 ATTGGAAATAGTTGACATGCTGG + Intronic
960888179 3:122418086-122418108 ATCGTGAACACTTGACATGAAGG + Intergenic
967990776 3:195128673-195128695 ATCAGGAAGAGGTGACATATTGG - Intronic
971028741 4:22613756-22613778 ATGAGGAAGAGGTGACATGAGGG + Intergenic
972775286 4:42234315-42234337 ATGGGGAAGAGGTGAAATTCTGG - Intergenic
976759370 4:88531761-88531783 AGCAGGGAGAGTTGACACGCAGG + Intronic
982874779 4:160633257-160633279 ATCTGGAATAGTTGAGATGTTGG - Intergenic
983693807 4:170504323-170504345 TTAGGGCAGAGTTGACAAGCAGG + Intergenic
984134286 4:175916191-175916213 ATAGGGAAGAAGTGGCATGCGGG - Intronic
988157122 5:27469135-27469157 ATCTGGAAGAGTTCAAATTCTGG - Intergenic
990304441 5:54480866-54480888 ATTGGGAAGAGATGGCATGATGG + Intergenic
991695447 5:69266533-69266555 AACGGGAAGACATGAGATGCAGG + Intronic
992197463 5:74354194-74354216 ATGGGGAACAATTGAAATGCTGG - Intergenic
993477813 5:88386867-88386889 ACCTGGAAGAGCTGACATGTTGG + Intergenic
996501786 5:124224936-124224958 ACTGGGAAGAGTTCTCATGCTGG - Intergenic
998056074 5:139078615-139078637 ATCGGGAAGAGTTGACATGCAGG - Intronic
999394884 5:151221067-151221089 ATTGGGACAAGTTGAAATGCTGG - Intronic
1002599470 5:180346105-180346127 CTCGGGAAGGGTTGGCATGCGGG - Intronic
1008158062 6:48041640-48041662 ATCTTGAAGAGTTGACATACCGG - Intronic
1009509227 6:64527395-64527417 ATTTGCAAAAGTTGACATGCAGG - Intronic
1017336127 6:153262440-153262462 ATTGGGAAGAGTGGATATCCAGG - Intergenic
1020977987 7:15031636-15031658 GTTGAGAAGAGTTGAGATGCTGG - Intergenic
1025199007 7:56950388-56950410 ATGGGTAGGAGTTCACATGCTGG + Intergenic
1027986311 7:85295504-85295526 ATTGGGAAGAGTTTAAATTCAGG + Intergenic
1031537714 7:122955889-122955911 ATGAGAAAGACTTGACATGCTGG - Intergenic
1032875764 7:136036588-136036610 ACCAAGAAAAGTTGACATGCTGG - Intergenic
1039858631 8:41437635-41437657 ATGGGGAAGGGTAGAGATGCTGG - Intergenic
1040543366 8:48379204-48379226 ATATGGAAAAGTTGACATGGTGG + Intergenic
1055613384 9:78045704-78045726 ACCAGGAAGAGTTGACAGGGTGG - Intergenic
1058621131 9:106884286-106884308 TGCTTGAAGAGTTGACATGCAGG + Intronic
1200247502 X:154533957-154533979 ATAGGGAAGAGTAGCCCTGCAGG + Intronic