ID: 998056076

View in Genome Browser
Species Human (GRCh38)
Location 5:139078632-139078654
Sequence GTTTTTTATCCACTGGGATC GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 156
Summary {0: 1, 1: 0, 2: 1, 3: 10, 4: 144}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
998056076_998056082 8 Left 998056076 5:139078632-139078654 CCCGATCCCAGTGGATAAAAAAC 0: 1
1: 0
2: 1
3: 10
4: 144
Right 998056082 5:139078663-139078685 CACTGCACACATCAAATGCCAGG No data
998056076_998056083 15 Left 998056076 5:139078632-139078654 CCCGATCCCAGTGGATAAAAAAC 0: 1
1: 0
2: 1
3: 10
4: 144
Right 998056083 5:139078670-139078692 CACATCAAATGCCAGGCACGAGG 0: 1
1: 0
2: 1
3: 12
4: 170
998056076_998056085 26 Left 998056076 5:139078632-139078654 CCCGATCCCAGTGGATAAAAAAC 0: 1
1: 0
2: 1
3: 10
4: 144
Right 998056085 5:139078681-139078703 CCAGGCACGAGGCAGAGACCTGG 0: 1
1: 0
2: 5
3: 39
4: 374

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
998056076 Original CRISPR GTTTTTTATCCACTGGGATC GGG (reversed) Intronic
901460735 1:9389887-9389909 GTTTATTATACAAGGGGATCAGG - Intergenic
905642481 1:39600587-39600609 TTTTTATATCCACGTGGATCTGG + Intergenic
907030759 1:51168960-51168982 ATTCTTTATCCAAAGGGATCTGG + Intergenic
909325457 1:74346468-74346490 GTTTTTTATCAACTGCTTTCAGG - Intronic
909890942 1:81005878-81005900 GTATTTCATCCTCTGTGATCAGG + Intergenic
910532915 1:88261034-88261056 TTGTTTTAGCCACTGAGATCCGG - Intergenic
923020970 1:230163565-230163587 GTTTTCTATCCACTGTGATGTGG - Intronic
923546892 1:234929738-234929760 GTTTATAAGCCACTGGGCTCTGG + Intergenic
1063658449 10:8014848-8014870 GTTCTTTATCCACAGGCATCTGG - Exonic
1064276425 10:13910122-13910144 GTTTTTCTTCCACTTGAATCTGG + Intronic
1065655935 10:27949869-27949891 GGTTTTTATCAACTTGGTTCAGG + Intronic
1067907373 10:50307495-50307517 GTTGTTTTTCTACTGGGATGTGG - Intronic
1071714256 10:88079353-88079375 CTTTTTTAGCCACTGAGATTTGG - Intergenic
1071811396 10:89185680-89185702 TATTTTCATCCACTGGGATTTGG - Intergenic
1071837833 10:89437090-89437112 GTATGTTATCCATTGGTATCTGG + Intronic
1072789386 10:98306705-98306727 GTTTTTAAGCCACTGAGATTGGG - Intergenic
1073144072 10:101267926-101267948 GTTTTTTTTCCACTGGAACTTGG + Intergenic
1074015208 10:109527666-109527688 GTGTTTTCTTCTCTGGGATCTGG - Intergenic
1075377296 10:121988919-121988941 GTTTTCTATCTATTGGGAGCCGG - Intergenic
1079779528 11:24583358-24583380 GTTCTTTTTACACAGGGATCTGG + Intronic
1082132696 11:48509959-48509981 TTTTTTTTTTAACTGGGATCTGG + Intergenic
1088589518 11:111391459-111391481 TTTTTTTAGCCACTGGACTCAGG + Intronic
1089907961 11:122064812-122064834 ATTTTATATCCACAGGGATGGGG + Intergenic
1090284766 11:125490412-125490434 GCATTTCATCCAGTGGGATCTGG - Intronic
1090379656 11:126317492-126317514 ATTTTATTTCCTCTGGGATCTGG + Intronic
1092365148 12:7871506-7871528 GTGATTTCTCCACTGGGAGCTGG - Intronic
1093538462 12:20251175-20251197 GTTTTTATTCCACTGTGGTCAGG - Intergenic
1093846874 12:23983077-23983099 GTTTGGTAGTCACTGGGATCTGG + Intergenic
1095926916 12:47587760-47587782 GTTTTTTATCAATAGGAATCTGG + Intergenic
1096248534 12:50011387-50011409 GTTTTTTAGACACTAGAATCAGG - Intronic
1097719985 12:63010031-63010053 TTTTTTTAACCACTGGGAGATGG + Intergenic
1099128153 12:78792503-78792525 GTTTTTAATCTCCTGGGAGCAGG - Intergenic
1104227815 12:126853176-126853198 TTTTTCTTTCCACTGGCATCTGG + Intergenic
1106025512 13:25952016-25952038 GTTATTTAAACATTGGGATCGGG + Intronic
1107404840 13:40102763-40102785 TTTGTTTATTCACTGGGAGCAGG + Intergenic
1108921211 13:55676526-55676548 GTTTGTGAACCACTGAGATCTGG - Intergenic
1110927615 13:81174702-81174724 GTTTTTAATATACTGGGATTAGG + Intergenic
1112625947 13:101103857-101103879 GTATTTTATGCAATGGAATCAGG + Intronic
1116464672 14:45217503-45217525 ATTATTTCTACACTGGGATCTGG + Intronic
1117283634 14:54264959-54264981 GGTTTCAATCCACTGGGAACAGG - Intergenic
1120734676 14:88039655-88039677 GTTTTTAAGCCACTGGAATTTGG + Intergenic
1122003457 14:98683547-98683569 TTTTTTAATCCACTGTGAACTGG + Intergenic
1125379618 15:39073785-39073807 TTTTTTTAACCACTGGGAGTGGG + Intergenic
1126730156 15:51674264-51674286 ATTTTTTATCAACCAGGATCTGG + Intergenic
1128333800 15:66773357-66773379 GTTCTTTATCCACCGGGCTCCGG - Intronic
1129306633 15:74669541-74669563 GTTGTTTATTCACTTGAATCAGG + Intronic
1132283023 15:100636428-100636450 ATGTTTTGCCCACTGGGATCAGG + Intronic
1137451932 16:48584055-48584077 GATTTGTATCCACTGGTCTCTGG - Intronic
1137549087 16:49424584-49424606 GTTTTGTATCCACTGAGGACAGG + Intergenic
1137904851 16:52310653-52310675 GTTTCTTAGGCACTAGGATCTGG + Intergenic
1140751440 16:78027977-78027999 TTTTTGTATACACTGGGCTCAGG + Intronic
1140900700 16:79364520-79364542 GTTTTTAATCCACTGGGGACAGG + Intergenic
1141470531 16:84235296-84235318 TTTCTTTATTAACTGGGATCAGG + Intronic
1145181426 17:20756208-20756230 ATTTTCTTTCCACTGGCATCTGG + Intergenic
1147916789 17:43892544-43892566 TTTTTTTTTCCAGTGGGCTCAGG + Intronic
1149841315 17:59967145-59967167 ATTTTCTTTCCACTGGCATCTGG + Intronic
1149938009 17:60829064-60829086 GATTTTTATCTTCTTGGATCAGG - Intronic
1151687707 17:75658710-75658732 GTATTTTTTCCACTGGGCCCTGG - Intronic
1158234409 18:55297164-55297186 TTTTTTTATCCCTTAGGATCAGG + Intronic
1159323854 18:66890257-66890279 TTTTTTTTTCCACTGGGAATTGG - Intergenic
1163331834 19:16643856-16643878 ATATTTTGTCCACTGTGATCAGG - Intronic
1166086894 19:40482246-40482268 ATTTTTTATACAATGGGGTCTGG + Intronic
1166434052 19:42752221-42752243 CTTGTTTATCCTCTGGGGTCTGG + Intronic
1166446905 19:42865997-42866019 CTTGTTTATCCTCTGGGGTCTGG + Intronic
1166453841 19:42923664-42923686 CTTGTTTATCCTCTGGGGTCTGG + Intronic
1166466100 19:43032217-43032239 CTTGTTTATCCTCTGGGGTCTGG + Intronic
1166472240 19:43088285-43088307 CTTGTTTATCCTCTGGGGTCTGG + Intronic
1166485847 19:43211321-43211343 CTTGTTTATCCTCTGGGGTCTGG + Intergenic
1166493001 19:43275274-43275296 CTTGTTTATCCTCTGGGGTCTGG + Intergenic
1168222078 19:54967752-54967774 GTTTTTTATTCACTGAGGTGAGG + Intronic
928169361 2:28993565-28993587 GTTTAATATCTACTGGGATAAGG - Intronic
928241033 2:29586825-29586847 GTTTTTTATTAATTGGAATCTGG - Intronic
928543406 2:32305848-32305870 GTATTTTATTCACTGGAATATGG - Exonic
930487977 2:52032248-52032270 GTTTTTTTTCCATTGAGATATGG + Intergenic
933263398 2:80154655-80154677 GTTATTAAGCCACTGGGATGGGG - Intronic
934992566 2:98931897-98931919 GTTCATTATCCACTTGGCTCAGG + Intronic
939067515 2:137501912-137501934 GTGCTTTATCCGCTGTGATCTGG + Intronic
939176393 2:138752910-138752932 GTTTTTCATCCACTGTGTTAAGG + Intronic
940557025 2:155242030-155242052 CTTTTGTATCTACTGAGATCAGG - Intergenic
941893117 2:170602741-170602763 GTCTTTTATCCCATGGGCTCTGG - Intronic
942998669 2:182297357-182297379 TTTTTTTCTCCACTGGGCTCAGG - Intronic
944642762 2:201744972-201744994 GTTTTTTATACAGTGGTATCTGG - Intronic
945045970 2:205782141-205782163 GTCTGTTATCCACTGGGATTGGG - Intronic
945560489 2:211333477-211333499 TTTTTTTAAGCACTGGGACCAGG + Intergenic
946270030 2:218584199-218584221 TTTTCTTAACCACTGTGATCTGG + Intronic
946795638 2:223348971-223348993 GGTTTTATTCCACTGTGATCTGG - Intergenic
948657239 2:239484126-239484148 GTGTTTCATTCACTGGGATTTGG - Intergenic
948744374 2:240075852-240075874 TTGTATTATCTACTGGGATCTGG - Intergenic
1173818499 20:46005548-46005570 GTTTTTTACCAAATGGGAGCAGG - Intergenic
1174702233 20:52620634-52620656 GTTGTATATCCAGTGGGATAAGG - Intergenic
1175916405 20:62428050-62428072 GATTTCTGTCCACTGGGTTCTGG - Intergenic
1178124765 21:29504635-29504657 GGTTTTTCTCCACTCGAATCTGG - Intronic
1178727624 21:35068327-35068349 ATTTTATATGCACTGGGGTCTGG + Intronic
1182489611 22:30662539-30662561 ATTTTTTATACAGTGGTATCGGG + Exonic
1182882536 22:33745885-33745907 GTTAGTTCTCCACAGGGATCAGG - Intronic
1183138597 22:35914765-35914787 GTTGTTTACCCCCGGGGATCGGG - Intronic
1183491526 22:38119212-38119234 GTTTTTTATGCTCTGTGGTCCGG + Intronic
952471323 3:33655636-33655658 CTTTGTGATACACTGGGATCAGG - Intronic
953453580 3:43024064-43024086 GTTTTTTATGCTCTGGTGTCTGG + Intronic
955575472 3:60357910-60357932 GTCTTTTATCTACTGGGAGAAGG - Intronic
957968695 3:87355266-87355288 GTTCATTATACACTGGTATCAGG - Intergenic
962115211 3:132498636-132498658 TTTTTTTATCAACTGGCATTAGG + Intronic
962522010 3:136205920-136205942 GCTTTTTATCAACTTGGACCTGG - Intergenic
965433175 3:168614097-168614119 CTTTTCTACCCACTGGGCTCTGG - Intergenic
966218519 3:177527437-177527459 GTTTTCTATCTATTGGGAGCCGG - Intergenic
972192753 4:36614260-36614282 GCTTTTTATTCACTGGCAACTGG - Intergenic
974183257 4:58410470-58410492 GTTTTCTATACACTGCCATCTGG + Intergenic
980943088 4:139293670-139293692 GTTTTTTATCTAATGGGTTTGGG - Intronic
982222741 4:153138881-153138903 ATTTATTGTCCCCTGGGATCTGG + Intergenic
983283640 4:165711912-165711934 ATTTTTTTTCCACTGGTTTCAGG + Intergenic
983832679 4:172348292-172348314 CTGTTTTATCCTCTGGTATCAGG - Intronic
989654241 5:43727967-43727989 ATTTTCTATCCTCTGAGATCAGG + Intergenic
990797494 5:59560887-59560909 GTATTTTATCTTCAGGGATCTGG + Intronic
992706236 5:79396152-79396174 GTTTTTTGTACACTGGAATCAGG + Intronic
992876607 5:81061982-81062004 TTTTTTTGTCAGCTGGGATCAGG - Intronic
993037722 5:82775531-82775553 TTTTTTTTTCCTCTGGGATGGGG - Intergenic
994568811 5:101486588-101486610 GTTTGTTTTGCACTGGGATGTGG - Intergenic
994627216 5:102235241-102235263 GTTTTATATACACTGTAATCAGG - Exonic
994692992 5:103040949-103040971 ATATTTTATACACTGTGATCTGG - Intergenic
996518093 5:124395740-124395762 GAATTTAAGCCACTGGGATCAGG + Intergenic
998056076 5:139078632-139078654 GTTTTTTATCCACTGGGATCGGG - Intronic
1001535744 5:172496804-172496826 CTTTTCTATCCACTGGGCTTTGG - Intergenic
1004580827 6:16949819-16949841 GTTTTGTTCCCACTGGGATTGGG - Intergenic
1004595601 6:17096298-17096320 TTTTTTTCTCCACTGGAATGTGG - Intergenic
1006604325 6:35245199-35245221 TTGTTTTATCCACTGGGGTTTGG + Intronic
1009751175 6:67881046-67881068 GTTGTTTATTCACTGGGTGCGGG + Intergenic
1012839019 6:104306014-104306036 CTTTTTCCTCCACTGTGATCAGG - Intergenic
1014663387 6:124202386-124202408 GTTTTTTATGCACTGGAGTTAGG + Intronic
1018452540 6:163922454-163922476 ATTTTTTAGCCACTGGGCACAGG + Intergenic
1021081081 7:16365912-16365934 GTTTTTTGTCCACTGTCTTCTGG - Intronic
1022736353 7:33079818-33079840 GTTTTCTATTTACTGGGAGCCGG + Intergenic
1022820280 7:33953127-33953149 GTTTTTAATATACTGGGTTCCGG + Intronic
1023085494 7:36566617-36566639 GTTTTCTATCTATTGGGAGCTGG - Intronic
1025122446 7:56316735-56316757 AATTTTTATACAGTGGGATCAGG + Intergenic
1027781878 7:82530304-82530326 ATTTTTGATGCACTGGAATCTGG + Intergenic
1029835911 7:103309642-103309664 TTTTGGTATCCACAGGGATCTGG + Intronic
1032773864 7:135090140-135090162 GTGCTTCATCCACTGGAATCTGG - Intronic
1033727500 7:144134479-144134501 GTTTTCTGTCCTCTGGGATCTGG - Intergenic
1035846646 8:2872844-2872866 GTGTCATAACCACTGGGATCGGG + Intergenic
1043794494 8:84519507-84519529 CTTTTGTTTCCTCTGGGATCTGG - Intronic
1048129624 8:131680471-131680493 TTTGTTTGTCCACTGGGAGCAGG + Intergenic
1048636508 8:136301483-136301505 ATTTTTTATGCTCTGGCATCTGG - Intergenic
1052011309 9:23412973-23412995 GTTTTTTATCCCTTGGGATCAGG + Intergenic
1052278284 9:26703624-26703646 CTTTTTTATTCACTGGGCTTAGG + Intergenic
1058325105 9:103686219-103686241 GTATTTTTTCCACTGGAATGAGG - Intergenic
1059605380 9:115829118-115829140 GTATGTTGACCACTGGGATCAGG + Intergenic
1062614175 9:137388554-137388576 GCTTTTTATCCACAGGGTTGGGG + Intronic
1185664153 X:1751273-1751295 GTTTTTTTCCCAAGGGGATCCGG + Intergenic
1186796407 X:13050779-13050801 ATCTTTTATCCACTGCAATCTGG - Intergenic
1187739527 X:22340593-22340615 GTTTATTATACACTGTGATATGG + Intergenic
1188400472 X:29738151-29738173 GTTTTCTCTCCTCTGTGATCTGG - Intronic
1191848963 X:65571568-65571590 GTCATTTATCCTCTGAGATCAGG + Intergenic
1194497225 X:94631842-94631864 GTTTAATATCCATTGGAATCAGG + Intergenic
1196129650 X:112141457-112141479 GTTTTTTTTCCCCTGAGATCAGG - Intergenic
1199728877 X:150611277-150611299 GTTTTCTAGCTACTGGCATCAGG + Intronic
1200131028 X:153846039-153846061 GTTTCCTCTCCTCTGGGATCCGG - Intergenic