ID: 998056077

View in Genome Browser
Species Human (GRCh38)
Location 5:139078633-139078655
Sequence GGTTTTTTATCCACTGGGAT CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 144
Summary {0: 1, 1: 0, 2: 1, 3: 9, 4: 133}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
998056077_998056085 25 Left 998056077 5:139078633-139078655 CCGATCCCAGTGGATAAAAAACC 0: 1
1: 0
2: 1
3: 9
4: 133
Right 998056085 5:139078681-139078703 CCAGGCACGAGGCAGAGACCTGG 0: 1
1: 0
2: 5
3: 39
4: 374
998056077_998056082 7 Left 998056077 5:139078633-139078655 CCGATCCCAGTGGATAAAAAACC 0: 1
1: 0
2: 1
3: 9
4: 133
Right 998056082 5:139078663-139078685 CACTGCACACATCAAATGCCAGG No data
998056077_998056083 14 Left 998056077 5:139078633-139078655 CCGATCCCAGTGGATAAAAAACC 0: 1
1: 0
2: 1
3: 9
4: 133
Right 998056083 5:139078670-139078692 CACATCAAATGCCAGGCACGAGG 0: 1
1: 0
2: 1
3: 12
4: 170

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
998056077 Original CRISPR GGTTTTTTATCCACTGGGAT CGG (reversed) Intronic
906883077 1:49613831-49613853 GTTTTTCTATGGACTGGGATGGG - Intronic
909802594 1:79830865-79830887 GGTTCTTTATCCTCTGGCTTTGG - Intergenic
917068999 1:171128466-171128488 GGTTTGTGGTCCACTGGGGTGGG - Intergenic
919680466 1:200429626-200429648 GTTTTTTTTTCCACTGTGAGTGG + Intergenic
921077696 1:211712848-211712870 GGTTTATTACCAACAGGGATTGG - Intergenic
921448113 1:215270675-215270697 GGTTTGATATCCACTTGGATGGG - Intergenic
924376526 1:243414993-243415015 GGTTATTGACCCAGTGGGATAGG + Intronic
924645429 1:245872959-245872981 GCAGTTTTATTCACTGGGATGGG - Intronic
1062989414 10:1801929-1801951 GATTTTTTTTCCACTTGGATTGG + Intergenic
1066678900 10:37917225-37917247 GGGTTTTTATGGACTGGGAAGGG + Intergenic
1072789387 10:98306706-98306728 GGTTTTTAAGCCACTGAGATTGG - Intergenic
1076367027 10:129927742-129927764 GGTCCCTTATCCACTGGGTTAGG + Intronic
1078870541 11:15340051-15340073 GGTTTTTTATTAACTGGTAGTGG + Intergenic
1089535427 11:119158153-119158175 GGTTTTTCATTCACTGAGCTGGG + Intronic
1089907960 11:122064811-122064833 TATTTTATATCCACAGGGATGGG + Intergenic
1091275411 11:134346287-134346309 GCTTTCTAATCCACAGGGATGGG - Intronic
1099328991 12:81257181-81257203 GGGTTATTTTCCACTAGGATGGG + Exonic
1102412184 12:112729705-112729727 GGCTTTTTAGCCAGTGGTATGGG - Intronic
1103242381 12:119424935-119424957 GGATTTGTATTGACTGGGATTGG - Intronic
1106984228 13:35325987-35326009 GGTTTTTTATCCCCTTCCATTGG + Intronic
1110207685 13:72935710-72935732 GTTTTTTTATCCACTATAATGGG + Intronic
1111233141 13:85371483-85371505 GGTTTGTTGTCCACTGACATGGG - Intergenic
1113499511 13:110762017-110762039 GGTATTTTATCCACTCAGCTGGG - Intergenic
1114400121 14:22402384-22402406 GGTCTTTTATCCACTGTTTTAGG - Intergenic
1117504542 14:56389061-56389083 GTTTTGTTTTCCACTGTGATAGG + Intergenic
1119669034 14:76504956-76504978 AGGTTGTTATCCACTGAGATGGG + Intergenic
1120085204 14:80264063-80264085 GGTTTTTTGTCCACTCAGAGAGG + Intronic
1120219966 14:81720757-81720779 GGTTATTTAGCACCTGGGATTGG + Intergenic
1120439311 14:84515261-84515283 GGTCTTTAATCCACTTTGATTGG + Intergenic
1123902644 15:24892154-24892176 GATATTTTATCCACTCAGATGGG - Intronic
1125379617 15:39073784-39073806 TTTTTTTTAACCACTGGGAGTGG + Intergenic
1125641957 15:41238511-41238533 TATTTTTTCTCCACTGGTATGGG - Intronic
1125867000 15:43061482-43061504 GTTTCTTTATCCACTCTGATGGG - Intronic
1127936287 15:63642341-63642363 GTTTTTTTTTCCTTTGGGATGGG + Intronic
1129584524 15:76849187-76849209 GGGTGTTCAGCCACTGGGATGGG - Intronic
1133947017 16:10357104-10357126 GGGTTTTTATGGACTGGGAAGGG + Intronic
1139047401 16:63078441-63078463 TATTTTTCATCCAATGGGATGGG - Intergenic
1139844965 16:69914286-69914308 CTTTTTTTATCCTCTGGGCTAGG - Intronic
1140625622 16:76790560-76790582 GGTTTTTTTGCCATTGTGATAGG - Intergenic
1142846842 17:2685153-2685175 GATTTTTTTTCCAGTGGGGTGGG + Exonic
1152116738 17:78392566-78392588 GGTTTCTGATCCACTGGAACCGG - Exonic
1203169015 17_GL000205v2_random:129975-129997 GGGTTTTTATGGACTGGGAAGGG + Intergenic
1158708630 18:59817369-59817391 GAAGTTGTATCCACTGGGATGGG + Intergenic
1159435301 18:68408746-68408768 GAGTTTGTATGCACTGGGATGGG + Intergenic
1159682401 18:71371080-71371102 GGTTTTTTACCCATTTTGATAGG - Intergenic
1164194497 19:22944209-22944231 GGGTTTTTATAAACTGGAATGGG - Intergenic
1166590981 19:43998208-43998230 GGGTTTTTATGGACTGGGAAGGG - Intronic
1166606687 19:44149676-44149698 GGGTTTTTATGGACTGGGAAGGG + Intronic
928360504 2:30658742-30658764 GGTTTTTTTTCCTATGGTATGGG - Intergenic
930011975 2:46944171-46944193 TGTTTTTTAATCACTTGGATGGG - Intronic
931735075 2:65186552-65186574 GACTTTTTCTCCACTGGGAGAGG + Intergenic
933263399 2:80154656-80154678 TGTTATTAAGCCACTGGGATGGG - Intronic
933973905 2:87492481-87492503 AGTCCTTTATCCACTGTGATTGG - Intergenic
936319816 2:111457723-111457745 AGTCCTTTATCCACTGTGATTGG + Intergenic
940260890 2:151778742-151778764 GATTTATAATCCACTGGGTTGGG - Intergenic
945045971 2:205782142-205782164 GGTCTGTTATCCACTGGGATTGG - Intronic
946506397 2:220305416-220305438 GTTTTTTTTTCCAATGGAATGGG - Intergenic
1172996722 20:39076037-39076059 GGTTTTTTTTCCCCTGGGTTTGG + Intergenic
1176402741 21:6329177-6329199 GGGTTTTTATGGACTGGGAAGGG - Intergenic
1176434416 21:6659927-6659949 GGGTTTTTATGGACTGGGAAGGG + Intergenic
1176458678 21:6986997-6987019 GGGTTTTTATGGACTGGGAAGGG + Intergenic
1177716560 21:24846612-24846634 GGGTTTTTATGGACTGGGAAGGG + Intergenic
1183146840 22:36000651-36000673 GTTTTTTTATCTCCTGTGATAGG + Intronic
949395831 3:3613999-3614021 GGTTCTTTTTGCAATGGGATGGG - Intergenic
949601869 3:5608541-5608563 GCTTTTTTATCCAATGTGACAGG - Intergenic
950292252 3:11794495-11794517 GCATTTTTATCCACTGGGGAAGG - Intronic
950559885 3:13715239-13715261 GGCTGTTTTTCCACTGGGGTGGG + Intergenic
952557122 3:34544920-34544942 GGTATTGTATCCATTGGGGTGGG - Intergenic
953739668 3:45526745-45526767 TGTTGTTTGTCCACTGGGAGAGG - Intronic
955275856 3:57546179-57546201 GGGTTTTTATGGACTGGGAAGGG - Intergenic
956484252 3:69704710-69704732 TGTTTTTTGTCCACTGGGTTTGG + Intergenic
957573582 3:81980712-81980734 GGCTTTTTATGCACTGTGACAGG + Intergenic
959242084 3:103808942-103808964 GGTTTGTTATCCACTGCACTGGG - Intergenic
959560762 3:107778077-107778099 GGCATTTTCTCCACTGGCATGGG - Intronic
963389178 3:144635805-144635827 TTTTCTTTATCCACTGGCATTGG + Intergenic
965865610 3:173201047-173201069 GATATTTTATCCACTCAGATGGG - Intergenic
966896639 3:184449911-184449933 GGTTTTTTATCCATTCAGAGAGG + Intronic
971371074 4:26019398-26019420 GTTTTATCATCCACTGGGAGGGG + Intergenic
971850017 4:31973416-31973438 GAGTTTTTAAGCACTGGGATAGG + Intergenic
973852666 4:54976806-54976828 GCTTTATTCTCCACTGTGATGGG - Intergenic
976185140 4:82435861-82435883 GCTTTTTCATCCGCAGGGATGGG + Intronic
977394840 4:96457621-96457643 GGTTTTGGAAACACTGGGATTGG - Intergenic
978958829 4:114650010-114650032 GGTTTTTTAACCACTTTCATTGG + Intronic
979118847 4:116866479-116866501 GGTTTTTTATGGACTGGAAGGGG - Intergenic
979293831 4:119007758-119007780 GTTTTTTTAACCACTGATATTGG + Intronic
980943089 4:139293671-139293693 TGTTTTTTATCTAATGGGTTTGG - Intronic
985904289 5:2821207-2821229 CATTTTTTCTCTACTGGGATGGG - Intergenic
986885334 5:12226705-12226727 GGTGTTTTTTCCACTGTGACAGG + Intergenic
988639599 5:33026718-33026740 TGTTTTCTATCCACTGAGAAAGG - Intergenic
988695312 5:33615927-33615949 GGTTTATTATCCAGTGGAACGGG - Exonic
988726184 5:33928708-33928730 GGTTTATCATACACTGCGATTGG - Intergenic
990845483 5:60133580-60133602 TGTGTTTTATGCACTGGGTTAGG - Intronic
992853808 5:80839531-80839553 GTATTTTAATCCACTGGAATTGG + Intronic
993037723 5:82775532-82775554 ATTTTTTTTTCCTCTGGGATGGG - Intergenic
993296888 5:86152223-86152245 GGTATTATATTCACTGGGCTGGG - Intergenic
995094311 5:108217146-108217168 GGGTTTTTATGGACTGGGAAGGG - Intronic
995310698 5:110707395-110707417 GCTTTGTTATCCACTGTGACAGG - Intronic
996989886 5:129615864-129615886 AGTGTATTATCTACTGGGATTGG - Intronic
997569196 5:134913190-134913212 GTTTATTTTCCCACTGGGATGGG - Intronic
997921846 5:137988131-137988153 AGTTTTTTATGTACTGTGATAGG - Intronic
998056077 5:139078633-139078655 GGTTTTTTATCCACTGGGATCGG - Intronic
1001479199 5:172075807-172075829 GGTTTTTTAGCCATTCTGATAGG - Intronic
1003836030 6:10073552-10073574 GCTTTTCTGTCCACTGGGAACGG + Intronic
1004580828 6:16949820-16949842 GGTTTTGTTCCCACTGGGATTGG - Intergenic
1005870373 6:29970906-29970928 GGTGTTCTGTCCAATGGGATGGG - Intergenic
1009585466 6:65595966-65595988 GGCTGTTTTTCCACTGAGATAGG - Intronic
1009751174 6:67881045-67881067 GGTTGTTTATTCACTGGGTGCGG + Intergenic
1014435033 6:121411298-121411320 TGTTTTCTCTCCACTGGCATTGG + Intergenic
1014582874 6:123160444-123160466 GGGCTTTTAACCACTAGGATTGG + Intergenic
1015627565 6:135196614-135196636 GATTTTTAATCAACTGGGAAAGG - Intronic
1016056797 6:139586515-139586537 GGTTTGATATCCACTGTGGTGGG + Intergenic
1016770793 6:147848188-147848210 AGTTTTTGATCCACTGCTATGGG - Intergenic
1017247875 6:152246722-152246744 CTATTTTTATCCACTGGGCTGGG - Intronic
1019790414 7:3009007-3009029 AATTTTGTATCCACTGGGTTGGG - Intronic
1021714631 7:23450525-23450547 GGATCTTTATCCACGAGGATTGG - Intronic
1022075604 7:26966788-26966810 GGGCTATTATCCACTGGGAATGG - Intronic
1022911724 7:34905271-34905293 AGTTTTTTTTCCTCTGGGACTGG - Intergenic
1027299033 7:76810206-76810228 GGTTTCTTATCCACTGTGTATGG + Intergenic
1027524806 7:79254609-79254631 GCATTTTTGTTCACTGGGATAGG - Intronic
1028035124 7:85972398-85972420 GGGTTTTTATGGGCTGGGATGGG + Intergenic
1032156183 7:129470256-129470278 AGATTGTTATCCAGTGGGATGGG + Intronic
1033968225 7:147005204-147005226 GATTTTCTATCCACGGGAATAGG + Intronic
1035456019 7:159009338-159009360 GATTTTTCCTCCACTAGGATGGG - Intergenic
1044338785 8:91022647-91022669 GGTTTTCTATCCACTGTATTAGG + Intronic
1044485764 8:92752344-92752366 GACTTTTTTTCCACTGGAATTGG - Intergenic
1044696723 8:94930610-94930632 GTTCTTTTATCCACTGGGAAGGG + Exonic
1047398008 8:124520631-124520653 GTTATTTTATACACTGGGAGAGG - Intronic
1051769771 9:20564731-20564753 GGATATTTATCCACTGGAAGTGG + Intronic
1053112204 9:35471046-35471068 GTTTATATATCAACTGGGATCGG + Intergenic
1055624400 9:78160058-78160080 GGTTTTTTCTCTCCTGGGATAGG - Intergenic
1056464798 9:86843124-86843146 GGCTTTTTATCCCCTTGGACGGG - Intergenic
1057418593 9:94888710-94888732 GGGTTTTTATGGACTGGGAAGGG + Intronic
1059761436 9:117341294-117341316 GGTACTTTATTCACTGAGATAGG + Intronic
1062614174 9:137388553-137388575 GGCTTTTTATCCACAGGGTTGGG + Intronic
1203437119 Un_GL000195v1:148718-148740 GGGTTTTTATGGACTGGGAAGGG - Intergenic
1185526801 X:786687-786709 GGTTATCTATCCACTGAGACTGG + Intergenic
1185963276 X:4570193-4570215 GGGTTTTTATGGACTTGGATGGG + Intergenic
1187360509 X:18622673-18622695 ATTTTTTTATTCACTGGTATAGG + Intronic
1193347705 X:80423457-80423479 GGGTTTTTATGGACCGGGATGGG + Intronic
1193348736 X:80432842-80432864 GGGTTTTTATGGACTGGGAAGGG + Intronic
1194385135 X:93243162-93243184 GGGTTTTTATGGACTGGGAAGGG - Intergenic
1194496603 X:94623843-94623865 GGGTTTTTATGGACTGGGAGGGG + Intergenic
1194993449 X:100569452-100569474 GGTTCTTTTTCCCCTAGGATAGG - Intergenic
1197328774 X:125127628-125127650 GGTTTTATAGCCACCTGGATGGG - Intergenic