ID: 998056078

View in Genome Browser
Species Human (GRCh38)
Location 5:139078638-139078660
Sequence GTAGTGGTTTTTTATCCACT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 156
Summary {0: 1, 1: 0, 2: 0, 3: 7, 4: 148}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
998056078_998056085 20 Left 998056078 5:139078638-139078660 CCCAGTGGATAAAAAACCACTAC 0: 1
1: 0
2: 0
3: 7
4: 148
Right 998056085 5:139078681-139078703 CCAGGCACGAGGCAGAGACCTGG 0: 1
1: 0
2: 5
3: 39
4: 374
998056078_998056083 9 Left 998056078 5:139078638-139078660 CCCAGTGGATAAAAAACCACTAC 0: 1
1: 0
2: 0
3: 7
4: 148
Right 998056083 5:139078670-139078692 CACATCAAATGCCAGGCACGAGG 0: 1
1: 0
2: 1
3: 12
4: 170
998056078_998056082 2 Left 998056078 5:139078638-139078660 CCCAGTGGATAAAAAACCACTAC 0: 1
1: 0
2: 0
3: 7
4: 148
Right 998056082 5:139078663-139078685 CACTGCACACATCAAATGCCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
998056078 Original CRISPR GTAGTGGTTTTTTATCCACT GGG (reversed) Intronic
908303424 1:62784994-62785016 GTATTGGTTATTTACCCACATGG + Intronic
911743614 1:101415008-101415030 GTAGAGGTCTTTTATCTCCTTGG - Intergenic
912976160 1:114332151-114332173 GTAGTGGTTTCTCTTCCTCTAGG - Intergenic
915481817 1:156191902-156191924 GAAGTGGCATTTTATCAACTTGG + Intergenic
915986149 1:160466932-160466954 GTAGAGGTTTTTTACCTCCTTGG + Intergenic
916249490 1:162723467-162723489 ACAGTGGTTTTATATCCCCTAGG - Intronic
918858605 1:189791987-189792009 GTAGTCCCTCTTTATCCACTAGG - Intergenic
919271876 1:195359044-195359066 TTAGTGTTTTTTTATCCTCAGGG - Intergenic
919643665 1:200070121-200070143 GTAGTAGTTTTGTATACAGTTGG + Intronic
920600096 1:207316412-207316434 ATAGTAGTTTTTTTTTCACTAGG - Intergenic
920653705 1:207858791-207858813 GTAGTGTTTTTTTCACCAGTTGG - Intergenic
924627056 1:245704294-245704316 GTAGTGTTTTTTTCCCCGCTTGG - Intronic
1062989413 10:1801924-1801946 TTAGAGATTTTTTTTCCACTTGG + Intergenic
1064510857 10:16089649-16089671 GTAGTGGTCTTTTACCTCCTTGG - Intergenic
1066057899 10:31698520-31698542 GTTTTGGATTTTTATCAACTTGG + Intergenic
1068584122 10:58777464-58777486 GTAGCTCTTTTTTATCCAATTGG + Intronic
1070226386 10:74511501-74511523 GTAGAGGTCTTTTATCACCTTGG + Intronic
1073367874 10:102958772-102958794 GTATTTGTTTTTAATCAACTAGG + Intronic
1074518543 10:114195717-114195739 GTAATGTTTTTTAATTCACTAGG + Intronic
1075234977 10:120719637-120719659 GTCTGGGTTTTTTTTCCACTGGG - Intergenic
1077236182 11:1483069-1483091 GCAGAGGTGTTTTCTCCACTGGG - Intronic
1081840292 11:46195628-46195650 GTGGTGATTTTTTACCCTCTTGG + Intergenic
1087288607 11:96295386-96295408 GAAGTGGTTTTAAATGCACTTGG - Intronic
1088007259 11:104957332-104957354 GTACTTGTTTTTTACCTACTCGG - Intronic
1088026393 11:105189363-105189385 CAAGTGTGTTTTTATCCACTAGG + Intergenic
1088760924 11:112928035-112928057 GTCCTGGTGTTTTTTCCACTGGG + Intergenic
1089802002 11:121039732-121039754 CTAGTGATTTGCTATCCACTTGG - Intronic
1094157963 12:27357306-27357328 GTAGAGGTCTTTTATCTCCTTGG - Intronic
1096246401 12:49990643-49990665 GTAGTTGTTTTTTATTTCCTAGG + Intronic
1099422743 12:82483449-82483471 GTAGTGATCTTTTATCTCCTTGG - Intergenic
1105373788 13:19824760-19824782 CTAGTGGTTTTTTCACCATTTGG + Intronic
1106324545 13:28675441-28675463 GTAGATGATTTTTATCCACCTGG + Intronic
1107268933 13:38591594-38591616 GTAGTGGTTTCTTTCCCTCTAGG - Intergenic
1108635485 13:52330347-52330369 GTAGAGGTTTTTCACCTACTTGG - Intergenic
1108768901 13:53671629-53671651 GTTGTGGTTTTATTTCTACTAGG - Intergenic
1110235026 13:73208183-73208205 ATAGAGGTTTTTCATTCACTGGG + Intergenic
1113572202 13:111366058-111366080 AGAGTGGTTTTTTTCCCACTAGG - Intergenic
1115094343 14:29616866-29616888 GTAGGGGTTTGGTATACACTTGG + Intronic
1116661114 14:47711345-47711367 GTTGTGGTGTTTTATCTAGTGGG - Intergenic
1120131221 14:80809799-80809821 GTAGTGGTTTTGAATTCCCTAGG - Intronic
1120231084 14:81842511-81842533 ATAGTTATTTTTCATCCACTGGG - Intergenic
1120455588 14:84725978-84726000 GCAATGGTTTTTTAACCACTGGG + Intergenic
1123002848 14:105305557-105305579 ATAGTGGTTTATAAGCCACTTGG + Exonic
1124012921 15:25853106-25853128 CTTGTGGTTATTTTTCCACTGGG - Intronic
1124255510 15:28139063-28139085 ATAGTACTTTTATATCCACTGGG + Intronic
1124514065 15:30351204-30351226 GTAGTGCCTTCTTATCCACAGGG + Intergenic
1124728855 15:32179560-32179582 GTAGTGCCTTCTTATCCACAGGG - Intergenic
1127656120 15:61057867-61057889 GTAGTGGTCTTTTTTCCAGGAGG - Intronic
1130792780 15:87173604-87173626 GTAGTGTTTTTTAACCCATTTGG - Intergenic
1131221321 15:90586897-90586919 GTTGTTGTTTATTATCAACTAGG - Intronic
1138227990 16:55315266-55315288 GTAGTGGTTTATTGTCTCCTTGG + Intergenic
1138776098 16:59725823-59725845 GTAGTGGTTCATTTTCCCCTTGG + Intronic
1140208828 16:72954976-72954998 GTACTGGTTTTTTTTCCCCATGG - Intronic
1142331087 16:89454396-89454418 TTAGGGTTTTTTTACCCACTAGG - Intronic
1144276550 17:13674353-13674375 ATTGTGATTTTTTATCCATTCGG - Intergenic
1150550046 17:66201892-66201914 GTTGTGGTTCTTTCTTCACTAGG + Intergenic
1150895962 17:69211135-69211157 GTAGTGATTTCTTTTCCTCTGGG - Intronic
1153454401 18:5263893-5263915 GTCTTGGTTCTTTATCCAATTGG - Intergenic
1155522151 18:26679290-26679312 TTTGTGCTTTTTTGTCCACTTGG + Intergenic
1156643364 18:39129207-39129229 GTAATGGTTTCTTTTCCTCTGGG - Intergenic
1156845892 18:41664905-41664927 GTATTGGCTTCTAATCCACTTGG - Intergenic
1162235695 19:9307643-9307665 GTACTGATTTTTTTTCCTCTAGG - Intronic
1163984755 19:20935437-20935459 GTAGTGGTTTCTGTTCCATTGGG + Intronic
1164001045 19:21099543-21099565 GTAGTGGTTTCTGTTCCATTAGG + Intronic
1164049419 19:21571479-21571501 CTCGTGGTATTTTATCCTCTAGG + Intergenic
927271838 2:21218965-21218987 TTCGTGATTTTGTATCCACTTGG + Intergenic
928293363 2:30059741-30059763 GTAGTGGTTTTTAATACATTGGG + Intergenic
928575462 2:32649897-32649919 GTATTTTTTTTTTAGCCACTTGG - Intronic
935942285 2:108253207-108253229 ATAGTAATTTTTTATCCACAAGG - Intronic
938978508 2:136503280-136503302 GATGTGGTTTTCTATCCACAGGG + Intergenic
939219671 2:139285697-139285719 GTAGGGGTCTTTCATCTACTTGG - Intergenic
940431135 2:153591246-153591268 TTAGAGGTTTTTTATCTCCTTGG - Intergenic
943741575 2:191415805-191415827 GTTGTGGTTTCATATTCACTGGG + Intronic
944540859 2:200752170-200752192 GTAGTGGTTTTCTGGCCACCTGG - Intergenic
948678875 2:239617922-239617944 GTAGTGGGTCTTTTTCCTCTGGG + Intergenic
1170410568 20:16086211-16086233 GTAGAGGTCTTTCATCCCCTTGG - Intergenic
1170440670 20:16376004-16376026 GCAGTGGTTGTATAACCACTGGG - Intronic
1172414314 20:34751767-34751789 GTAGTGCTTATTTATTTACTGGG + Intronic
1176699162 21:10022039-10022061 GTAGTGGTCTTTGACCCCCTTGG - Intergenic
1179300532 21:40105230-40105252 TCAGTGGTTGTTTGTCCACTAGG - Intronic
1179607917 21:42529908-42529930 GTAGTGTTTTTTATTTCACTGGG - Intronic
949572788 3:5309733-5309755 ATAGTGGTTGTTTATTTACTTGG + Intergenic
950311947 3:11966574-11966596 GAAGTGCTTTTTTTTCCACCAGG - Intergenic
950385730 3:12658110-12658132 GTAGTGCTTCCATATCCACTTGG + Intronic
951032655 3:17899939-17899961 GTAGTGGGTTTTCAAACACTCGG + Intronic
951054037 3:18126823-18126845 GAAGTGGTTTTGTGGCCACTGGG + Intronic
951297872 3:20961432-20961454 GTCGTGGTTTTTTCCCCATTGGG + Intergenic
951782445 3:26379397-26379419 AGAGTGGTATTTTATCCACTTGG - Intergenic
951819543 3:26792589-26792611 CTATTGGCTTTTTAGCCACTGGG + Intergenic
951860751 3:27249653-27249675 GTCTTAGTTTTTTGTCCACTGGG + Intronic
956926740 3:73997020-73997042 CCAGTTGTTTTATATCCACTTGG - Intergenic
958722204 3:97857751-97857773 GTTCTGTTTTTTTATCCATTCGG + Intronic
958980816 3:100717595-100717617 GTAGAGGTTTTTCATCTTCTTGG + Intronic
959448905 3:106474293-106474315 GTGGTGATTTTATTTCCACTGGG + Intergenic
961026388 3:123561736-123561758 GTTGTGGTTTTTTATTCATGTGG - Intronic
964459843 3:156912314-156912336 CCAGTGGTTTTCTAGCCACTGGG + Intronic
964645603 3:158955922-158955944 GTATTGGTTTATTGTCCAATTGG + Intergenic
964871939 3:161322275-161322297 GTTGATGTTTTTTATCCATTCGG - Intergenic
967236455 3:187389171-187389193 GTAGAGGTCTTTTATCTCCTTGG - Intergenic
977446148 4:97135561-97135583 GTAGTGATTTTATTTCCTCTGGG - Intergenic
978070962 4:104468644-104468666 GTAGCTGTCTTTTATTCACTAGG + Exonic
978367699 4:107999425-107999447 TTAGTGGCATTTTTTCCACTTGG + Intronic
980847464 4:138341308-138341330 ATGGTGGTTTTTAATCCAATGGG + Intergenic
980923287 4:139109302-139109324 GTAGTGCATTTTTCTCAACTAGG - Intronic
981666101 4:147228721-147228743 ATTGTGCATTTTTATCCACTGGG + Intergenic
981966699 4:150612420-150612442 GTATGTGCTTTTTATCCACTGGG + Intronic
985290804 4:188385051-188385073 GTAGAGGTCTTTTATCTCCTTGG + Intergenic
988899607 5:35718155-35718177 GTAGAGTTTTTTTAACCAGTTGG - Intronic
989289379 5:39745271-39745293 GTGGTGCTTTATTATCCAATGGG - Intergenic
990841491 5:60084790-60084812 GTAGTAATTATTTATCCACCAGG - Intronic
991479657 5:67063733-67063755 GTTGTGTTTGTGTATCCACTGGG + Intronic
992435714 5:76754352-76754374 GTTATGCTTTGTTATCCACTAGG + Intergenic
993461478 5:88188671-88188693 GAAGAGGTTTTTTATCCAGCTGG + Intergenic
993743625 5:91568951-91568973 GTAGAGGTCTTTTACCCCCTTGG - Intergenic
997231414 5:132246335-132246357 GTTGTTGTTTTTAATCCACTAGG - Intronic
998056078 5:139078638-139078660 GTAGTGGTTTTTTATCCACTGGG - Intronic
999346219 5:150821727-150821749 GTAGTCCTTTCTTATCCACAGGG + Intergenic
1000577373 5:162990895-162990917 ATAGTAGTTTTTTATTTACTGGG + Intergenic
1002160271 5:177310764-177310786 GTAGTGGCTCTTGAGCCACTGGG - Intronic
1003629506 6:7773908-7773930 ATAATGGCATTTTATCCACTTGG + Intronic
1004269000 6:14177181-14177203 GTACTGGGTTGTTATCCACGTGG + Intergenic
1004529832 6:16443546-16443568 GTATTGGTTTTTAGTCCACTGGG - Intronic
1005056736 6:21736476-21736498 TTAGTGGTTTTTTAAAAACTTGG + Intergenic
1005576708 6:27196512-27196534 GCAGTGGTTTTTTGGCTACTTGG + Intergenic
1008814453 6:55547443-55547465 GTACTGCTTTTTTTTCCCCTAGG + Intronic
1009441924 6:63690366-63690388 GTAGTGGTTTTATACACAATAGG + Intronic
1009621441 6:66083303-66083325 GTCTTGCTTCTTTATCCACTTGG + Intergenic
1010633204 6:78225554-78225576 ATAATGGTTTCTTTTCCACTGGG + Intergenic
1011374297 6:86673563-86673585 GAAATGGTTTTTTCTCCAATAGG - Intergenic
1013877893 6:114856231-114856253 GTAGTGGTCTTTTGCCCCCTTGG - Intergenic
1018353316 6:162986003-162986025 GTAGAGGTTTTTTATATCCTTGG - Intronic
1024127394 7:46314183-46314205 GTAGAGGTTTTTCATCTCCTTGG + Intergenic
1024502659 7:50129194-50129216 GTACTTGTTTTTTCTCCCCTAGG - Intronic
1025791558 7:64692343-64692365 GTAGTGGTTTCTGTTCCATTGGG + Intronic
1026030407 7:66788142-66788164 GTAGTGCTTTTTAATAAACTTGG + Intronic
1028022582 7:85794784-85794806 GTCTTGCTTTTTTATCCATTTGG - Intergenic
1028225645 7:88249642-88249664 GTCTTGTTTTTTTATCCATTGGG + Intergenic
1028307244 7:89281257-89281279 CTATTGGTTTTTTCTCCCCTGGG - Intronic
1028556562 7:92132473-92132495 GTATTGGGTTTTTTTCCCCTGGG + Intronic
1032425296 7:131817949-131817971 GTATTTGTTTTTTATCCAGTTGG + Intergenic
1040966911 8:53091798-53091820 GTAGAGGTTTTTCACCTACTTGG + Intergenic
1042086314 8:65113069-65113091 GTAGTTTTTATTTATCCAATAGG - Intergenic
1044674354 8:94714870-94714892 GTAGAGATTTTTGATCAACTTGG - Intergenic
1045806157 8:106164653-106164675 GTAGTGGTGTTTTATATCCTGGG - Intergenic
1048164132 8:132047147-132047169 GTGGTGGTTTTGTCTCCACTAGG - Intronic
1048725163 8:137375016-137375038 GTAGTGGGATTTTTTCTACTGGG - Intergenic
1053636275 9:40008227-40008249 GTAGTGGTCTTTGACCCCCTTGG - Intergenic
1053769717 9:41456421-41456443 GTAGTGGTCTTTGACCCCCTTGG + Intergenic
1054548385 9:66367900-66367922 GTAGTGGTCTTTGACCCCCTTGG + Intergenic
1057537178 9:95922733-95922755 GTAATGGTATTTAATCTACTGGG + Intronic
1057689419 9:97270322-97270344 GTAGAGGTTTTTCACCTACTTGG + Intergenic
1059466356 9:114471174-114471196 GTAGTGGTGTTATTTTCACTGGG - Intronic
1061140693 9:128764467-128764489 GTGGTGGTGTTTCTTCCACTTGG - Intronic
1186213075 X:7270645-7270667 GCAGTGGTTTTTTATTCTATAGG - Intronic
1188527642 X:31103616-31103638 TTAGTGGAATTATATCCACTGGG + Intronic
1201586007 Y:15561939-15561961 GCAGTGGTTTTTCATCCTATAGG - Intergenic