ID: 998056079

View in Genome Browser
Species Human (GRCh38)
Location 5:139078639-139078661
Sequence GGTAGTGGTTTTTTATCCAC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 126
Summary {0: 1, 1: 0, 2: 0, 3: 11, 4: 114}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
998056079_998056085 19 Left 998056079 5:139078639-139078661 CCAGTGGATAAAAAACCACTACC 0: 1
1: 0
2: 0
3: 11
4: 114
Right 998056085 5:139078681-139078703 CCAGGCACGAGGCAGAGACCTGG 0: 1
1: 0
2: 5
3: 39
4: 374
998056079_998056082 1 Left 998056079 5:139078639-139078661 CCAGTGGATAAAAAACCACTACC 0: 1
1: 0
2: 0
3: 11
4: 114
Right 998056082 5:139078663-139078685 CACTGCACACATCAAATGCCAGG No data
998056079_998056083 8 Left 998056079 5:139078639-139078661 CCAGTGGATAAAAAACCACTACC 0: 1
1: 0
2: 0
3: 11
4: 114
Right 998056083 5:139078670-139078692 CACATCAAATGCCAGGCACGAGG 0: 1
1: 0
2: 1
3: 12
4: 170

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
998056079 Original CRISPR GGTAGTGGTTTTTTATCCAC TGG (reversed) Intronic
900172097 1:1274125-1274147 GGTCGGGGTTCTTTCTCCACCGG - Intergenic
903607101 1:24583020-24583042 GTTATTGGTTGTTTATCCACAGG + Intronic
907604458 1:55802979-55803001 TTTAGTGCTTATTTATCCACAGG + Intergenic
908666546 1:66497652-66497674 GGATGTTGTTTATTATCCACAGG - Intergenic
909802595 1:79830871-79830893 CGTAGAGGTTCTTTATCCTCTGG - Intergenic
910182304 1:84498359-84498381 GGTAATTGTTTTATATACACTGG - Exonic
911689587 1:100817664-100817686 AGTACTGGTTATCTATCCACAGG + Intergenic
917592584 1:176491994-176492016 GCTTGTGGTTTTATGTCCACAGG + Intronic
918883609 1:190160231-190160253 GTTTGTGGTTTTCTATACACTGG + Intronic
919196298 1:194290885-194290907 GTTAGTGGTTTTCTTTCAACAGG + Intergenic
919271877 1:195359045-195359067 TTTAGTGTTTTTTTATCCTCAGG - Intergenic
921525269 1:216209746-216209768 AGTATTGGTCTTTTATCCAAGGG + Intronic
923925437 1:238621727-238621749 GGTTGTGGGTTAATATCCACTGG - Intergenic
1063476840 10:6336287-6336309 GGGAGGGGTATTTTCTCCACTGG - Intergenic
1066570671 10:36768227-36768249 GGTAGTGTTTTTTATTCCAGTGG + Intergenic
1066927795 10:41719550-41719572 GATATTTGTATTTTATCCACAGG - Intergenic
1068387340 10:56348699-56348721 GGAAGTGGTTTTTTAAACGCAGG - Intergenic
1068977552 10:63026217-63026239 GGTAGTGCTTATTTCTCCAAAGG - Intergenic
1071700867 10:87933892-87933914 GGTAATGGTATTTTATCCAAAGG - Intronic
1072776516 10:98201939-98201961 TGTAGTGGTTGTTCATCCACAGG + Intronic
1075091321 10:119445569-119445591 GACAGTGGTTTTGTACCCACGGG - Intronic
1081017181 11:37897013-37897035 GATAGTTGGTTTTTATCCAAAGG + Intergenic
1083165196 11:60880572-60880594 GGTAGTGGTTTTCTCTGCAGGGG + Intergenic
1083492313 11:63022085-63022107 GGTAGTCCTTTTATCTCCACTGG + Intergenic
1086699409 11:89883063-89883085 GGTACTTGATTTTTTTCCACTGG - Intergenic
1086706762 11:89961451-89961473 GGTACTTGATTTTTTTCCACTGG + Intergenic
1095225853 12:39675657-39675679 GGTTGTAGTTTTTAATGCACTGG - Intronic
1107525135 13:41222955-41222977 GGTATTGGTTTTCTATTGACAGG - Intronic
1108087756 13:46812651-46812673 GGTAGTGAGTTTTTATCAGCAGG + Intergenic
1108506673 13:51118579-51118601 GGTGGTGGTTTTTTTTACACAGG + Intergenic
1111536048 13:89604692-89604714 GGTGGTGGTTTTTTATCTGGTGG + Intergenic
1115438070 14:33399537-33399559 TGCAGTGGTCTTCTATCCACAGG - Intronic
1116108085 14:40537484-40537506 GCTAGTTTTATTTTATCCACAGG - Intergenic
1116249305 14:42459555-42459577 GGTGGTAGTTTTTTACCCAGTGG - Intergenic
1116638468 14:47429409-47429431 GGTAATGGTTTTGTATCTTCTGG + Intronic
1116661115 14:47711346-47711368 GGTTGTGGTGTTTTATCTAGTGG - Intergenic
1120455587 14:84725977-84725999 GGCAATGGTTTTTTAACCACTGG + Intergenic
1124514064 15:30351203-30351225 TGTAGTGCCTTCTTATCCACAGG + Intergenic
1124728856 15:32179561-32179583 TGTAGTGCCTTCTTATCCACAGG - Intergenic
1127543831 15:59970515-59970537 GCTAGTGGATTTTGATCCAAGGG + Intergenic
1132162757 15:99557929-99557951 GGGGGTGGTTTTTAAACCACTGG - Intergenic
1132787959 16:1668591-1668613 GGCAGTGGTTTGTTGTTCACTGG + Intronic
1133674174 16:8054251-8054273 GCAAATGGTTTTTTTTCCACTGG - Intergenic
1134886673 16:17799267-17799289 GGGTGTGGTCTTTTATACACAGG + Intergenic
1135753731 16:25078914-25078936 GGTACTGGTTTTTTGACCAAGGG + Intergenic
1143238075 17:5420077-5420099 GGAAGTGTTGTTTTATCGACCGG - Exonic
1150031883 17:61747134-61747156 TGTTGTGGTTTTTTTTCCACTGG - Intronic
1158586406 18:58740001-58740023 GGTAGAAGATTTTTAACCACTGG + Intronic
926655385 2:15398662-15398684 GGTAGTTGTTATTTATCAAGTGG - Intronic
928168779 2:28990123-28990145 GGTAGCTGTTTCTTGTCCACAGG + Intronic
928293362 2:30059740-30059762 TGTAGTGGTTTTTAATACATTGG + Intergenic
930698151 2:54432292-54432314 GGTAGGGGTTTTGTAATCACAGG - Intergenic
930882397 2:56286981-56287003 GGGAGTGGTGTTTTCTCCAAGGG + Intronic
931657870 2:64526030-64526052 TGTAGTGGATTTTTTTCCAGAGG - Intronic
932638712 2:73418854-73418876 GGTAATTGTTTTATATACACTGG + Intronic
933623289 2:84569637-84569659 TATGGTGGTTTTTCATCCACAGG - Intronic
934505502 2:94889409-94889431 GGTAGTGGCTTTATAGTCACTGG - Intergenic
937857975 2:126686457-126686479 GGGAGTGGCTTTTCATCCATGGG - Intronic
938545332 2:132324127-132324149 GGCAGTGGTTTTATTCCCACGGG + Intergenic
938547005 2:132343161-132343183 GGTAGTGGTTTCTTTTCCTGGGG - Intergenic
938978507 2:136503279-136503301 TGATGTGGTTTTCTATCCACAGG + Intergenic
940660636 2:156540725-156540747 GGGAATGGTTTTTAATCCAGAGG - Intronic
943982575 2:194573197-194573219 CGTAGAGGCTTTTTATCCATTGG - Intergenic
948678874 2:239617921-239617943 GGTAGTGGGTCTTTTTCCTCTGG + Intergenic
1171874183 20:30556886-30556908 GGCAGTGGTTTTATTCCCACAGG + Intergenic
1183771094 22:39926699-39926721 GGGATTGGTTTTTTTTCCACTGG + Intronic
950727385 3:14925562-14925584 GGTAGTAGTATTCTGTCCACAGG - Intronic
951754415 3:26074419-26074441 GGTAGTTGTGTTATAGCCACAGG - Intergenic
952914329 3:38221586-38221608 GTTAGTGCTTTTTTAGCAACTGG + Exonic
957330945 3:78762878-78762900 GGTTGTGGTTTTTTGTTCACTGG - Intronic
961230040 3:125297526-125297548 TGTAGTAGTTCTTTATCCACTGG - Intronic
963703011 3:148650038-148650060 GGTAGTTGTGTTTTATGCAATGG + Intergenic
965570214 3:170164998-170165020 GGTGGTGGTTTATTATCACCTGG - Intronic
970782384 4:19753719-19753741 GGTGGTGGTTTCTTATTCTCGGG - Intergenic
971954133 4:33394154-33394176 GGTACTGATTTTATTTCCACTGG - Intergenic
973285040 4:48405630-48405652 AGTAGTGCTTCTTTATCCAAAGG + Intronic
977009446 4:91618224-91618246 GGTACTGGATATTTATCCAAAGG + Intergenic
977446149 4:97135562-97135584 GGTAGTGATTTTATTTCCTCTGG - Intergenic
977628212 4:99211924-99211946 GGAAGTGGATTTTTCTCCAGAGG + Intronic
981155354 4:141428453-141428475 GGTAGTGGTTATTTAACAACAGG + Intergenic
981666100 4:147228720-147228742 GATTGTGCATTTTTATCCACTGG + Intergenic
981966698 4:150612419-150612441 GGTATGTGCTTTTTATCCACTGG + Intronic
983327701 4:166279392-166279414 GGAAGTGGTTTGGTATCCAGTGG + Intergenic
988676618 5:33439899-33439921 TGTAGTGGCTTTTTTTCCTCAGG - Intergenic
989782680 5:45288207-45288229 GGCAGTTATTTTTTAACCACCGG + Intronic
993835475 5:92814743-92814765 GGTAGTGGTTGTTATTCCATGGG - Intergenic
998056079 5:139078639-139078661 GGTAGTGGTTTTTTATCCACTGG - Intronic
998128907 5:139641320-139641342 GGGAGGGGTTTTTTTTCCTCAGG - Intergenic
999346218 5:150821726-150821748 AGTAGTCCTTTCTTATCCACAGG + Intergenic
999352503 5:150888004-150888026 GGTCTTGCTTTTTTATCCAGCGG - Intronic
999849287 5:155520741-155520763 GGTCGTGGGTTTTTCTCTACTGG + Intergenic
1000937517 5:167321016-167321038 AGTAGTGGCTTTTTATCCTAAGG - Intronic
1001105114 5:168846513-168846535 GGTAGAGGTTGTTGATTCACCGG - Intronic
1001269691 5:170302048-170302070 GGTACTGCTTTCTTGTCCACAGG - Intergenic
1004264900 6:14140639-14140661 GGTAGTGTTTTATTAGCTACGGG - Intergenic
1004529833 6:16443547-16443569 TGTATTGGTTTTTAGTCCACTGG - Intronic
1005438803 6:25842804-25842826 GCTTGTGGTTTTCCATCCACAGG + Intronic
1008764066 6:54889425-54889447 GGTAGTGTTATTTTAAACACAGG - Intronic
1011194780 6:84769444-84769466 GGCAGCGGTTTTTCACCCACGGG - Intergenic
1011799324 6:90993167-90993189 GGTAGTGGTATTTTTTACACAGG - Intergenic
1011830308 6:91363839-91363861 GGTAGTGGGTTTTTACCTGCTGG - Intergenic
1015413435 6:132920941-132920963 GGTGTTGGTTTTTTCTTCACAGG - Intergenic
1018678005 6:166239958-166239980 GGTAATTGTTTTATATACACTGG - Intergenic
1027247162 7:76375025-76375047 TGTAATTTTTTTTTATCCACTGG + Intergenic
1028225644 7:88249641-88249663 GGTCTTGTTTTTTTATCCATTGG + Intergenic
1028307245 7:89281258-89281280 GCTATTGGTTTTTTCTCCCCTGG - Intronic
1032638162 7:133734148-133734170 GTAAGTTGTTTGTTATCCACAGG + Intronic
1033279417 7:139995239-139995261 GGAATTTATTTTTTATCCACTGG - Intronic
1040897208 8:52381196-52381218 GGTACTGGTTTTTAGTCCGCAGG - Intronic
1041389888 8:57338844-57338866 GGTTGTGGTTTTATACTCACTGG + Intergenic
1041737035 8:61122012-61122034 GGTGGTGGTGTTTAATCTACAGG - Intronic
1042093960 8:65191358-65191380 GATCGTTGTGTTTTATCCACTGG + Intergenic
1045806158 8:106164654-106164676 GGTAGTGGTGTTTTATATCCTGG - Intergenic
1048245648 8:132795662-132795684 GGTAGTCCTTCCTTATCCACGGG + Intronic
1048546082 8:135388563-135388585 TTTAGTAATTTTTTATCCACTGG - Intergenic
1050845294 9:10209078-10209100 GTTCGTGATTTTTTTTCCACTGG + Intronic
1052555121 9:30002994-30003016 GGTAGTGGGTTTTTACCAAAAGG + Intergenic
1055832570 9:80399094-80399116 GTTAGTTTTTTTTTAACCACAGG - Intergenic
1059345065 9:113622699-113622721 GTTATTGGTTTTTCATCCAAAGG - Intergenic
1060337137 9:122735886-122735908 GCTACTGGTTATATATCCACAGG + Intergenic
1186871059 X:13773424-13773446 GGGAATTGATTTTTATCCACAGG - Intronic
1189867165 X:45342856-45342878 GGAAGTGGATTTTTCTCCAGTGG + Intergenic
1191777936 X:64838085-64838107 AGTATTGGTTATTTATCCAAAGG - Intergenic
1196541396 X:116912624-116912646 CATAGTTGTTTTTTCTCCACAGG + Intergenic
1197062603 X:122199326-122199348 GGTTGTGCTTTTTTATCTAGTGG + Intergenic
1197562590 X:128042151-128042173 GTTAGTGGTTTTATACCCAAAGG - Intergenic