ID: 998056082

View in Genome Browser
Species Human (GRCh38)
Location 5:139078663-139078685
Sequence CACTGCACACATCAAATGCC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
998056079_998056082 1 Left 998056079 5:139078639-139078661 CCAGTGGATAAAAAACCACTACC 0: 1
1: 0
2: 0
3: 11
4: 114
Right 998056082 5:139078663-139078685 CACTGCACACATCAAATGCCAGG No data
998056074_998056082 25 Left 998056074 5:139078615-139078637 CCTGCATGTCAACTCTTCCCGAT 0: 1
1: 0
2: 0
3: 4
4: 70
Right 998056082 5:139078663-139078685 CACTGCACACATCAAATGCCAGG No data
998056078_998056082 2 Left 998056078 5:139078638-139078660 CCCAGTGGATAAAAAACCACTAC 0: 1
1: 0
2: 0
3: 7
4: 148
Right 998056082 5:139078663-139078685 CACTGCACACATCAAATGCCAGG No data
998056076_998056082 8 Left 998056076 5:139078632-139078654 CCCGATCCCAGTGGATAAAAAAC 0: 1
1: 0
2: 1
3: 10
4: 144
Right 998056082 5:139078663-139078685 CACTGCACACATCAAATGCCAGG No data
998056077_998056082 7 Left 998056077 5:139078633-139078655 CCGATCCCAGTGGATAAAAAACC 0: 1
1: 0
2: 1
3: 9
4: 133
Right 998056082 5:139078663-139078685 CACTGCACACATCAAATGCCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
998056082 Original CRISPR CACTGCACACATCAAATGCC AGG Intronic
No off target data available for this crispr