ID: 998056258

View in Genome Browser
Species Human (GRCh38)
Location 5:139080577-139080599
Sequence TAGACCCTGAACAAAATTTG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 175
Summary {0: 1, 1: 0, 2: 0, 3: 11, 4: 163}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
998056258 Original CRISPR TAGACCCTGAACAAAATTTG AGG (reversed) Intronic
903051437 1:20604153-20604175 TTGAGCCTGGACAAAATTTTGGG - Intronic
903118005 1:21193975-21193997 TATACACTGAACCCAATTTGTGG + Intergenic
903500922 1:23799861-23799883 TCCACCCTGAACAAACTCTGCGG + Intronic
904833521 1:33320558-33320580 TAGAACCTGAACAAGAAATGTGG - Intronic
906342167 1:44989908-44989930 TAGACCCTGAAAAAAAAAGGGGG + Intergenic
909252754 1:73379885-73379907 GAGAGCCTGATCAAAATTTAGGG + Intergenic
910394287 1:86776369-86776391 TAAACCATGACCAAAATTTAAGG - Intergenic
914389790 1:147209482-147209504 TAGCCCCTGCACAATCTTTGTGG + Intronic
914733624 1:150395112-150395134 TATACACTGAACCCAATTTGTGG + Intronic
915006363 1:152640916-152640938 TAGACTCTGAACCAAACTTCTGG - Intergenic
918544396 1:185665885-185665907 TAAACCATGCACCAAATTTGAGG + Intergenic
918660154 1:187078311-187078333 GAGAGGCTGAACAAAATTAGTGG + Intergenic
921510334 1:216020794-216020816 AAGCCCCTAAACAGAATTTGAGG + Intronic
921512014 1:216043599-216043621 TAGGCCCTGAAGAAAGATTGTGG - Intronic
921548568 1:216504242-216504264 TAAACCCTGCACAAACTTTCTGG + Exonic
924657947 1:245990466-245990488 TCGACCTTGAATAAAATTTCTGG + Intronic
924685468 1:246285074-246285096 TATACACTGAACCGAATTTGTGG + Intronic
1063561537 10:7132726-7132748 TTGACCCTGAGCAAAATCTTTGG - Intergenic
1064862659 10:19844956-19844978 TAGATCCTGAACCAAAACTGGGG - Intronic
1066333708 10:34454205-34454227 TAGACGGTGAACTAGATTTGTGG - Intronic
1066439823 10:35427865-35427887 TAGATCCAGAACAGAACTTGAGG - Intronic
1068931053 10:62590723-62590745 TAGACCCTGAACTGAACTGGAGG - Intronic
1073939193 10:108674707-108674729 GAGACACTGAAGTAAATTTGTGG - Intergenic
1077800705 11:5533242-5533264 TACACCCTAAACACAGTTTGGGG - Intronic
1078034781 11:7791988-7792010 TACTCCCTTAACAAATTTTGTGG - Intergenic
1079723996 11:23856454-23856476 TAGAAAATGAACAAAATTTGGGG - Intergenic
1082083026 11:48026806-48026828 TATACACTGAACCCAATTTGTGG + Intronic
1082793753 11:57365369-57365391 CAGAACCTGAACAAAAGCTGAGG + Intronic
1084782584 11:71420202-71420224 TGGACCCTGAACTGAATTTCGGG + Intergenic
1085654722 11:78303076-78303098 TATACACTGAACCCAATTTGTGG - Intronic
1086179264 11:83930865-83930887 TAGACCATGAAGCAAACTTGAGG + Intronic
1095300399 12:40577997-40578019 TAGAGCCTGAACCTAATTTTTGG + Intergenic
1095680908 12:44974425-44974447 TATACGCTGAACCCAATTTGCGG + Intergenic
1097450303 12:59730089-59730111 TAGATCCTGAACTAATTTTTGGG - Intronic
1099492721 12:83306778-83306800 TTGCCCCTGCCCAAAATTTGTGG + Intergenic
1103379274 12:120481325-120481347 CAGACCCTGAACAAAAGTTAAGG + Intronic
1104243994 12:127019293-127019315 TATACACTGCACCAAATTTGTGG - Intergenic
1104244048 12:127020111-127020133 TATACACTGCACCAAATTTGTGG + Intergenic
1104667125 12:130655611-130655633 TAGACACAGAAAAAAATGTGTGG + Intronic
1106741672 13:32650197-32650219 TGGACCTTGAACAAACTTTGTGG + Intronic
1107116541 13:36753264-36753286 TAGACCCAGAACATAATGAGGGG + Intergenic
1107235683 13:38166870-38166892 TAGCCCCTGAAAAGAATTTGGGG - Intergenic
1110908478 13:80923104-80923126 AAGACCCTGAAGAAAAGCTGAGG - Intergenic
1112672274 13:101654054-101654076 AAGACAGTGAACAAAATTTGGGG + Intronic
1116291111 14:43041806-43041828 TAGTACCTGAACAAATATTGTGG - Intergenic
1117205837 14:53442896-53442918 TTGACCCTGAGGAAAATTTGGGG + Intergenic
1118519208 14:66562457-66562479 TTGTACCTTAACAAAATTTGGGG + Intronic
1119344258 14:73909252-73909274 TAGACTCTGAATAAAGTTGGTGG + Intronic
1119488597 14:75010065-75010087 TAGACTATGAACAAACTTTGGGG - Exonic
1120146519 14:80984800-80984822 TACTCACTGAACAAAGTTTGGGG - Intronic
1121038016 14:90722677-90722699 GTGACCCTGAACAAACTTGGTGG - Intronic
1202877470 14_KI270722v1_random:18644-18666 TTGATCCTGAACACAATTTCAGG - Intergenic
1123454354 15:20406055-20406077 AATACCCTCAACACAATTTGAGG - Intergenic
1126086232 15:45013389-45013411 TGGGCCCTGAACAAAATCTGAGG + Intergenic
1131189569 15:90303126-90303148 TAGAACCTGAAAAATATTTAAGG - Intronic
1133952446 16:10407749-10407771 TATACACTGAACCCAATTTGTGG + Intronic
1134288624 16:12884284-12884306 TATACACTGAACCCAATTTGTGG - Intergenic
1138475298 16:57267220-57267242 TAGAACTTGAACATATTTTGGGG - Intronic
1138766938 16:59616385-59616407 TAGACCCAGAAAAAAATATCAGG + Intergenic
1138967417 16:62101492-62101514 TAGATGCTTAATAAAATTTGTGG - Intergenic
1140999345 16:80293894-80293916 TACACACTGAAAATAATTTGGGG - Intergenic
1144657406 17:17045531-17045553 TAGACCCTGAACAGGAGTAGGGG - Intronic
1145859173 17:28193049-28193071 TAGACCCTGATCAATATATAAGG - Intronic
1146247637 17:31303669-31303691 TTTACCCTGAAAAAAATATGAGG - Intronic
1148401471 17:47365869-47365891 AATACCTTGACCAAAATTTGAGG - Intronic
1148941748 17:51220165-51220187 TATAGGCTGAACAAACTTTGGGG + Intronic
1154400639 18:14033529-14033551 TGGGCCTTGAACCAAATTTGGGG - Intergenic
1154944275 18:21146360-21146382 TACACCCTGCACATAATTTTTGG + Intergenic
1161372318 19:3919874-3919896 TAGACCCTGAGCAACATTATTGG + Intronic
1166235366 19:41451830-41451852 TATACACTGAACCCAATTTGTGG - Intergenic
1167358753 19:49018995-49019017 TAGAGCCTGAGCAAGATTGGGGG + Intergenic
1167366445 19:49057243-49057265 TAGAGCCTGAGCAAGATTGGGGG + Exonic
925340904 2:3135187-3135209 TAAACACTGAACCCAATTTGTGG + Intergenic
926480942 2:13393081-13393103 AATACCCTCAACACAATTTGAGG + Intergenic
927466653 2:23341749-23341771 TAGACTCTGAATCACATTTGAGG + Intergenic
928195242 2:29211352-29211374 TAGACCAGGAACAATATTTATGG + Intronic
930583069 2:53235572-53235594 TAGACACTAAACAAGATGTGAGG - Intergenic
931432474 2:62219235-62219257 TAGACCTTTACCAAAATTTCTGG - Intronic
932799532 2:74728069-74728091 TAGAACCTGCACTAAATCTGTGG + Intergenic
935103389 2:100017599-100017621 TAGACCCAGAAAATTATTTGGGG - Intronic
936824478 2:116564402-116564424 TAGACCCTGGACACTATTTTTGG + Intergenic
937749146 2:125453596-125453618 TAGATCCTGAATCATATTTGAGG - Intergenic
940467835 2:154054919-154054941 TAGACACTGAACAAGTTGTGTGG - Intronic
940620604 2:156108428-156108450 TAATCCATGAGCAAAATTTGTGG - Intergenic
940784104 2:157963836-157963858 TATACACTGTACACAATTTGTGG + Intronic
941110056 2:161411345-161411367 TAAACACTGGACAATATTTGAGG - Exonic
945256386 2:207806972-207806994 TATACACTGAACCCAATTTGTGG + Intergenic
945579975 2:211581149-211581171 TATACACTGCACCAAATTTGTGG - Intronic
948065165 2:235072830-235072852 TATACACTGCACACAATTTGTGG - Intergenic
1169828443 20:9795586-9795608 TAGATGTTGAATAAAATTTGTGG + Intronic
1169845586 20:9987995-9988017 TAGACCCTGTACATATGTTGTGG - Intronic
1170917968 20:20646685-20646707 TAGATTCTGAAAAAAATTTAAGG + Intronic
1177663440 21:24119379-24119401 TAGACCATGAAAAGAATTTTGGG + Intergenic
1177731355 21:25030950-25030972 TAGAAGCTGAGCCAAATTTGCGG + Intergenic
1178260080 21:31091133-31091155 GACACCCTGAATAAAAATTGAGG + Intergenic
1178630232 21:34253198-34253220 TAGAGCCAGAACAAATTTTATGG + Intergenic
1183340657 22:37279096-37279118 TGGACCATGAAGAGAATTTGAGG + Intergenic
953821482 3:46210852-46210874 TAAAGCCTGAGCAAGATTTGAGG + Intronic
954417915 3:50403091-50403113 TTGACCCAGCACATAATTTGGGG + Intronic
955730527 3:61980910-61980932 CAGGCTCTGAACAAAATTTTGGG + Intronic
957419128 3:79945642-79945664 TATACACTGAACCCAATTTGTGG - Intergenic
958597223 3:96242480-96242502 TAGTCCCTGAATCAAACTTGTGG - Intergenic
959360749 3:105388136-105388158 TTAACACTGAACAAAATTTTTGG + Intronic
961068516 3:123898081-123898103 TAGTCCCTCCACACAATTTGAGG - Intronic
962194980 3:133353783-133353805 GAGAGCCTGAACAAAGATTGGGG - Intronic
963383788 3:144565092-144565114 TTTACCCTGAATAAAATTTGAGG + Intergenic
964006244 3:151832783-151832805 TAACCCCTGAACAAAACTGGCGG - Intergenic
964086950 3:152830590-152830612 TAGTGCCTGAACAGTATTTGGGG - Intergenic
964287133 3:155130491-155130513 TAGAGCCTTCACAAAATCTGAGG + Intronic
971616099 4:28792249-28792271 TAGATGCTGCATAAAATTTGTGG - Intergenic
973090271 4:46126922-46126944 TGATCCCTGAACAAATTTTGGGG - Intergenic
980818485 4:137980543-137980565 TAGATTCTGAAGAAAATATGTGG + Intergenic
981075163 4:140583773-140583795 CAGACTTTGAACAAAATTTAAGG + Intergenic
981172440 4:141640498-141640520 TAGACCCTGGTCACCATTTGGGG + Intronic
982286492 4:153741398-153741420 TAAAACCTAAACAAAATGTGGGG + Intronic
983540483 4:168904120-168904142 TAGACCCTTAATAATATTTGTGG - Intronic
984665929 4:182429734-182429756 TGGTACCTGAACCAAATTTGTGG - Intronic
986223494 5:5791685-5791707 TACACCCTGAATAAACTCTGAGG + Intergenic
986867132 5:12002741-12002763 TAAAACATGAACAAATTTTGAGG + Intergenic
989432797 5:41375203-41375225 TAGGCCCAGCACAAAATCTGTGG + Intronic
992816413 5:80444839-80444861 TAGAGACTGAATAAAATTTAGGG - Intronic
992846989 5:80760499-80760521 TTGACCCTGACCAAAGATTGGGG - Intronic
993417704 5:87655973-87655995 TAGAGCCTGAATAAATTTGGGGG + Intergenic
994559057 5:101344586-101344608 TAGAAGCTGGAAAAAATTTGAGG + Intergenic
995056280 5:107762730-107762752 TAGGCCATGTACAAACTTTGGGG - Intergenic
995095287 5:108228757-108228779 GAGATCCTGATCATAATTTGGGG + Intronic
997811789 5:136977864-136977886 CAGACCTGGAACAAAATTTCTGG - Exonic
998056258 5:139080577-139080599 TAGACCCTGAACAAAATTTGAGG - Intronic
998733556 5:145108651-145108673 AAGACACTGAACAAAGTTAGTGG - Intergenic
999471565 5:151859320-151859342 TAGACCCAGTGCAAAGTTTGGGG + Intronic
1000230025 5:159307192-159307214 TAGCATCTGAACCAAATTTGGGG - Intergenic
1001249626 5:170136760-170136782 AAGACCATGATCAAAATTTTTGG - Intergenic
1004449440 6:15731196-15731218 AAGAACCTGAACAAAGGTTGAGG + Intergenic
1010840731 6:80646896-80646918 TATACACTGAACCCAATTTGTGG - Intergenic
1011324899 6:86139785-86139807 TATACACTGAACCCAATTTGTGG - Intergenic
1012328592 6:97956277-97956299 AAGAACATGAACAACATTTGAGG - Intergenic
1013659989 6:112285639-112285661 TAAAACCTGAAATAAATTTGTGG - Intergenic
1015663779 6:135604173-135604195 TAGAAGCTGAACACACTTTGGGG + Intergenic
1016178662 6:141114755-141114777 TAGACTTTGAACAAAATATTAGG + Intergenic
1017332623 6:153217431-153217453 TAGTTTCTGGACAAAATTTGGGG + Intergenic
1020374939 7:7474323-7474345 TATACACTGAACCCAATTTGTGG - Intronic
1020700193 7:11472253-11472275 TTGACCTTGAATAAGATTTGGGG - Intronic
1021066353 7:16178912-16178934 TAGAGCCTCAACCAAATTTATGG - Intronic
1021090864 7:16481156-16481178 TGGACCCTGGATATAATTTGAGG - Intronic
1021562975 7:21987196-21987218 GAGAGCCTGAGCAGAATTTGGGG - Intergenic
1021852247 7:24819775-24819797 TATAAACTGAACAAAATTTTAGG + Intronic
1023047748 7:36225779-36225801 TGAACCCTCTACAAAATTTGGGG + Intronic
1023071309 7:36437329-36437351 TACAACATGAACAAACTTTGAGG - Intronic
1023690603 7:42782479-42782501 TAGACCCAGAAAAAAATTTAAGG - Intergenic
1024065589 7:45730686-45730708 TAGAGCCTAAAAAAGATTTGTGG - Intergenic
1030068917 7:105681728-105681750 TACAACCTGGACAAACTTTGGGG + Intronic
1030965257 7:115984782-115984804 TAGACCCTCAAAAAATATTGTGG - Intronic
1031145369 7:117991838-117991860 TAGGCCATGACCAAAGTTTGAGG - Intergenic
1031431718 7:121679034-121679056 TTGACCCTAAACAGATTTTGTGG - Intergenic
1033706222 7:143887010-143887032 TAGAACCAGCTCAAAATTTGAGG - Intronic
1034400621 7:150859190-150859212 TTGACCCTGAACAATATGGGGGG + Intronic
1038320650 8:26523611-26523633 TACAACATGAACAAACTTTGAGG - Intronic
1039743541 8:40403529-40403551 TAGAACATGAAGAAGATTTGGGG - Intergenic
1043774521 8:84248260-84248282 TACAGCCTGAACAACATTTCAGG + Intronic
1044286892 8:90420184-90420206 CAGACCCTGAAAACATTTTGGGG - Intergenic
1045413473 8:101943515-101943537 CAGACCCTGAACACAATATCTGG + Intronic
1046541356 8:115587422-115587444 TAGACCCTGAAGTCAATTTTGGG + Exonic
1051327123 9:15984153-15984175 TGGACCCTGGACCAAATGTGAGG + Intronic
1052549430 9:29929175-29929197 TAAACCCTGGCCAAATTTTGAGG + Intergenic
1186042002 X:5490725-5490747 TAAAACCTGAATACAATTTGTGG - Intergenic
1189664356 X:43337510-43337532 TTGACCTTAAACTAAATTTGAGG + Intergenic
1191841813 X:65518620-65518642 TGGACCCAGAACAAACTCTGTGG + Intronic
1196089407 X:111723704-111723726 TAGACACTGAACTCCATTTGGGG + Intronic
1196128522 X:112126125-112126147 TTAACCTTGAACAAAATATGGGG + Intergenic
1196659433 X:118254067-118254089 GAGACCCTTAAGAAATTTTGGGG + Intergenic
1198637804 X:138718672-138718694 CAGACACTGACCAAGATTTGGGG + Intronic
1198894548 X:141438290-141438312 TATACACTGAACCCAATTTGTGG + Intergenic
1199297017 X:146170901-146170923 GAGAGCCTGAACAAGATTGGTGG - Intergenic
1199363904 X:146955881-146955903 TAGAGGCTGAATAAAATATGAGG + Intergenic
1201354336 Y:13082032-13082054 CAAACCCTGAATATAATTTGGGG + Intergenic