ID: 998058670

View in Genome Browser
Species Human (GRCh38)
Location 5:139101703-139101725
Sequence GTGTCTAACCCAGAATCAAA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 160
Summary {0: 1, 1: 0, 2: 0, 3: 13, 4: 146}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
998058670_998058676 17 Left 998058670 5:139101703-139101725 CCATTTGATTCTGGGTTAGACAC 0: 1
1: 0
2: 0
3: 13
4: 146
Right 998058676 5:139101743-139101765 ATAACTGCTTGCTATCAAAGGGG 0: 1
1: 0
2: 2
3: 10
4: 104
998058670_998058674 15 Left 998058670 5:139101703-139101725 CCATTTGATTCTGGGTTAGACAC 0: 1
1: 0
2: 0
3: 13
4: 146
Right 998058674 5:139101741-139101763 CAATAACTGCTTGCTATCAAAGG 0: 1
1: 0
2: 1
3: 11
4: 102
998058670_998058675 16 Left 998058670 5:139101703-139101725 CCATTTGATTCTGGGTTAGACAC 0: 1
1: 0
2: 0
3: 13
4: 146
Right 998058675 5:139101742-139101764 AATAACTGCTTGCTATCAAAGGG 0: 1
1: 0
2: 2
3: 7
4: 183

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
998058670 Original CRISPR GTGTCTAACCCAGAATCAAA TGG (reversed) Intronic
900901825 1:5522152-5522174 AAGTCTAACCTACAATCAAAAGG + Intergenic
902739615 1:18426883-18426905 GTGTAGACCCCAGAATCCAAAGG - Intergenic
904272487 1:29359487-29359509 GTGTCAAACTCAGGGTCAAATGG + Intergenic
904547612 1:31288300-31288322 GTGTCAAAGAGAGAATCAAATGG + Intronic
905311745 1:37053887-37053909 GTTACTTACCCAGAATCACATGG + Intergenic
905316715 1:37086583-37086605 GTGTCTCACCCACACTCAAAGGG - Intergenic
909732165 1:78906386-78906408 GTCTCAAAAACAGAATCAAAAGG + Intronic
909983017 1:82127105-82127127 GTGGATAACCCAAAATTAAATGG + Intergenic
910377068 1:86583934-86583956 AACTCTAACCCAGAATCATATGG + Intergenic
913645961 1:120854020-120854042 GTTTCAAACCAAGAATAAAATGG - Intergenic
914080678 1:144408863-144408885 GTTTCAAACCAAGAATAAAATGG + Intergenic
914175589 1:145277397-145277419 GTTTCAAACCAAGAATAAAATGG + Intergenic
914530310 1:148518866-148518888 GTTTCAAACCAAGAATAAAATGG + Intergenic
920051825 1:203168965-203168987 GTGTAGACCCCAGAATCAAAGGG + Exonic
922510122 1:226158734-226158756 GTGCCTAACACAAAGTCAAATGG + Intronic
922961386 1:229648937-229648959 GTTTCTAGCCCAGAAGCAACAGG - Intronic
924177739 1:241409932-241409954 GTGGCTAATACAGAAGCAAAAGG + Intergenic
1064519052 10:16182107-16182129 GTGTCTAACCCAGCAAACAAAGG - Intergenic
1064805838 10:19130972-19130994 GTGTATTAACCAGAACCAAATGG + Intronic
1066417594 10:35235657-35235679 GTGTAGACTCCAGAATCAAATGG + Intergenic
1069981745 10:72257434-72257456 GTGTTTGACCCAGAATTGAATGG - Intergenic
1075565518 10:123500866-123500888 TTGTCTAAGCCAGAACTAAAAGG - Intergenic
1076414779 10:130277853-130277875 GTGACAAACCCACAATCACAGGG - Intergenic
1078435184 11:11318886-11318908 GTGTCTGAGAGAGAATCAAAAGG - Intronic
1081689209 11:45065185-45065207 ATGGCCATCCCAGAATCAAAGGG - Intergenic
1082669038 11:56010969-56010991 GTGTCAACCCCAGAGTCCAAAGG + Intergenic
1090141975 11:124275119-124275141 GTGTGTAAACCAGAAACATAGGG + Intergenic
1090669967 11:128939215-128939237 GTGTCTTCCCCAGAACCAGATGG - Intronic
1092248454 12:6877260-6877282 GTGTCTGAGCCACAAGCAAATGG + Intronic
1093773354 12:23043089-23043111 GTGTCTAGCACAGAAACAATAGG + Intergenic
1094711617 12:32969160-32969182 GTGTGTAACTCTGAATCAAAAGG - Intergenic
1097789191 12:63796071-63796093 GTTTCCAATCCAGAATCACACGG + Intronic
1098712403 12:73779730-73779752 CTATAAAACCCAGAATCAAAGGG - Intergenic
1101800468 12:108017350-108017372 GTGTGTATCCCAGAAGGAAAAGG + Intergenic
1102045989 12:109830681-109830703 GTGTCTTTCCCAAAGTCAAATGG + Intronic
1102709596 12:114914565-114914587 GTGACTTACCCTAAATCAAATGG + Intergenic
1103455302 12:121060530-121060552 GTGTCTGCCCCGGAATCAGAAGG + Intergenic
1104794232 12:131505966-131505988 GTTTCTAACCTAGCATCAGAAGG + Intergenic
1106557609 13:30823762-30823784 GTGTCTGTCCCTGAATCAAGGGG + Intergenic
1107724788 13:43287751-43287773 GTATCTTGTCCAGAATCAAAAGG + Intronic
1110588397 13:77222912-77222934 GTGTATATGCCAGAATCAAGGGG - Intronic
1110947124 13:81436050-81436072 GTATCTAACCCTGATTTAAATGG - Intergenic
1116051194 14:39805200-39805222 GTGTCCAAACCAGATTAAAAAGG - Intergenic
1117487944 14:56217371-56217393 GTGTCTAACCCACCATCATCAGG + Intronic
1117525077 14:56592971-56592993 TTGTCTAACCCTTAATCAAAAGG - Intronic
1121281895 14:92705026-92705048 GTGTCCCTCCCAGAATCAAAAGG - Intronic
1121431839 14:93893282-93893304 ATTTCTAAACCTGAATCAAAAGG - Intergenic
1122514312 14:102296356-102296378 GTTCCTTACCCAAAATCAAATGG - Intronic
1124695327 15:31859676-31859698 TTCTCAAACCCAGAATCAATAGG + Intronic
1126001391 15:44213430-44213452 GGGTCTAAAGCAGAAGCAAAAGG + Intergenic
1128033436 15:64501876-64501898 GTCTCTAACAGAGAAGCAAATGG + Intronic
1132153853 15:99481445-99481467 GTGCCTTGCCCAGGATCAAATGG + Intergenic
1134619361 16:15675896-15675918 CTGACTAGCCCAGAATCAACTGG - Intronic
1137802820 16:51276770-51276792 TTGTCTGACCCAGAAGCAACGGG + Intergenic
1143173113 17:4941324-4941346 GTGTAGAACCCAGAATCTAGAGG + Intronic
1143486729 17:7259387-7259409 GTATCTATCCCAGTACCAAATGG + Intronic
1146407068 17:32548074-32548096 GTGACAAACCCAGAAAGAAAGGG - Intronic
1147239949 17:39084158-39084180 GTGTGTATCCCACAGTCAAAGGG + Intronic
1148247277 17:46041690-46041712 GTTTTTGACCCAGAATTAAAGGG - Intronic
1149407285 17:56366706-56366728 GTGTATAACCTAGAAGCAATAGG + Intronic
1149524114 17:57340738-57340760 ATGTCTACCCCAGAGTCAGAAGG - Intronic
1154068699 18:11132794-11132816 GTGACTGACCCAGAATCACTGGG + Intronic
1154193410 18:12248714-12248736 ATGTCTACTCCAGAATTAAAAGG + Intergenic
1155793765 18:30007308-30007330 GTGGCTGGCCCAGAAACAAAGGG + Intergenic
1158572839 18:58611452-58611474 CTGCCTAACCCAGAACCACAAGG + Intronic
1160715368 19:573941-573963 ATCTTTAACCCAGAACCAAATGG - Intronic
1163275627 19:16282477-16282499 GGGTGGAACCCAGAATCACAGGG + Intergenic
1164681501 19:30136821-30136843 GTGGCTACCCCAGTATCAAATGG + Intergenic
925080612 2:1061239-1061261 GCGTCCAACCCAGGATCACACGG - Intronic
925259776 2:2519499-2519521 GTGTCTAAGCTGGAATGAAAGGG + Intergenic
927283142 2:21328387-21328409 GTGTGTAACCAATAAGCAAAAGG - Intergenic
927386779 2:22543576-22543598 CTGTCAAACTCAGAACCAAATGG + Intergenic
928959417 2:36908411-36908433 GTGAATAAGCCAGAATCGAAAGG + Intronic
931071302 2:58653570-58653592 GTGTGTAACACAAACTCAAAAGG - Intergenic
935362564 2:102259805-102259827 GGGTCTCACTCAGAATCAACTGG - Intergenic
936758878 2:115749477-115749499 GTGTCAAGCCCAGAGTCACAGGG - Intronic
937236364 2:120433819-120433841 GTGTCCAACACAGAATCCAAAGG - Intergenic
939278845 2:140037013-140037035 TTATCTAACTCAGAATTAAATGG - Intergenic
940526055 2:154815425-154815447 ATGTCTAATGCAGATTCAAAAGG - Intronic
941352579 2:164454970-164454992 TTGTCTACCCCATAAGCAAATGG - Intergenic
943366008 2:186968060-186968082 GAGGCTAACCCAGAATGCAATGG - Intergenic
945193855 2:207219359-207219381 TTCCCTAACCCAGCATCAAATGG + Intergenic
945931840 2:215863066-215863088 GTGTGAATCCCAGAGTCAAAGGG + Intergenic
948043388 2:234923058-234923080 GTGTAGAACCCAGACACAAAAGG + Intergenic
1169708933 20:8539326-8539348 GTGTCAAAACCAGAGACAAATGG - Intronic
1173930605 20:46814828-46814850 TTGTCTACCCCAGAGTTAAAAGG - Intergenic
1178925920 21:36774921-36774943 GTGTCAAATCCAGAATAGAATGG - Intronic
1184937636 22:47736581-47736603 CTGACTCACCCAGAATTAAAAGG - Intergenic
952620008 3:35327011-35327033 GGGTCTTACCTAGAATCTAATGG + Intergenic
954380183 3:50215190-50215212 GTGTCGCACCCTGGATCAAAGGG + Intronic
954764936 3:52906698-52906720 ATGGCTTAACCAGAATCAAAAGG + Intronic
956199644 3:66692994-66693016 GTGGCTAATACAGACTCAAAAGG + Intergenic
957320566 3:78625020-78625042 GTGTTTAACCCAGTATTTAAAGG - Intronic
957607856 3:82427557-82427579 GGTTCTAAACCATAATCAAAAGG + Intergenic
963787797 3:149552618-149552640 GTGTGAAACTCAGAATGAAATGG - Intronic
964438939 3:156684298-156684320 ATTTCAAACCCAGAATCAAAGGG - Intronic
965474699 3:169141329-169141351 CTGTCTAACACAAAAGCAAATGG - Intronic
966502960 3:180666226-180666248 GTGAATAACCCAGAAACAAAAGG - Intronic
970266490 4:14293761-14293783 GTCTTTAATCCAAAATCAAAAGG + Intergenic
970408856 4:15788329-15788351 GTTTCTAATGCAGAATCACAAGG - Intronic
970906686 4:21224482-21224504 GTGTCCAACCCAAACTCATAGGG - Intronic
972195776 4:36652102-36652124 GTATCTAAAACAGAATAAAAAGG - Intergenic
974785262 4:66610931-66610953 GTGTTAAACCCAGATTTAAAAGG - Intergenic
977379743 4:96256995-96257017 GTGTCTCACCCTGGAGCAAAGGG - Intergenic
978807627 4:112817218-112817240 GTGTCTAATACTGAATCTAAAGG - Intergenic
981490836 4:145337630-145337652 GTGAATAACACAGACTCAAAAGG + Intergenic
982888492 4:160815854-160815876 GTGTCTATCACAGAAACTAAAGG - Intergenic
984341309 4:178459984-178460006 GTGACTAACTCAGAGTTAAAGGG + Intergenic
984516055 4:180740887-180740909 GTGTATAACCCAGAAGCAACGGG - Intergenic
988850567 5:35176547-35176569 GTGTCAAACTCAGAGTTAAATGG + Intronic
989976171 5:50589518-50589540 GTTTCAAACCAAGAATAAAATGG - Intergenic
990904030 5:60783853-60783875 CTGTCTTCCCCAGAAACAAAAGG + Intronic
996979644 5:129475155-129475177 GTGTCTAACCCAAAGTCACAAGG + Intronic
997857473 5:137384988-137385010 GTGTCTATCACATAATCACATGG + Intronic
998058670 5:139101703-139101725 GTGTCTAACCCAGAATCAAATGG - Intronic
998530145 5:142876889-142876911 GTGCCTGAACCAGAATCAGAAGG + Intronic
1005774672 6:29117924-29117946 GTATCTAATCCAGGATCATAAGG + Intergenic
1011753966 6:90480322-90480344 GTGAGGAGCCCAGAATCAAAGGG - Intergenic
1013765120 6:113565209-113565231 GTTTCTTTCCCAGAATCTAAAGG - Intergenic
1015088579 6:129327288-129327310 CTGTCTAGGCCAGAACCAAAGGG + Intronic
1015195712 6:130523042-130523064 GTCACTAACCCAAAATCACATGG + Intergenic
1017249145 6:152261088-152261110 GAGGCTAAACCAGAAGCAAAGGG - Intronic
1018255998 6:161920032-161920054 GTTTTTAACCCAGCAGCAAAAGG - Intronic
1018290460 6:162287900-162287922 GTGACTAACCCAGCAGCAGATGG + Intronic
1021200346 7:17722063-17722085 GTGGATACCCCAGAATAAAAGGG + Intergenic
1021384645 7:20013494-20013516 GTCTCTAAACCAGTATAAAAAGG + Intergenic
1022613054 7:31896250-31896272 GTGTCTGCCCCAGGACCAAAGGG + Intronic
1024201829 7:47116267-47116289 GTTTGTAACCCAAAATCCAAAGG + Intergenic
1024792211 7:52979552-52979574 ATATCTATCCTAGAATCAAATGG + Intergenic
1027413730 7:77950789-77950811 GTGTGTAAACCAAAATCATAGGG - Intronic
1029792856 7:102863676-102863698 CTCTGTCACCCAGAATCAAAGGG + Intronic
1030327319 7:108234185-108234207 GTATCAAAATCAGAATCAAAAGG + Intronic
1033435324 7:141328531-141328553 GGGTCTAACCCAGGAACAGAAGG + Intronic
1037625509 8:20602936-20602958 GAGTCTAGCCCAGATTCAAGAGG - Intergenic
1037651066 8:20838981-20839003 GTGTCTAACTGCAAATCAAATGG - Intergenic
1038607625 8:29024773-29024795 GTGACTAACCCATATGCAAATGG + Intronic
1041374570 8:57200388-57200410 GTGTCAAACTCAGAGTTAAATGG - Intergenic
1042416539 8:68526999-68527021 ATTTCTAAACCAGGATCAAATGG - Intronic
1046170964 8:110505580-110505602 ATGTCTCACCCAGATTCAAAAGG - Intergenic
1046406931 8:113786238-113786260 GTATCTAATTCAAAATCAAATGG + Intergenic
1047101092 8:121676517-121676539 GTGCATAACCCAGAGGCAAAGGG - Intergenic
1048358153 8:133670723-133670745 AAGTCTAGCCCAGAATCAAGAGG + Intergenic
1049788868 8:144463929-144463951 TTGTCTAGACCAGAATGAAAGGG - Intronic
1051268978 9:15336500-15336522 GTGTCTAGCCCTGATTCACAGGG + Intergenic
1051702561 9:19839898-19839920 GTTTGTAACCCAGAAGCAATAGG + Intergenic
1053198044 9:36135401-36135423 GTGCCCAACCCTGATTCAAAAGG - Intergenic
1053232420 9:36421728-36421750 TAGTCTAACTCAGAATTAAAGGG - Intronic
1053403196 9:37846785-37846807 GTGAAAAGCCCAGAATCAAATGG + Intronic
1057722249 9:97542048-97542070 TTGCCTAATCCAGAATCAGAAGG + Intronic
1059223964 9:112654007-112654029 GTGGCTAGCCCAGATTCAAGGGG + Intronic
1061059903 9:128245090-128245112 GTGTCCAACCCCGAAGCACAGGG + Intronic
1061930989 9:133833068-133833090 GTGGCCAGCCCAGCATCAAAGGG + Intronic
1186042881 X:5501155-5501177 GTGTGAAACCCACAGTCAAAAGG - Intergenic
1187514092 X:19950390-19950412 AAGACTAACCCAGAATCTAAAGG + Intronic
1192249631 X:69400978-69401000 GTAACTAACCCAGAATGACATGG - Intergenic
1194006706 X:88503949-88503971 GTGTCTGAGCCAGTATCAAGAGG - Intergenic
1194200729 X:90950777-90950799 GTGTCAAACTCAGAGTTAAATGG + Intergenic
1196076536 X:111583939-111583961 GACTCTTACCCAGAATCATATGG - Intergenic
1199725129 X:150572570-150572592 GTGTATAACCAACAATCACAGGG + Intronic
1201966848 Y:19746735-19746757 TTGTCTAACCCAAAATCACAAGG + Intergenic