ID: 998065761

View in Genome Browser
Species Human (GRCh38)
Location 5:139157020-139157042
Sequence CAGGGTCACCCATCAGATAG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 148
Summary {0: 1, 1: 0, 2: 0, 3: 10, 4: 137}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
998065761 Original CRISPR CAGGGTCACCCATCAGATAG TGG (reversed) Intronic
900177185 1:1296094-1296116 CAAGCTCACACATCAGCTAGCGG + Exonic
901666907 1:10831290-10831312 CAGGGTTACCCATCTGCTTGAGG + Intergenic
904208990 1:28873460-28873482 CAGGGTCCTCCATTAGAAAGGGG - Intergenic
904376315 1:30084605-30084627 CAGGGTCACCAAGCAGAAACAGG - Intergenic
904796564 1:33060663-33060685 CAGGGTCTCCCATGAGTTTGTGG - Intronic
905370144 1:37478669-37478691 CAGGGTCACACAGCAGTTAACGG - Intronic
908408615 1:63840783-63840805 CCGGTTCACCCAGCAGAAAGTGG - Intronic
909189902 1:72538856-72538878 TAGTGGCAGCCATCAGATAGAGG + Intergenic
910448883 1:87328084-87328106 AAGGGTCTCCTCTCAGATAGAGG + Intergenic
916014039 1:160732702-160732724 CAGTGTCACCTATCAGACAGGGG - Intergenic
922462504 1:225824173-225824195 CTGGCTGACCCACCAGATAGGGG + Intronic
922611751 1:226935492-226935514 CAGGGCAACCCATAAGAAAGAGG + Intronic
1065305568 10:24365216-24365238 GAGGGTCACCTAGCAGAGAGTGG + Intronic
1065667080 10:28074043-28074065 CTGTATCACCCACCAGATAGAGG + Intronic
1065905756 10:30249618-30249640 CAGTCTCACCCATCAGATTTTGG + Intergenic
1067545222 10:47188045-47188067 CAGGGTAAGCCATCTGATAAGGG + Intergenic
1069868740 10:71520456-71520478 CAGGGTCACCCCGCAATTAGTGG + Intronic
1070648634 10:78219251-78219273 CAGGGTCACCCAGCAACCAGGGG - Intergenic
1070916596 10:80159004-80159026 CGGTGTCACCCATCAGCTGGAGG + Intronic
1071505404 10:86228755-86228777 CTGGGTCACCCCTCAGGAAGTGG + Intronic
1074100114 10:110348232-110348254 CAGGGTCACCCATCAGGGGCTGG - Intergenic
1074281305 10:112054184-112054206 CAGGGTCACCTCCAAGATAGGGG - Intergenic
1074509793 10:114101612-114101634 CAGGGTCTCCCCTCTGACAGAGG - Intergenic
1076112766 10:127873442-127873464 CAGGGTCCCCCAGAAGAGAGCGG - Intergenic
1077167472 11:1150331-1150353 CAGGGCCCCCCATCAGGGAGGGG + Intergenic
1080722698 11:34865547-34865569 CAGGGTGACTCAGCAGGTAGAGG - Intronic
1081642715 11:44767225-44767247 AAGTGTCAGCCATCAGCTAGAGG - Intronic
1083102698 11:60326597-60326619 CAGGCTCAGCCAGCAGAGAGAGG - Intergenic
1085709954 11:78820310-78820332 CAAGGTCACACAGCTGATAGGGG + Intronic
1087716296 11:101612619-101612641 CAGGGTCACCCATCGGAAGTTGG - Intronic
1089339984 11:117750728-117750750 CAAGGTCACACAGCAGTTAGTGG - Intronic
1090401685 11:126453272-126453294 CAGTGTTCCCCAGCAGATAGCGG - Intronic
1090529739 11:127578259-127578281 CAGGGTCACACAGCAGGTAGAGG + Intergenic
1100325296 12:93534553-93534575 CATGGTGACCCAAGAGATAGGGG + Intergenic
1101432805 12:104640968-104640990 CAGGCTCAGCCAACAGAGAGGGG + Intronic
1102998656 12:117368479-117368501 CAAGGTCACACAGCAGATGGAGG - Intronic
1106387425 13:29301609-29301631 CAGGGTCACACAGCAATTAGTGG - Intronic
1110618930 13:77572904-77572926 CAGAGTCAGGCATCAGACAGGGG + Intronic
1113562128 13:111289971-111289993 CTGGGTAACCCATCAGAAGGTGG + Intronic
1113893164 13:113747311-113747333 CAGGGTCACACAGCAGGCAGTGG - Intergenic
1115019073 14:28653007-28653029 CAGGGTGATCCATCAAAAAGTGG - Intergenic
1119653680 14:76401315-76401337 CAGTGTCACCCAGCTGATGGTGG + Intronic
1122421609 14:101581452-101581474 CAGGGCCACCCAGCAGCCAGTGG + Intergenic
1122465886 14:101933280-101933302 CAGGGCCATCCAGGAGATAGCGG + Intergenic
1122825796 14:104369806-104369828 CAGGGTCACCCTGCAGATTTTGG - Intergenic
1123405689 15:20018360-20018382 CAGAGTCACCCCTCAGGCAGTGG + Intergenic
1124178839 15:27454079-27454101 CAGGCTCACCCAGAAGTTAGAGG + Intronic
1128385582 15:67145933-67145955 CAAGGTCACCCAGCAGGCAGGGG - Intronic
1131814783 15:96211203-96211225 CAGGCTCAGCCAGCAGAGAGAGG + Intergenic
1133975882 16:10599608-10599630 CAGGGTCACACAGCAGCTAGTGG + Intergenic
1134814687 16:17196131-17196153 TAGGGTCTCCCAGCAGATGGTGG + Intronic
1135614813 16:23902098-23902120 CAGCCTCACCCAGCAGACAGAGG + Intronic
1137494193 16:48956996-48957018 CAGGGTCACACAGCAAGTAGTGG - Intergenic
1137982646 16:53082904-53082926 CAGGGTGAGCACTCAGATAGAGG - Intronic
1140915029 16:79485188-79485210 CAGGGTCACACAGCAAGTAGTGG - Intergenic
1141874183 16:86810473-86810495 CAGGGTCACATAGCAAATAGTGG + Intergenic
1144434723 17:15230424-15230446 CTGGGTCACCCACCAGAAAAGGG + Exonic
1146622441 17:34409525-34409547 CAAGGTCACACAGCACATAGTGG + Intergenic
1151960483 17:77402995-77403017 CAGGGACACACAGCAGACAGAGG - Intronic
1152495216 17:80666387-80666409 CAGGGTCACCCTGAAGACAGCGG - Intronic
1154233324 18:12578690-12578712 CAGGGCTACACATCGGATAGTGG - Intronic
1156295026 18:35781696-35781718 CAAGGTCCCACATCAGAAAGTGG - Intergenic
1160011701 18:75111141-75111163 CAGGGACACCCCCCAGCTAGAGG + Intergenic
1161075501 19:2283231-2283253 CAGGGTCACGCAGCAGCTCGAGG + Intronic
1163076170 19:14893739-14893761 AAAGGTAACCCATCAGATAAAGG - Intergenic
1166552356 19:43674644-43674666 CAGGGTCACCCAGAAGCAAGTGG - Intergenic
927517681 2:23681685-23681707 CAGGGTCACACACCAATTAGTGG + Intronic
931633229 2:64319984-64320006 CAGAGTCACCCAACAGAGACTGG + Intergenic
932415797 2:71573274-71573296 AAGGGGCACCCAGCAGACAGAGG + Intronic
935114299 2:100121245-100121267 CAGGCTCAACCAGCAGAGAGAGG + Intronic
937313888 2:120918948-120918970 CAGTGTCACACATCAGCCAGAGG - Intronic
939436706 2:142186106-142186128 CAGGGGCTCCCAGCAGTTAGAGG + Intergenic
946564212 2:220945152-220945174 CAGGGTCACCAGTCAGTTTGGGG - Intergenic
947712074 2:232321981-232322003 CAGGGTCACCCATCTGAACCTGG - Intronic
947731315 2:232433100-232433122 CAGGGTCACCCATCTGAACCTGG - Intergenic
1172449338 20:35010666-35010688 CACGGTCACACATCACACAGAGG + Intronic
1173374906 20:42474561-42474583 CAGGGTCACCCATTTGATTTGGG - Intronic
1173549188 20:43920670-43920692 CAAGGTCACCCAGCAGATCGGGG - Intronic
1174368448 20:50070504-50070526 CAAGGTCACCCAGCAGGTGGGGG - Intergenic
1183097035 22:35558630-35558652 CAGGGTCATCCACCAGATAAAGG + Intergenic
1183977508 22:41521416-41521438 CAGGGTCACTCAGCTGTTAGTGG - Intronic
1185149560 22:49156268-49156290 CACAGCCACCCATCAGAAAGGGG - Intergenic
952694440 3:36249351-36249373 CAGGGGCACACATCAGAAGGAGG + Intergenic
954156006 3:48685323-48685345 CAGGGTCGCCATTCAGATGGCGG + Intronic
957210718 3:77254840-77254862 CCGAGTCACCCATCAAAAAGTGG + Intronic
961668161 3:128506917-128506939 CTGTGTCACCCATCAGGGAGGGG - Intergenic
963858415 3:150280546-150280568 CAGGATCAGCCAGCAGAGAGAGG + Intergenic
967830324 3:193913000-193913022 CAAGGTCACACATCAGCCAGTGG + Intergenic
967943598 3:194785047-194785069 CAAGGTCACACACCAGACAGAGG - Intergenic
968920189 4:3518476-3518498 GAGGGTGACCCAGCAGAGAGGGG - Intronic
969554101 4:7894548-7894570 CATGGTCACCCTTCACAAAGCGG - Intronic
973772041 4:54215630-54215652 CAGGCTCACACTTCAGATAGTGG - Intronic
973790522 4:54374098-54374120 CAGGGCAAGCCATCAGAGAGGGG + Intergenic
981724550 4:147833894-147833916 CATGGGCACCTCTCAGATAGAGG + Intronic
982118805 4:152119397-152119419 CAGGGTCACACAGCAGAAACTGG + Intergenic
982204729 4:152989296-152989318 CAAGGTCACCAAGCAGATACAGG - Intergenic
982614873 4:157627985-157628007 CAGGGTCACACATCAGCGATAGG - Intergenic
986356558 5:6933927-6933949 CAGCATCGCCCATCAGATTGGGG - Intergenic
991087042 5:62657120-62657142 CAGGTACACCAATCAGACAGAGG - Intergenic
991089146 5:62677429-62677451 CAGGTACACCAATCAGACAGAGG + Intergenic
992020150 5:72614973-72614995 TAGGTTCACCCAACAAATAGTGG - Intergenic
995479869 5:112583108-112583130 CAGTGGCAGCCATCAGATAGAGG - Intergenic
997391836 5:133523445-133523467 CAGGGAAAACCACCAGATAGTGG + Intronic
997436030 5:133876384-133876406 CAGGGTCACCCAACTGGTAAGGG - Intergenic
997509540 5:134444295-134444317 CAGGGAGACCCATAAGAGAGTGG + Intergenic
997615629 5:135244412-135244434 CAGGGTCACCCAGATGGTAGGGG - Intronic
998065761 5:139157020-139157042 CAGGGTCACCCATCAGATAGTGG - Intronic
999932316 5:156446933-156446955 CAAGGTCATCCATCAAATAGTGG + Intronic
1000517273 5:162253510-162253532 CAGGGACATGCATCAGAGAGTGG - Intergenic
1003766360 6:9241535-9241557 CAGGGTTGCCCTTCAGTTAGAGG - Intergenic
1004342065 6:14816679-14816701 CAAGGTCACCCAGCAGATGGAGG + Intergenic
1007701152 6:43767346-43767368 CAGGGTCACCTAGCAGATTGGGG - Intergenic
1012425498 6:99109690-99109712 CAGGATCACCAATTTGATAGGGG - Intergenic
1012982204 6:105842750-105842772 CAGGGTCTCCCATCTCATCGGGG - Intergenic
1015269143 6:131321653-131321675 CAGGCTCAACCAACACATAGAGG + Intergenic
1015684945 6:135849325-135849347 AAGGGTCACTAGTCAGATAGAGG - Intergenic
1018988990 6:168659325-168659347 CAGGGTCAGCCAAGAGACAGAGG + Intronic
1022149796 7:27590277-27590299 CAAAGTCACACAACAGATAGAGG + Intronic
1022898924 7:34782276-34782298 GAGTGTCACCCATCAGACACTGG + Intronic
1024207908 7:47179550-47179572 GAGGGACACCCTTCAGACAGTGG - Intergenic
1024541389 7:50477691-50477713 CAGGGTCACTCATAAAACAGGGG - Intronic
1025849327 7:65233071-65233093 CAGGCTCAGCCAGCAGAGAGAGG + Intergenic
1026540528 7:71276153-71276175 CAGGGGCACCCATCACATGCCGG - Intronic
1027238142 7:76310270-76310292 CAGGGTCACCCAGCAGGTCTGGG + Intergenic
1034036996 7:147835398-147835420 AAGTGTCACACAGCAGATAGTGG + Intronic
1034198064 7:149262762-149262784 CAGGGTCACGCATCTATTAGAGG + Intronic
1035795012 8:2348030-2348052 CTGGCTCACTCATCAGATACTGG + Intergenic
1038223199 8:25630346-25630368 CAGGGTCACACAGCTGATGGGGG - Intergenic
1039475519 8:37837547-37837569 CAGGGTCCCCCATTAGACTGAGG + Intronic
1041163448 8:55068808-55068830 CATGCCCACCCTTCAGATAGAGG + Intergenic
1042081557 8:65059748-65059770 CAGGCTCAGCCAGCAGAGAGGGG + Intergenic
1048897329 8:139004086-139004108 CAGGGTCACCCAGCAACAAGTGG - Intergenic
1051948289 9:22598877-22598899 CAGGGTTATCCAGCAAATAGAGG + Intergenic
1053583910 9:39436370-39436392 CAGGCTCAGCCAGCAGAGAGAGG - Intergenic
1054105491 9:60995114-60995136 CAGGCTCAGCCAGCAGAGAGAGG - Intergenic
1055240802 9:74183528-74183550 CAGGCTCAGCCAGCAGAGAGCGG - Intergenic
1057006856 9:91568413-91568435 CAGGCTCAGCCAGCAGAGAGAGG - Intronic
1057175803 9:92998097-92998119 CAGGTACACCAATCAGACAGAGG + Intronic
1058818683 9:108709240-108709262 CAAGGTCACACATAAGATTGTGG + Intergenic
1060409637 9:123391471-123391493 CAGGGTCACACAGCAGCTAAAGG + Intronic
1060953398 9:127620035-127620057 CAGTGTCACCCATGAGTCAGGGG - Intronic
1061003708 9:127916759-127916781 CAAGGTCACCCATCAGGTCTGGG + Intronic
1061325452 9:129861240-129861262 CAGGGTCACCCAGCTGGGAGAGG - Intronic
1061993013 9:134170345-134170367 CAGGGACACCCACCAGCCAGGGG - Intergenic
1190649362 X:52554424-52554446 CAGTGTCACCCAGCAGTGAGTGG + Intergenic
1193865367 X:86724558-86724580 AAGGAACACCCATCAGACAGTGG - Intronic
1195260232 X:103124657-103124679 CAGTGTCACACATCAAATAAGGG + Intergenic
1196828122 X:119757118-119757140 CAAGGTCACCCAGCAGGAAGTGG - Intergenic