ID: 998066067

View in Genome Browser
Species Human (GRCh38)
Location 5:139159968-139159990
Sequence CACTTCTGTGATGCCTAATG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 235
Summary {0: 1, 1: 0, 2: 2, 3: 16, 4: 216}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
998066067_998066075 22 Left 998066067 5:139159968-139159990 CCTCATTAGGCATCACAGAAGTG 0: 1
1: 0
2: 2
3: 16
4: 216
Right 998066075 5:139160013-139160035 GTCAAGAGCATCTCAAGTTTGGG No data
998066067_998066077 30 Left 998066067 5:139159968-139159990 CCTCATTAGGCATCACAGAAGTG 0: 1
1: 0
2: 2
3: 16
4: 216
Right 998066077 5:139160021-139160043 CATCTCAAGTTTGGGGACCCTGG 0: 1
1: 0
2: 1
3: 10
4: 130
998066067_998066076 23 Left 998066067 5:139159968-139159990 CCTCATTAGGCATCACAGAAGTG 0: 1
1: 0
2: 2
3: 16
4: 216
Right 998066076 5:139160014-139160036 TCAAGAGCATCTCAAGTTTGGGG 0: 1
1: 0
2: 0
3: 15
4: 139
998066067_998066069 0 Left 998066067 5:139159968-139159990 CCTCATTAGGCATCACAGAAGTG 0: 1
1: 0
2: 2
3: 16
4: 216
Right 998066069 5:139159991-139160013 CAGGCCATTACCATCCCTGAAGG 0: 1
1: 0
2: 0
3: 8
4: 106
998066067_998066074 21 Left 998066067 5:139159968-139159990 CCTCATTAGGCATCACAGAAGTG 0: 1
1: 0
2: 2
3: 16
4: 216
Right 998066074 5:139160012-139160034 GGTCAAGAGCATCTCAAGTTTGG 0: 1
1: 0
2: 1
3: 4
4: 81

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
998066067 Original CRISPR CACTTCTGTGATGCCTAATG AGG (reversed) Intronic
900965489 1:5955138-5955160 CACTTCCCTGATGACTAGTGAGG - Intronic
901138578 1:7013338-7013360 CACTTCTGTAATCCCTACTCAGG - Intronic
901849033 1:12003682-12003704 CATTTCTGTGATTACTAGTGAGG + Intronic
902147293 1:14413948-14413970 CACTTCCCTGATTACTAATGAGG - Intergenic
902761684 1:18585054-18585076 CATTTCTCTAATGACTAATGAGG - Intergenic
903643472 1:24876288-24876310 CCCTGCTGTGATGCCTGCTGGGG + Intergenic
903818344 1:26081685-26081707 CACTTCTGTGATTCCTGCCGTGG - Intergenic
904918706 1:33989244-33989266 CATTTCCCTGATGGCTAATGAGG - Intronic
906800009 1:48728909-48728931 CACTGCTGTGATTACTAATGAGG + Intronic
909899705 1:81117258-81117280 CATTTCTCTAATGACTAATGAGG + Intergenic
911142464 1:94520615-94520637 CATTTCCCTGATGACTAATGAGG + Intergenic
911308001 1:96255155-96255177 CAGTACTGTGCTGACTAATGGGG + Intergenic
916808818 1:168286963-168286985 CATTTCTCTGATGGCTGATGAGG + Intronic
917194937 1:172455212-172455234 CACTTAGGTGATGCATCATGGGG - Intronic
918434562 1:184498131-184498153 CACTTTTGTGATGCAGATTGGGG - Intronic
918934848 1:190908894-190908916 TATTTCTATGATGACTAATGAGG + Intergenic
919173066 1:193981622-193981644 CATTTCTCTAATGTCTAATGAGG + Intergenic
920613724 1:207468561-207468583 CACTTGTGTGATGTCCATTGTGG - Exonic
923245592 1:232128806-232128828 CATCTCTGTTTTGCCTAATGTGG - Intergenic
923788588 1:237091814-237091836 CAGGCCTGTGCTGCCTAATGTGG + Intronic
923937056 1:238774037-238774059 CATTTCTCTGATGGCTAATAAGG + Intergenic
1063507334 10:6612445-6612467 CATTTTTCTGATGACTAATGAGG - Intergenic
1065181007 10:23125500-23125522 CCCTTCTTTCATTCCTAATGGGG + Intergenic
1065403714 10:25337864-25337886 CATTTCTCTGATAACTAATGAGG + Intronic
1066024185 10:31336735-31336757 CATTTCCCTGATTCCTAATGAGG - Intronic
1066423218 10:35281003-35281025 CATTTCCCTGATGACTAATGAGG - Intronic
1067293613 10:44961680-44961702 GACTTCTGTGAAGACGAATGAGG - Intronic
1068281743 10:54880749-54880771 CACTTCTCTCATTCCTTATGTGG - Intronic
1068820170 10:61366529-61366551 CATTTCTCTGATGACTAATGAGG + Intergenic
1070822735 10:79371662-79371684 CATTTCTCTGATGATTAATGAGG + Intergenic
1070985558 10:80686839-80686861 CATTCCTGTGCTCCCTAATGAGG + Intergenic
1072518860 10:96212741-96212763 CACTTTTGTGATGCCCACTGGGG + Intronic
1074627473 10:115207422-115207444 CACTTCTCTGATGACCAGTGAGG + Intronic
1076331095 10:129667832-129667854 CATTTCTATAATGACTAATGTGG + Intronic
1076895713 10:133310382-133310404 CACTTGTGTGTCACCTAATGGGG + Intronic
1081764266 11:45598623-45598645 AGCTTCTGTGATGACTCATGGGG + Intergenic
1083325940 11:61873070-61873092 CACTGGTGTGATGCCAGATGTGG + Intergenic
1086162614 11:83739608-83739630 CATTTCTCTGATGAATAATGAGG - Intronic
1087180671 11:95139153-95139175 AATTTCTGTAATGACTAATGGGG - Intergenic
1087310865 11:96541451-96541473 CACTTCTCTGATGATTAGTGAGG + Intergenic
1087589150 11:100162926-100162948 CATTTCTGGAATGCCAAATGAGG + Intronic
1090615035 11:128506810-128506832 CACTTATGTGAGGACTAAAGAGG + Intronic
1094005818 12:25749764-25749786 CACTTCTCTGATTACTCATGAGG - Intergenic
1095392162 12:41720649-41720671 CTTTTCTGTGGTGACTAATGAGG + Intergenic
1095592652 12:43921042-43921064 CCCTTCTGTGTTTCCTAATGTGG + Intronic
1097838675 12:64300081-64300103 CTTTCCTGTCATGCCTAATGGGG - Intronic
1098704436 12:73670109-73670131 CATTTCTGTGATTTCTAATAAGG + Intergenic
1100961897 12:99971797-99971819 CACAGCTTTAATGCCTAATGTGG - Intronic
1103106242 12:118228834-118228856 CATTTCTCTGATTACTAATGAGG + Intronic
1103234259 12:119359180-119359202 CATTTCCTTAATGCCTAATGAGG + Intronic
1104233597 12:126909667-126909689 CACTGCTGTGAAGACTCATGGGG + Intergenic
1105802503 13:23920375-23920397 CATTTCTCTGATGATTAATGAGG - Intergenic
1106230041 13:27814631-27814653 CACATCTCTGATGGCCAATGAGG + Intergenic
1106352153 13:28942237-28942259 CATTTCCCTGATGACTAATGAGG - Intronic
1109050076 13:57469001-57469023 CACTTGTGGCATGCCCAATGAGG - Intergenic
1109107042 13:58266457-58266479 CACTTCTTAAATGACTAATGAGG + Intergenic
1110803701 13:79730443-79730465 CACTTCTGTAATGATTAGTGAGG + Intergenic
1111021916 13:82460957-82460979 AAGTTCCGTGATGACTAATGTGG + Intergenic
1111034462 13:82654666-82654688 CATTACTGTATTGCCTAATGTGG + Intergenic
1111564856 13:90001214-90001236 CATTACTGTGATGACCAATGTGG + Intergenic
1113281214 13:108789958-108789980 CACTTCTGTGATGCCTTCTGTGG - Intronic
1114282972 14:21211626-21211648 CAGTTCTGTGATCCTTAGTGGGG - Intronic
1117230230 14:53709532-53709554 CATTTCTCTGATGTCTAATGAGG - Intergenic
1119459368 14:74787036-74787058 CATTTCCCTGATGACTAATGAGG + Intronic
1121724442 14:96136474-96136496 CATTTCTGATATGCCTAAGGGGG - Intergenic
1122572542 14:102716129-102716151 CAGTTCCCTGATGACTAATGAGG + Intronic
1125126878 15:36234610-36234632 CAATTCTCTGATGACAAATGAGG - Intergenic
1127373500 15:58361502-58361524 CATTTCTCTGAGGCCTGATGAGG - Intronic
1128147729 15:65341732-65341754 CATGTCTGTGCTGTCTAATGTGG + Intronic
1130041347 15:80407290-80407312 CTCTTCTGTGATGTGTAGTGGGG + Intronic
1131343999 15:91629233-91629255 CTCTTTTGTTAAGCCTAATGTGG - Intergenic
1131762882 15:95643168-95643190 CACTTTTGTGCTGCATACTGGGG - Intergenic
1132435881 15:101802178-101802200 CACCTGTCTGAAGCCTAATGCGG - Intergenic
1133083637 16:3344363-3344385 CATTTCTCTGATTACTAATGAGG - Intergenic
1134200611 16:12195476-12195498 CATTTATGAGATGCCTAAGGGGG + Intronic
1137706212 16:50537535-50537557 CAGTGCTGTGCTGCCTAGTGAGG + Intergenic
1138044558 16:53707668-53707690 CATTTCAGTGATGACTAATGAGG + Intronic
1140184645 16:72756850-72756872 TATTTCTCTGATGACTAATGGGG + Intergenic
1140645085 16:77021228-77021250 CACTTCTGTCATTCCTTTTGTGG + Intergenic
1142649545 17:1338943-1338965 CATTTCTCTGATTACTAATGAGG - Intergenic
1142984569 17:3688152-3688174 CACATCAGTGCTGCCTAAAGAGG - Intronic
1143859846 17:9881137-9881159 TGCTTCTGTGATGCCTCCTGGGG + Intronic
1144012247 17:11160484-11160506 CATTTCTATGATTTCTAATGAGG - Intergenic
1144857651 17:18278520-18278542 CACTCCTGTGATGACTGGTGGGG - Intronic
1145438944 17:23077410-23077432 CACTTCTTTGAGGCCTATCGTGG + Intergenic
1148285854 17:46390866-46390888 TATTTCTCTGATGACTAATGAGG - Intergenic
1148308016 17:46608487-46608509 TATTTCTCTGATGACTAATGAGG - Intronic
1150869366 17:68888695-68888717 GACATCTGTGTTGCCTACTGTGG + Intronic
1152032037 17:77848855-77848877 TATTTCTGTGATGACTAATGTGG + Intergenic
1155497619 18:26458318-26458340 CTCTTCTGTGCTGCCTCTTGAGG - Intronic
1156109428 18:33706567-33706589 CATTTATCTGATGACTAATGAGG + Intronic
1156749922 18:40439747-40439769 CACTTCTGGGATAAATAATGTGG - Intergenic
1158042240 18:53109129-53109151 TACTTCCCTGATGACTAATGAGG + Intronic
1159479379 18:68968084-68968106 CAGTTATGTGTTGCCTAATGAGG + Intronic
1162075993 19:8187787-8187809 CATTTCTCTGATGACTCATGAGG - Intronic
1164092844 19:21975879-21975901 CAACTCTGTCCTGCCTAATGGGG + Intronic
1165543634 19:36514515-36514537 GACTTCTCTGGTGTCTAATGAGG + Exonic
1165582289 19:36877394-36877416 GAATTCTGTGATGCCGAATAAGG - Exonic
1165755838 19:38292293-38292315 CACTTCTGTGATGAGAAAAGAGG - Exonic
1167941518 19:52949515-52949537 GAATTCTCTGATGTCTAATGAGG + Exonic
1168430661 19:56276995-56277017 CATTTTTCTGATGGCTAATGAGG - Intronic
1168552624 19:57310354-57310376 AAATTTTCTGATGCCTAATGAGG - Intergenic
1168560467 19:57377822-57377844 GAATTCTGTAATGCCTAAAGAGG - Exonic
1168664938 19:58197096-58197118 AACTTCTGTGATGCTGAATAAGG - Intronic
925417820 2:3684321-3684343 CATTTCCCTGATGACTAATGAGG + Intronic
926241431 2:11090167-11090189 CACTTCTCTAATGGTTAATGAGG - Intergenic
926477916 2:13351065-13351087 CAATTATGTAATGACTAATGGGG - Intergenic
929061539 2:37930100-37930122 CAAGTCTGTGCTGCCCAATGTGG + Intronic
929496976 2:42453434-42453456 CACTTCTGTGATCATCAATGAGG + Intronic
930574459 2:53128853-53128875 CATTTCTCTGATGAATAATGAGG - Intergenic
930917759 2:56714644-56714666 CACCTCTGTGATTAGTAATGTGG - Intergenic
931414310 2:62066393-62066415 CACTTCTGTAATGACTGATCAGG + Intronic
932710464 2:74060221-74060243 AATTTCCCTGATGCCTAATGAGG + Intronic
933209246 2:79547657-79547679 AAGTTCTGTAATGCATAATGAGG + Intronic
933428719 2:82146773-82146795 CAGTTCTCTGATGACTAATAAGG - Intergenic
933873082 2:86589181-86589203 CACTTCTCCAATGACTAATGAGG - Intronic
933989070 2:87620590-87620612 CTCTTCTGTGAAGCCTCTTGTGG + Intergenic
934943236 2:98517580-98517602 CATTTCCCTGATGACTAATGGGG + Intronic
935654909 2:105413820-105413842 CACTTCTGTGACCCCAGATGGGG + Intronic
935757356 2:106286813-106286835 CATTTCTTTGACGACTAATGAGG - Intergenic
936304773 2:111330236-111330258 CTCTTCTGTGAAGCCTCTTGTGG - Intergenic
936469470 2:112786003-112786025 CATTTCTGTGTTGCCTAAAGAGG - Intergenic
937940736 2:127283795-127283817 CAGTTCCCTGATGACTAATGAGG + Intronic
938130616 2:128712821-128712843 CATTTCTCTAATGACTAATGAGG + Intergenic
938762121 2:134435415-134435437 CATTTCAGTGATGCCTTATCAGG + Intronic
942258460 2:174131683-174131705 CATTTCTGTGGTGATTAATGAGG + Intronic
942529076 2:176888946-176888968 CATTTCTCTGATGATTAATGAGG + Intergenic
945794559 2:214346314-214346336 CATTTCTCTTATGACTAATGTGG + Intronic
946883891 2:224203771-224203793 CACATCTGTGCTGTCTAATATGG - Intergenic
947148446 2:227089787-227089809 CATTTCTGAGATGTGTAATGTGG - Intronic
947170013 2:227301379-227301401 CTCATCAGTGATGCGTAATGAGG + Intronic
947400669 2:229728455-229728477 CATTTCCCTGATGACTAATGTGG - Intergenic
948027506 2:234789784-234789806 AGCTTCTGTGATAGCTAATGAGG - Intergenic
1168734472 20:118484-118506 CACTTCTGTAATGTCTCAAGGGG + Intergenic
1170036847 20:11998433-11998455 CACTTCTGGGATGCTGATTGGGG + Intergenic
1170541074 20:17388602-17388624 AACTTATGAGGTGCCTAATGAGG - Intronic
1170929441 20:20755548-20755570 CTCTTCTTGGATGTCTAATGGGG + Intergenic
1173327064 20:42043521-42043543 CCTTTCTGTGATGACTCATGAGG + Intergenic
1178287286 21:31336307-31336329 CATTTATGTGATGAATAATGTGG - Intronic
1181897004 22:26118955-26118977 CATTTTTCTGATGCCTGATGAGG - Intergenic
1182058716 22:27381595-27381617 CACATCTGAGATGCTTAATTTGG - Intergenic
1183615292 22:38941203-38941225 CATTTCTCTGATGATTAATGAGG + Intergenic
951283470 3:20780379-20780401 CACTTCTGGGCTGCCTACTATGG - Intergenic
954049112 3:47958396-47958418 CATTTCTGTGATTAGTAATGAGG - Intronic
954094425 3:48313382-48313404 CATTTCTCTAATGACTAATGAGG - Intronic
955691616 3:61596580-61596602 CACTTCTCTCATTCCTGATGAGG + Intronic
955985476 3:64569325-64569347 GACTTCTGTAATCACTAATGAGG - Intronic
956275069 3:67490842-67490864 CCTTTCTGTCATGACTAATGAGG - Intronic
958073948 3:88652186-88652208 CATTTCTGTGATGGCTAATGAGG - Intergenic
958571923 3:95894839-95894861 CACTTCTCTCATGCCTCATATGG - Intergenic
959492925 3:107013280-107013302 CAATTCCTTGATGACTAATGAGG - Intergenic
960732884 3:120745490-120745512 AATTTGTGTGATGCCTAATCTGG + Intronic
961605217 3:128089111-128089133 CATTTCTTTGATTACTAATGAGG + Intronic
965373619 3:167894549-167894571 TACTTCTGTGAAGCAAAATGTGG - Intergenic
969163875 4:5287344-5287366 CACTTCTCTGACGTCTAATGAGG + Intronic
971695214 4:29893254-29893276 CAATTCTGGGAGCCCTAATGTGG + Intergenic
972836988 4:42883367-42883389 CATTTCTCTGATGCTTAGTGTGG + Intergenic
974067187 4:57089550-57089572 CACTTCAGTGAAGTCTGATGGGG + Intronic
974902372 4:68016948-68016970 CAGTTCAGTGATGCCTGAAGAGG - Intergenic
976952246 4:90848526-90848548 CACTTAAGTGATGACTAATAGGG - Intronic
977143319 4:93403332-93403354 CACTTCTGGGGTGGCAAATGAGG + Intronic
980705211 4:136484435-136484457 CACTTCTGTTATTGCTCATGTGG + Intergenic
981499165 4:145429812-145429834 CACTTCTGTGATGCCCACCATGG - Intergenic
981955969 4:150474700-150474722 CACTTCTGTGATCTGTAAAGAGG + Intronic
983772427 4:171568946-171568968 CATTTCTGTGCTGCCTAACTAGG - Intergenic
984691326 4:182729485-182729507 CACTTCTGTTCTGCCTTTTGGGG - Intronic
985512138 5:318891-318913 CACTTCTGTGAAGCCAACTTGGG + Intronic
985579244 5:688407-688429 CACTGCTGTGCTGGCTAACGTGG - Intronic
985594087 5:780470-780492 CACTGCTGTGCTGGCTAACGTGG - Intergenic
986003572 5:3649237-3649259 CACCAGTGTGAAGCCTAATGGGG + Intergenic
992200207 5:74376044-74376066 GATTTCTTTGATTCCTAATGAGG - Intergenic
992580505 5:78170490-78170512 CATTTCTCTGATGACCAATGAGG + Intronic
992602091 5:78411982-78412004 CATTTCTTTGATTACTAATGAGG + Intronic
998066067 5:139159968-139159990 CACTTCTGTGATGCCTAATGAGG - Intronic
999642678 5:153687656-153687678 TACATCTGTGCTGCCTGATGTGG - Intronic
1002756572 6:166245-166267 CACTTGTGTGATTACTAAGGTGG - Intergenic
1003036381 6:2643997-2644019 CACTTCTGTGCTTTCTAAGGGGG + Intergenic
1004281193 6:14281072-14281094 CACGTCTGTGATGACCGATGAGG - Intergenic
1004392312 6:15220107-15220129 CACTTCTCTGATGCCTTAGGTGG + Intergenic
1005284030 6:24305260-24305282 CACTTTTGCCATGCCGAATGAGG - Intronic
1005704095 6:28434572-28434594 GAATTCTCTGATGCTTAATGAGG + Exonic
1008501096 6:52184103-52184125 GACTCCTATGGTGCCTAATGTGG - Intergenic
1010040130 6:71371766-71371788 CACTTATTTGATGACTAATAAGG + Intergenic
1013590442 6:111615370-111615392 GGCTCCTGTGATGCCTGATGCGG - Intergenic
1014816517 6:125941786-125941808 CATTTCTCTGATTACTAATGAGG + Intergenic
1016657166 6:146532970-146532992 CATTTCTTTGATGACTAATGAGG + Intergenic
1016899242 6:149084820-149084842 AACTTCTTTGATTACTAATGAGG - Intergenic
1018037716 6:159895631-159895653 CATTTATTTGATTCCTAATGAGG - Intergenic
1022543541 7:31162608-31162630 CCCTGCTCTGATTCCTAATGAGG + Intergenic
1022796585 7:33736259-33736281 CACTTCTCTCTTGCCTAATGCGG + Intergenic
1024623244 7:51181909-51181931 CACTGCTGTGTTGCCAGATGTGG + Intronic
1024987547 7:55208591-55208613 CCCTTCTCTGATCCCTCATGGGG - Exonic
1025060619 7:55803301-55803323 CATTTCTCTGATGATTAATGAGG - Intronic
1028831717 7:95335551-95335573 TACTTCTGTGATGTGTAGTGAGG + Intergenic
1032100309 7:128970890-128970912 CACTCCTGGGTTGCCTAAGGAGG + Intronic
1032880171 7:136081240-136081262 CATTTCTTTGATTACTAATGAGG + Intergenic
1033384616 7:140860363-140860385 CATTTCTTTGATTACTAATGAGG - Intronic
1033495949 7:141896219-141896241 AACTTCTGTGATCCACAATGTGG + Intergenic
1039666478 8:39537303-39537325 CAAATCTGTGATGTCTACTGTGG + Intergenic
1041329222 8:56705617-56705639 CATTTCTCTGATGACTAATGAGG + Intergenic
1041611048 8:59850001-59850023 CACTTCTCTGGTGACTCATGAGG + Intergenic
1042236188 8:66615393-66615415 CATTTCTCTAATGACTAATGAGG - Intergenic
1043520160 8:81036195-81036217 TACTCATGTGAGGCCTAATGTGG + Intronic
1045131302 8:99157094-99157116 CATTTGTGTGAGGCATAATGAGG + Intronic
1045716870 8:105057166-105057188 CACTTCCATGAGGTCTAATGAGG + Intronic
1046043912 8:108940981-108941003 CATTTCTTTGATTACTAATGAGG - Intergenic
1047516414 8:125558380-125558402 GACTTCTGTGAGGACAAATGGGG + Intergenic
1049020681 8:139955864-139955886 CGCTTCTGTGATGCCTGGTGTGG + Intronic
1051992141 9:23163891-23163913 CTATTCTGTGATGGCTAAGGCGG - Intergenic
1052812206 9:33071435-33071457 CACTTCGGGGAGGGCTAATGTGG + Intronic
1052941685 9:34136362-34136384 CATTTCTGAAATGACTAATGTGG + Intergenic
1053122639 9:35558211-35558233 CAGTTCTGTGAGCCCCAATGTGG + Exonic
1053293380 9:36896771-36896793 CACTTCTGTGATCCCATTTGGGG - Intronic
1057989476 9:99752972-99752994 CATTCCTGTGATGACTGATGAGG + Intergenic
1058130319 9:101244944-101244966 CACTTCTCTAATGACTAATAAGG - Intronic
1059038228 9:110782821-110782843 CACTCCTGTGGTGCCGGATGAGG + Intronic
1059262066 9:112987115-112987137 CATTTCCCTGATGACTAATGAGG - Intergenic
1059526735 9:114998780-114998802 CATTTCCCTGATGGCTAATGAGG - Intergenic
1061265088 9:129500276-129500298 CAGCTCAGAGATGCCTAATGGGG - Intergenic
1061460074 9:130730409-130730431 CTCTTCTTTGATGACTCATGAGG + Intronic
1061939348 9:133875744-133875766 GACGTTTGTGATGGCTAATGTGG + Intronic
1062154564 9:135039488-135039510 CCCTTCTGTGATTCCCAAAGTGG + Intergenic
1186208673 X:7227029-7227051 CACTTCTCTGATTACTAATCAGG + Intronic
1187668643 X:21645490-21645512 ACCTTCTGTGATTCCTAATGAGG - Intronic
1188137851 X:26511913-26511935 CACTGCTGAGATGCAGAATGGGG - Intergenic
1190035723 X:47021674-47021696 CATTTCCGTGATAACTAATGAGG + Intronic
1191129923 X:56996555-56996577 CATTTCTCTAATGACTAATGAGG + Intergenic
1191768060 X:64722338-64722360 CACTTCTGTGATGCAAGAAGCGG - Intergenic
1194616819 X:96114600-96114622 CATTTCCCTGATGACTAATGAGG - Intergenic
1195387327 X:104325470-104325492 CACTTCTGTCATCCTTAGTGAGG + Intergenic
1195831797 X:109067376-109067398 CATTTCTCTGATGGCCAATGAGG + Intergenic
1195960984 X:110386421-110386443 CATTTCTCTGATGGTTAATGAGG + Intronic
1197015564 X:121621506-121621528 CACTCCTGTGATGGTTAATATGG + Intergenic
1197868212 X:131040936-131040958 CAATTCTCTGGTGACTAATGAGG + Intergenic
1199688651 X:150289015-150289037 CATTTCCTTGATGGCTAATGAGG - Intergenic