ID: 998066094

View in Genome Browser
Species Human (GRCh38)
Location 5:139160183-139160205
Sequence ACACAAAAGTTATAGCCTGG AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 135
Summary {0: 1, 1: 0, 2: 0, 3: 11, 4: 123}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
998066092_998066094 23 Left 998066092 5:139160137-139160159 CCACAATCACACACACACACACA 0: 5
1: 278
2: 5762
3: 9403
4: 15115
Right 998066094 5:139160183-139160205 ACACAAAAGTTATAGCCTGGAGG 0: 1
1: 0
2: 0
3: 11
4: 123

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
998066094 Original CRISPR ACACAAAAGTTATAGCCTGG AGG Intronic
901142426 1:7043808-7043830 TCACAAAAGCTCTAGCCTGAGGG - Intronic
901389450 1:8934387-8934409 ACACAAAAGTTAAAAACTCGAGG - Intergenic
903703112 1:25265382-25265404 GCACTGAAGTGATAGCCTGGAGG + Intronic
903712379 1:25335708-25335730 GCACTGAAGTGATAGCCTGGAGG + Intronic
904526841 1:31140108-31140130 ACACAAAAAAATTAGCCTGGCGG + Intergenic
908659805 1:66423919-66423941 GCACATAAGTGATAGCCTGGGGG + Intergenic
910276332 1:85453135-85453157 ACACACAAGATATAGCTTGTTGG - Intronic
910467578 1:87516563-87516585 ACACAAACTGTACAGCCTGGAGG - Intergenic
917760312 1:178149933-178149955 TCACAAAATTTATATACTGGGGG - Intronic
918245546 1:182656464-182656486 CCACAAAACTGATGGCCTGGTGG + Intronic
921842765 1:219846266-219846288 ACACAAAAGTTATGCTCAGGAGG + Intronic
923738510 1:236634611-236634633 ACACAAAAGAAATAGCATAGTGG + Intergenic
1064333228 10:14414182-14414204 ACACAAAGGTTATTGCTTGAGGG + Intronic
1064436634 10:15316577-15316599 GCACAAAAGTTATTGGTTGGAGG - Intronic
1067353571 10:45501698-45501720 AGATAAAAGCTATAGCCTGGGGG + Intronic
1068072579 10:52214282-52214304 GCACCCAAGTTATATCCTGGTGG - Intronic
1070679451 10:78438391-78438413 ACAGAAAAGTTACAGCATGCCGG + Intergenic
1071117786 10:82243750-82243772 ACACAAAGTTTTTAACCTGGAGG + Intronic
1071806606 10:89128560-89128582 ATAAAAATGTTATTGCCTGGAGG + Intergenic
1073663145 10:105499664-105499686 ACAGAAGAGTTATGGCCAGGAGG - Intergenic
1073938939 10:108671031-108671053 AAACAAAGGTTATAACCAGGTGG + Intergenic
1075725973 10:124611080-124611102 ACACCAAAGTAGGAGCCTGGGGG - Intronic
1081566406 11:44263780-44263802 ACACATAAGCTAGAGCTTGGGGG - Exonic
1082708135 11:56518829-56518851 TCACAAAAGTTACAACCTTGTGG - Intergenic
1085549871 11:77359137-77359159 ACACAAAGGTGAGAGCTTGGAGG - Intronic
1085715278 11:78867075-78867097 ACACAAAAGATAAATGCTGGAGG - Intronic
1086143092 11:83520796-83520818 ACACAAGAGTCATAGCATGAAGG - Intronic
1086880785 11:92151232-92151254 CCACAAAACTTAGAGCCAGGGGG - Intergenic
1087071174 11:94082372-94082394 ACATAAAAGGTACAGCTTGGAGG - Intronic
1087675226 11:101153898-101153920 ACACAAAATTTGTAGCTTGGAGG + Intergenic
1093885688 12:24457501-24457523 ACACAACATTTTTAGCCTTGTGG + Intergenic
1095170992 12:39036273-39036295 ACATAAAATTTATAGCCAGGTGG + Intergenic
1104025926 12:125026295-125026317 ATACAAAAGCTATACCCTTGAGG + Exonic
1104225023 12:126823174-126823196 ATACAAAATTCAGAGCCTGGAGG - Intergenic
1104321887 12:127759428-127759450 ACATAAAAGTTCTAGCATGCAGG + Intergenic
1105816888 13:24044163-24044185 ACACCACAGTGATGGCCTGGTGG + Intronic
1109536210 13:63723134-63723156 ACACAAAAGTTAAATGCTTGAGG + Intergenic
1109539890 13:63763152-63763174 ACACAAAAGTTAAATGCTTGAGG - Intergenic
1112048432 13:95621085-95621107 ACAGAAATGCTATAGCCTAGAGG + Intronic
1115337460 14:32255899-32255921 ACACAAAAATAATAGTGTGGTGG + Intergenic
1115523902 14:34260114-34260136 ACAGAAAATATATAGCATGGAGG - Intronic
1115860486 14:37680798-37680820 ATAGAAAAGTGATAGCCTGATGG + Intronic
1117136846 14:52743426-52743448 ACAAAAAAATTATGGCGTGGTGG + Intronic
1122075522 14:99232385-99232407 ACACAAATGTTTTGCCCTGGTGG - Intronic
1124609982 15:31201511-31201533 ACACACAGGTTCTAGGCTGGCGG + Intergenic
1125791335 15:42368435-42368457 ACACACAAGTTATAGTCAGTTGG + Intronic
1125911035 15:43439381-43439403 ACACAAAAATTAGCCCCTGGTGG + Intronic
1129907764 15:79201434-79201456 ACACAAGGGTTAGGGCCTGGAGG + Intergenic
1139971380 16:70777729-70777751 ACACAAAGGTTCTTGCCCGGAGG + Intronic
1148056972 17:44804937-44804959 ACAGCAATGTTATAGCCAGGGGG + Exonic
1153191250 18:2542073-2542095 AGACAAAAGTTAGATTCTGGAGG - Intronic
1154010161 18:10567502-10567524 ACAGGAAAGTGATGGCCTGGGGG + Intergenic
1155001832 18:21695183-21695205 ATACAAAAACTTTAGCCTGGTGG - Intronic
1157324658 18:46660037-46660059 ACAAAAAATTTAAAACCTGGTGG + Intergenic
1159093532 18:63875566-63875588 ATACAAAAGTTAGAGCGTGGTGG - Intronic
1161404154 19:4082388-4082410 ACACAAAGGTTAAAGGCTGGAGG - Intergenic
1166259746 19:41628836-41628858 AGACATATGTTAGAGCCTGGAGG + Intronic
1167164523 19:47789541-47789563 ACACAAAAGTTAAATGCTTGAGG - Intergenic
926456401 2:13073257-13073279 TCACAAAAACTGTAGCCTGGAGG + Intergenic
929082997 2:38139491-38139513 ACTCAAAAGTTATTGCGTGTGGG + Intergenic
939218709 2:139274260-139274282 ATAAAAAAGTTATAGACTGGTGG + Intergenic
940135414 2:150430070-150430092 TAACAAAAGTTATAGCCCAGAGG - Intergenic
940565545 2:155356101-155356123 ACACAACAGTTATATCCTGAAGG - Intergenic
940656005 2:156488936-156488958 ACACAAAATTTTTATCTTGGTGG - Intronic
941532116 2:166682980-166683002 AGCCAAAAGTTGTAGACTGGAGG + Intergenic
1170231488 20:14051711-14051733 ATTCAAAAGGTATATCCTGGTGG + Intronic
1172476721 20:35244176-35244198 AAACAAAAGCTATAGCTAGGAGG + Intronic
1176879670 21:14175684-14175706 ACACAAAAATTATTTCCTTGTGG - Intronic
1177453117 21:21298081-21298103 ATACAAAAATTACTGCCTGGGGG - Intronic
1178640293 21:34339995-34340017 TCAGAAAAGCTAAAGCCTGGGGG - Intergenic
953991853 3:47489941-47489963 ATACAAAAGTTAGGGCATGGTGG - Intergenic
955678423 3:61474177-61474199 ACACAAGTGTTATGGGCTGGCGG + Intergenic
958041689 3:88233891-88233913 ACAAAAATGTAATAGCCGGGTGG - Intergenic
958056613 3:88420432-88420454 GCACAAAAGTTAAAGCATGGGGG + Intergenic
958645250 3:96863072-96863094 AAACAAAAAAAATAGCCTGGGGG - Intronic
958765233 3:98360153-98360175 AAACAAAAGTGGTAGCCAGGGGG - Intergenic
959136359 3:102426764-102426786 CCACAAAAGTTTTAGCCAGTTGG - Intronic
960115614 3:113889392-113889414 ATAGTAAAGTTATTGCCTGGAGG + Intronic
962374297 3:134847340-134847362 ACACACAACTAATAGGCTGGTGG - Intronic
963715890 3:148803445-148803467 ACACACAATTTATAGGCTTGGGG - Intronic
964345572 3:155751350-155751372 AAAAAAAAGTTATAGTCTGTTGG - Intergenic
964657410 3:159083168-159083190 AAAGACAAGCTATAGCCTGGGGG + Intronic
967378110 3:188828124-188828146 ACAAAAAAATAATACCCTGGTGG + Intronic
967865055 3:194183320-194183342 AGACAAAAGACATGGCCTGGAGG + Intergenic
969176104 4:5400209-5400231 GCACAAAAGATATAGGCAGGCGG + Intronic
970932754 4:21531776-21531798 AGTAAAAAGTTATTGCCTGGAGG + Intronic
972836978 4:42883251-42883273 AAAAAAAACTTATACCCTGGTGG - Intergenic
972935660 4:44131830-44131852 ATACAAAAGGTATGGTCTGGAGG + Intergenic
973151100 4:46888994-46889016 ACACAAAAGTTAAATGCTTGAGG + Intronic
973336301 4:48959918-48959940 TAGCAAAAGTTATAGCATGGTGG + Intergenic
974375989 4:61076348-61076370 ACTTAAAAGATATAGGCTGGTGG + Intergenic
975941330 4:79650508-79650530 TTACAAAATTCATAGCCTGGTGG - Intergenic
976959021 4:90943867-90943889 ATACAAAAGTAACAGGCTGGGGG - Intronic
979905520 4:126285477-126285499 ACACTGAAGTTATAATCTGGGGG - Intergenic
980329558 4:131392273-131392295 AAAAAAAAGCTACAGCCTGGAGG + Intergenic
985130495 4:186734005-186734027 ACACCAAGGTCACAGCCTGGGGG + Intergenic
986411005 5:7479559-7479581 ACACAAAAGATAAATCCTTGGGG - Intronic
989495403 5:42106074-42106096 GCAGAAATGTTATGGCCTGGGGG - Intergenic
993232897 5:85261434-85261456 ACAGAAAAGTTACAGCCAGCTGG + Intergenic
994602893 5:101929254-101929276 ACACAAAAGATAAAGGCTGGAGG + Intergenic
995301797 5:110593836-110593858 ACACAAAAGTTAAATGCTTGAGG + Intronic
997802315 5:136876868-136876890 ACTTAAAAGATATAGACTGGTGG + Intergenic
998066094 5:139160183-139160205 ACACAAAAGTTATAGCCTGGAGG + Intronic
999655834 5:153809753-153809775 AGACAAAACTTATACACTGGAGG + Intronic
1000436125 5:161211398-161211420 ACACATTAGTGATTGCCTGGGGG + Intergenic
1000740700 5:164966696-164966718 ACAGAAAAGATATGGACTGGAGG - Intergenic
1001072703 5:168600641-168600663 ACACACTAGTTATTGCCTGAGGG + Intergenic
1001409556 5:171501012-171501034 ATACAAAAAAAATAGCCTGGTGG - Intergenic
1010878051 6:81133437-81133459 ACACAAAAATAATAGCCTTCAGG - Intergenic
1011729210 6:90243503-90243525 TCACAAAAGTTTTGTCCTGGTGG + Intronic
1016369227 6:143354873-143354895 ATAAAAAAGTTATTTCCTGGGGG - Intergenic
1021105171 7:16629932-16629954 ATAGAAAATTTATAGCATGGTGG - Intronic
1024007487 7:45237867-45237889 ACACAGAAATTGGAGCCTGGTGG + Intergenic
1024743215 7:52377504-52377526 AAACAAAAATTATATCCTAGTGG + Intergenic
1028104790 7:86864214-86864236 ACACAAAGGTAATAGCATGAAGG - Intronic
1029315995 7:99714541-99714563 ACACAAAAGGTAAAACGTGGTGG - Exonic
1031295997 7:120004893-120004915 ATACAAAAATTAGAGCGTGGTGG + Intergenic
1033062735 7:138123683-138123705 ACACAACCGTTATTGGCTGGTGG - Intergenic
1033468965 7:141626173-141626195 TCACAAAAGATGTAGCCTGCAGG + Intronic
1033706629 7:143892932-143892954 ACACAAATGTGATAGACTGGTGG - Intronic
1036290431 8:7483583-7483605 ACATAAAACTTACAGCCAGGTGG + Intronic
1036331055 8:7827952-7827974 ACATAAAACTTACAGCCAGGTGG - Intronic
1036912062 8:12765874-12765896 AAATAAAAGTTATCGCCTGTGGG - Intergenic
1037507461 8:19545422-19545444 AGACAAAAGTTATAGGCATGAGG - Intronic
1041398728 8:57419036-57419058 AGGCAAAAGTTAGAGCCCGGGGG + Intergenic
1044978164 8:97687363-97687385 ACAAAAAAGTTATAGTTTTGGGG - Intronic
1046169068 8:110481765-110481787 ACTCAAAATTTATAGCATGAAGG - Intergenic
1047660645 8:127031969-127031991 ACAGAAAACTTAGAACCTGGGGG - Intergenic
1047817696 8:128482917-128482939 ACACAGAATTTACATCCTGGTGG + Intergenic
1055282840 9:74694628-74694650 AGAGAAAACTTATAGCATGGTGG - Intergenic
1055365850 9:75543999-75544021 ACACAAAAGTTTGAGACTCGGGG - Intergenic
1186158866 X:6755229-6755251 ACAAAAATGTTATAACCAGGGGG + Intergenic
1189106629 X:38243320-38243342 AAACATTAGTGATAGCCTGGGGG + Intronic
1194103585 X:89738577-89738599 ACACAAAAGATATAAACTGTTGG - Intergenic
1199791937 X:151163122-151163144 ACACAAAAATAAAAGACTGGTGG + Intergenic