ID: 998068284

View in Genome Browser
Species Human (GRCh38)
Location 5:139176646-139176668
Sequence CATGTGAGGACCCAGTAAGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 5704
Summary {0: 1, 1: 58, 2: 666, 3: 1875, 4: 3104}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
998068284_998068290 17 Left 998068284 5:139176646-139176668 CCTTCTTACTGGGTCCTCACATG 0: 1
1: 58
2: 666
3: 1875
4: 3104
Right 998068290 5:139176686-139176708 CTCCTCGGGCCTCTTTTATAAGG 0: 1
1: 3
2: 41
3: 237
4: 833
998068284_998068289 3 Left 998068284 5:139176646-139176668 CCTTCTTACTGGGTCCTCACATG 0: 1
1: 58
2: 666
3: 1875
4: 3104
Right 998068289 5:139176672-139176694 AAGAGGCAAGGAAGCTCCTCGGG 0: 1
1: 0
2: 7
3: 34
4: 319
998068284_998068291 18 Left 998068284 5:139176646-139176668 CCTTCTTACTGGGTCCTCACATG 0: 1
1: 58
2: 666
3: 1875
4: 3104
Right 998068291 5:139176687-139176709 TCCTCGGGCCTCTTTTATAAGGG 0: 3
1: 16
2: 144
3: 568
4: 1236
998068284_998068288 2 Left 998068284 5:139176646-139176668 CCTTCTTACTGGGTCCTCACATG 0: 1
1: 58
2: 666
3: 1875
4: 3104
Right 998068288 5:139176671-139176693 GAAGAGGCAAGGAAGCTCCTCGG 0: 1
1: 1
2: 10
3: 91
4: 521
998068284_998068287 -9 Left 998068284 5:139176646-139176668 CCTTCTTACTGGGTCCTCACATG 0: 1
1: 58
2: 666
3: 1875
4: 3104
Right 998068287 5:139176660-139176682 CCTCACATGCAGAAGAGGCAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
998068284 Original CRISPR CATGTGAGGACCCAGTAAGA AGG (reversed) Intronic
Too many off-targets to display for this crispr