ID: 998068287

View in Genome Browser
Species Human (GRCh38)
Location 5:139176660-139176682
Sequence CCTCACATGCAGAAGAGGCA AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
998068284_998068287 -9 Left 998068284 5:139176646-139176668 CCTTCTTACTGGGTCCTCACATG 0: 1
1: 58
2: 666
3: 1875
4: 3104
Right 998068287 5:139176660-139176682 CCTCACATGCAGAAGAGGCAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
998068287 Original CRISPR CCTCACATGCAGAAGAGGCA AGG Intronic
No off target data available for this crispr