ID: 998068288

View in Genome Browser
Species Human (GRCh38)
Location 5:139176671-139176693
Sequence GAAGAGGCAAGGAAGCTCCT CGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 624
Summary {0: 1, 1: 1, 2: 10, 3: 91, 4: 521}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
998068284_998068288 2 Left 998068284 5:139176646-139176668 CCTTCTTACTGGGTCCTCACATG 0: 1
1: 58
2: 666
3: 1875
4: 3104
Right 998068288 5:139176671-139176693 GAAGAGGCAAGGAAGCTCCTCGG 0: 1
1: 1
2: 10
3: 91
4: 521

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
998068288 Original CRISPR GAAGAGGCAAGGAAGCTCCT CGG Intronic
900381147 1:2384720-2384742 GGAGAGGCAGGGAAGCTCACAGG - Intronic
901121991 1:6903263-6903285 AAAGAGGCAAGGAAGGTTTTGGG + Intronic
901687616 1:10952201-10952223 GAAGCTGCAGGGAAGCTGCTGGG + Intronic
901733486 1:11297290-11297312 GAAGGAGCAAGGCAGCTCCCTGG - Intergenic
902111051 1:14078657-14078679 GAAGGGGCAAGGCAGCTCTCTGG + Intergenic
902530830 1:17089695-17089717 GACGGGGTAAGGAGGCTCCTGGG - Intronic
902713058 1:18253701-18253723 GAGGAGGCAATGAAGCCTCTGGG + Intronic
903185059 1:21624185-21624207 GAGGAGGGAAGGAGGGTCCTGGG + Intronic
903648623 1:24909920-24909942 GGAGAGGCGAGGAAGCTTGTTGG + Intronic
904295497 1:29517449-29517471 GAACAGGCAGAGAAGCTTCTGGG - Intergenic
904836324 1:33339587-33339609 GCAGAGGCAGGGAGGCTCCTAGG + Intronic
904997333 1:34641198-34641220 CAAGACTCAAGGAAGCTCCCTGG + Intergenic
905172444 1:36117080-36117102 GCAGAGGCAAGCAAGCAGCTGGG - Intronic
906068708 1:43001815-43001837 GAAGGGGCAAGGCAGCTCTCTGG + Intergenic
906114544 1:43348009-43348031 GAAGAGTCAAGGGTGCTTCTAGG - Intronic
906259334 1:44374658-44374680 GAAGAGGCAAGGGATCTCTCTGG - Intergenic
906526087 1:46494017-46494039 GGAGAGGCCAGGAACATCCTGGG + Intergenic
906898632 1:49807869-49807891 GAAGGGGCAAGGCAGCTCTCTGG - Intronic
907547110 1:55271723-55271745 GAAGAGACAAGGCAGCTCTCTGG - Intergenic
910514726 1:88047161-88047183 GAAGGGGCAAGGTAGCTCTCTGG - Intergenic
910544646 1:88400128-88400150 GAAGGGGCAAGGCAGCTCTCTGG + Intergenic
911461037 1:98191437-98191459 GGAGAGGGAAGGATGCTCCCTGG + Intergenic
912397615 1:109359219-109359241 GAAGGGGCAAGGGAGCTCTCGGG + Intronic
912700109 1:111871741-111871763 AAAGAGTCAAGGATGATCCTTGG + Intronic
912855018 1:113160092-113160114 GAAGAGACAATGAAGCCTCTGGG - Intergenic
912908720 1:113734815-113734837 GAAGGGGCAAGGGAGCTCTTAGG - Intronic
913405526 1:118486612-118486634 GAAGAGGGAAGGAAGCCTCTTGG - Intergenic
913495034 1:119420734-119420756 GAAGAAGGAAGGAATTTCCTAGG - Intronic
913505478 1:119512942-119512964 GAAGAAGGAAGGAATTTCCTAGG - Intronic
913511957 1:119570348-119570370 GAAGAAGGAAGGAATTTCCTAGG - Intergenic
913516180 1:119607511-119607533 GAAGAAGGAAGGAATTTCCTAGG - Intergenic
914738553 1:150442747-150442769 AAATAGGCAAGGAAACTTCTAGG - Intronic
915330939 1:155112035-155112057 GCAGAGGGAAGGAAGATCTTGGG + Intergenic
915582606 1:156823995-156824017 GATGAGGCAAGTAGGTTCCTAGG + Intronic
916317929 1:163471096-163471118 AAAGAGGCTAGGAACCTTCTAGG - Intergenic
917241729 1:172956052-172956074 AAAGAGGCAAGGAAGCTCTCTGG - Intergenic
918075760 1:181170187-181170209 GGGGAGTCAAGGAAACTCCTGGG - Intergenic
919111809 1:193229453-193229475 GAAGGAGCAAGGAAGCTCTCTGG - Intronic
919256835 1:195137108-195137130 GGAGAGGCAAGGAGGCATCTGGG - Intergenic
919837055 1:201582346-201582368 GCAGAGGCAACCAAGATCCTGGG + Intergenic
920008329 1:202849750-202849772 GAAGAGGTATGGCAGCTGCTAGG + Intergenic
920686778 1:208115040-208115062 TATGAGGCAGGAAAGCTCCTAGG + Intronic
921770545 1:219033765-219033787 AAAGAGTCAAAGAAACTCCTAGG + Intergenic
922422829 1:225471138-225471160 GAAGCAGGAAGGAAGCCCCTTGG + Intergenic
922423583 1:225475067-225475089 GAAAAGGCAAGGACGCCCGTCGG + Intergenic
923393595 1:233537958-233537980 GAAGAGGCAAGAGAACTCTTTGG - Intergenic
923419188 1:233795897-233795919 GAAAAGGCAGGGAAGCTGGTGGG + Intergenic
923478339 1:234358536-234358558 GAAGAGGCAAGGGAGCTCTCTGG - Intergenic
923961373 1:239088064-239088086 GAAGAGGCAAAGCAGATCCCTGG + Intergenic
924072657 1:240297930-240297952 GAAGGGACAAGGGAGCTGCTTGG + Intronic
924209321 1:241748444-241748466 AAAGGGGCAAGGCAGATCCTTGG + Intronic
924604772 1:245523627-245523649 GAAGGGGCAAACAAGCTCCCTGG + Intronic
924814051 1:247427165-247427187 GAAGAGGCAAGGCAGCTCTCTGG + Intronic
924910954 1:248512589-248512611 GAAGAGGCAAGAAAGCTCTCTGG - Intergenic
924913147 1:248535451-248535473 GAAGAGGCAAGAAAGCTCTCTGG + Intergenic
1062880300 10:973007-973029 AAAGAGGCAAGGAGGCTAATGGG + Intergenic
1063388686 10:5634237-5634259 GAAGGGGCAAGGCAGCTCTCTGG + Intergenic
1063957550 10:11280814-11280836 CAAGAGGCAGGGGAGGTCCTAGG + Intronic
1064102596 10:12476427-12476449 GAACAGGGGAGGAAGCCCCTTGG + Intronic
1064699082 10:18000154-18000176 GAAGGGGCAAGGGAACTCCTTGG + Intronic
1065361029 10:24889160-24889182 GAAGGGGCAAGCAAGCTCTTTGG - Intronic
1066019923 10:31288170-31288192 GAATGGCCAAGGAAGCTTCTGGG - Intergenic
1066539383 10:36428864-36428886 GAAGAAGCAAGGCAGCTCTCTGG - Intergenic
1066645988 10:37609665-37609687 GAAGAGGCAAGGCTTCTTCTGGG - Intergenic
1066680107 10:37929955-37929977 GAAGGGGCAAGGGAGCTCTCTGG + Intergenic
1068340569 10:55696586-55696608 TAAGGGACAAAGAAGCTCCTGGG - Intergenic
1068790812 10:61029284-61029306 GAAGAAGCAAGGAAGCTCTCTGG + Intergenic
1069096639 10:64267357-64267379 GAAGAGGCGAAGGAGCTCCCTGG - Intergenic
1069859130 10:71459613-71459635 GAAGAGGCCTAGAGGCTCCTGGG + Intronic
1070532471 10:77349232-77349254 GAAGGGGCAAGGCAGCTCTCTGG - Intronic
1070778834 10:79125993-79126015 GAAGGGCCAAGGAAGCTCTGGGG + Intronic
1071000856 10:80828747-80828769 GAAGATGCAAGGAGGGTACTGGG - Intergenic
1072958985 10:99912669-99912691 GAGGAGGGAAGGAAACACCTAGG - Intronic
1074126094 10:110530137-110530159 GAAGAGGCAGGGAGGCTGGTCGG - Intergenic
1074391736 10:113063690-113063712 GGAGAGGCAAGGAATCACCCGGG - Intronic
1074606270 10:114971125-114971147 GAAGGGGCAAGGCAGCTCTCTGG + Intronic
1077402437 11:2365889-2365911 GAAGAAGCAAGGAGGCTCCAAGG + Intergenic
1077429168 11:2507509-2507531 GAAGAGAAAAGGATGCTGCTGGG + Intronic
1077585207 11:3446272-3446294 GAAAATGCAAGGAAGGTGCTTGG - Intergenic
1078107993 11:8370700-8370722 GAGGAGACAAGGTAGCTCCTGGG + Intergenic
1079963821 11:26956106-26956128 GAAGAGACAAGGCAGCTCTCTGG + Intergenic
1080095764 11:28404483-28404505 GAAGGGGCAAGGCAGCTCTCTGG + Intergenic
1080392118 11:31857980-31858002 GAAGAGGCATGGCAGCTCTCTGG - Intronic
1080597086 11:33782668-33782690 GAAGAGGCAAGGCAGCTTTCTGG - Intergenic
1081163513 11:39781853-39781875 GAAGGGTCAAGGCAGCTCTTTGG - Intergenic
1081265315 11:41014110-41014132 GAAGGGGCAAGGAAGCTCTCTGG + Intronic
1081280333 11:41202016-41202038 AGTGAGGCAAGGAGGCTCCTAGG - Intronic
1082087063 11:48058863-48058885 GAAGAGGCCAGGGAGCTGCCGGG - Intronic
1082777396 11:57257533-57257555 GAAGGGGCAAGGCAGCTCTTTGG - Intergenic
1084000381 11:66292508-66292530 GAAGAGGAAGGGAGGCGCCTGGG + Intronic
1084627265 11:70318026-70318048 GAAGAGGCAAGGGAGCTGAAAGG - Intronic
1085392835 11:76191255-76191277 GAAGAGACAATGACGCTACTGGG - Intronic
1085906501 11:80770502-80770524 GAAAGGGCAAGGCAGCTCTTTGG - Intergenic
1086038147 11:82441862-82441884 GAGCAGGCAAGGGAGCCCCTGGG + Intergenic
1086855193 11:91857884-91857906 GCAGAGAGAAAGAAGCTCCTGGG - Intergenic
1086891678 11:92265754-92265776 GAAGGGGCAAGGCAGCTCTCTGG + Intergenic
1087813310 11:102631738-102631760 GAGGGGGCAAGGCAGCTCCCCGG - Intergenic
1087830323 11:102813084-102813106 GAAGAGGAAAGGAAGAGCATAGG - Intergenic
1087889490 11:103520529-103520551 GAAGAGGCAAGGGAGCTCTCTGG - Intergenic
1088823044 11:113472900-113472922 GAAAAGCCCAGGAAGATCCTGGG + Intronic
1088840678 11:113625017-113625039 GAAGGGGCAAGGCAGCTCTCAGG + Intergenic
1089659490 11:119976801-119976823 GAAGAGGCAAGGGATCTCTGTGG + Intergenic
1089663247 11:119999414-119999436 GAAAGGGGAAGGCAGCTCCTTGG - Intergenic
1090188052 11:124751242-124751264 GAAGAGGAAAGGAAGATACACGG + Intronic
1090798788 11:130157966-130157988 TGAGAGGGAAGGAAACTCCTGGG + Intergenic
1090899995 11:131021006-131021028 GAAAAGGCAAGGCAGCTCTCTGG - Intergenic
1091218630 11:133918240-133918262 CAATAGGTAAGGGAGCTCCTCGG - Intronic
1091306326 11:134538592-134538614 GAGGAGTCAAGGACGCACCTGGG + Intergenic
1091768703 12:3138026-3138048 GAGAAGGCAAGGATGGTCCTGGG - Intronic
1093170912 12:15859387-15859409 GAAGAAGCACGGAAAGTCCTCGG + Intronic
1094350171 12:29515509-29515531 GAAGAAGCAAGGAGGATTCTGGG - Intronic
1094413854 12:30197440-30197462 AAACAGGCAAGGGAGCCCCTCGG + Intergenic
1095354652 12:41257324-41257346 GAAGAGGCAAGGCAGCTCAGAGG + Intronic
1095377762 12:41551220-41551242 GAAGAGGCAAGATAGCTCTCTGG + Intronic
1095542418 12:43325978-43326000 GAAAAAGGAAGGTAGCTCCTGGG + Intergenic
1095723782 12:45430008-45430030 GATTAGGCACGGAACCTCCTAGG - Exonic
1095775142 12:46002371-46002393 GAAGAGGCAAGGCAGCTGTCTGG - Intergenic
1096748315 12:53743053-53743075 GAAGAGGCCTGCAAGCACCTTGG - Intergenic
1097233844 12:57526997-57527019 AAAGAGGCAAGGAGGTTGCTGGG - Exonic
1097741530 12:63248643-63248665 AAAATGGCAAGGAAACTCCTTGG + Intergenic
1099139591 12:78955561-78955583 GAAGGGGTAAGCAAGCTTCTTGG + Intronic
1099302084 12:80909594-80909616 GAAGGGGCAATGAAGCTACTTGG + Intronic
1099652050 12:85441229-85441251 GAACAGGCAAAAAAGCTCCCTGG - Intergenic
1099931702 12:89082822-89082844 GAAGAGGAAAGGGAACTCCTTGG + Intergenic
1100118442 12:91339245-91339267 GAAGAGTCAAGGAAGCTGTCAGG - Intergenic
1100188806 12:92168034-92168056 GAAGGGGCAAGGAAGCTCTCTGG + Intergenic
1100806954 12:98295543-98295565 TAAGAGGCAGGCAAGCTTCTGGG - Intergenic
1101546608 12:105719306-105719328 GAAGGGGCAAGGGAGCTCTTGGG + Intergenic
1101634445 12:106526658-106526680 AAAGAGGGAAAGAAGCTCCTGGG - Intronic
1101961223 12:109251960-109251982 GAAGAGTCCAGGAACCTGCTGGG - Intronic
1102603592 12:114051912-114051934 GAAGAGGCAAGGTAGCTCCGAGG + Intergenic
1102872866 12:116427545-116427567 GAGATGGCAAGGAAGCTCCTGGG + Intergenic
1102904394 12:116662933-116662955 GCAGAGGTCAGGAAGCTCCCCGG + Intergenic
1103301144 12:119927408-119927430 GAAGGGGCAAGGGAGCTCTGTGG - Intergenic
1103729826 12:123020042-123020064 GAAGTGGCAGGGAAGGGCCTGGG + Intronic
1103764049 12:123269567-123269589 GCAGAGGCCAGGAAGCTCCTGGG + Intronic
1103867164 12:124062447-124062469 GAAGATTCAAGGATGTTCCTAGG + Intronic
1104212575 12:126703778-126703800 GAAGAGGGAAGGAATCTCACAGG - Intergenic
1104994593 12:132645544-132645566 AAAGAGGCAAGGAAGAGCTTGGG + Intronic
1105350144 13:19607598-19607620 GAAGTGGGAAGGAGGCTTCTGGG - Intergenic
1106401826 13:29438524-29438546 GAAGGGGCAAGGCAGCTCCCTGG + Intronic
1107136735 13:36953088-36953110 GAAAAGACAAGGAAGGCCCTGGG - Intronic
1107166526 13:37288276-37288298 GAACAGCCAAGGAAGCTCCTGGG + Intergenic
1108864218 13:54902923-54902945 GGAAGGGCAAGGAAGCTACTGGG + Intergenic
1110161935 13:72388899-72388921 GAAGAGGCAAGGCAGTTCTCTGG - Intergenic
1110970613 13:81756719-81756741 GAAGAGGCAAAGCAGATCCCTGG - Intergenic
1111159876 13:84380854-84380876 GGATAGGCAAGGAAGATCCTGGG + Intergenic
1111325287 13:86686356-86686378 GAAGAGGGCAGGAGGCTTCTTGG + Intergenic
1111812197 13:93104982-93105004 GAAGAGGCAACGCAGCTCTCTGG - Intergenic
1111846877 13:93521597-93521619 GAAGAGCCATGGAAGCCCATGGG - Intronic
1112611271 13:100957139-100957161 GAAGAGGGAAGGAAGCACTTAGG - Intergenic
1112821196 13:103338223-103338245 GAAGAGGCAAGGCAGCTGTCTGG + Intergenic
1113501544 13:110779373-110779395 GAAGGGGCAAGGGAGCTCTCTGG + Intergenic
1113822845 13:113227372-113227394 GAAGAGGCAGGGGAGCTCTCTGG + Intronic
1114562223 14:23601579-23601601 GAAGAGGCAAGGCAGCTCTCTGG - Intergenic
1114679830 14:24475166-24475188 GAAGAGTTGAGGAACCTCCTTGG + Intergenic
1115133675 14:30083879-30083901 GAAGAGGCAAGGAAGGTCTCAGG + Intronic
1115668195 14:35577402-35577424 GAAGAGTCAAGTAAGCTCTCTGG - Intronic
1116857042 14:49961735-49961757 GAAAAGTCAAGGCAGGTCCTGGG - Intergenic
1117158453 14:52964000-52964022 GAAGAGGCAGGGAAAAGCCTGGG - Intergenic
1117197545 14:53355589-53355611 GAAGAGGAAAGGAAGCAAATTGG - Intergenic
1117338886 14:54777340-54777362 GAATAGGCAAGGAAGCTTCCTGG + Intronic
1117674380 14:58140923-58140945 GAAGGGGCCAGGGAGCTCTTGGG - Intronic
1117679203 14:58185821-58185843 GAAGGGGCAAGGCAGCTCCCTGG - Intronic
1117965762 14:61205485-61205507 GGAGAGGCAAGGAAGCCCAGTGG + Intronic
1118049940 14:62015678-62015700 GAGGAGGCAAGGCGGCTTCTGGG - Intronic
1118148051 14:63162086-63162108 GAAGGGGCAAGGCAGCTCTCTGG - Intergenic
1118346821 14:64947072-64947094 GAAGAGAGAAGGAAGGCCCTGGG - Exonic
1119911473 14:78353450-78353472 GAAGGGGCAAGGCAGCTCTCCGG + Intronic
1120180200 14:81335460-81335482 CAACAGGAAAGGAAGCTGCTGGG + Intronic
1120846713 14:89132661-89132683 GAAGGGGCAAGGCAGCTCTCTGG - Intronic
1121303545 14:92890502-92890524 GAAGGGGCAAGGCAGCTCTCTGG - Intergenic
1121863586 14:97341766-97341788 GAAGAGGCAAGGGAACAGCTGGG - Intergenic
1121927590 14:97942728-97942750 GAAGGGACAAGGCAGCTCTTGGG + Intronic
1122595118 14:102885149-102885171 GCCGAGGAAAGCAAGCTCCTGGG + Intronic
1124572580 15:30878648-30878670 GAAGGGGCAAGGCAGCTCTCTGG - Intergenic
1124853481 15:33363467-33363489 CTAGTGGCATGGAAGCTCCTAGG + Intronic
1124888963 15:33713821-33713843 GAAGAGGCAAGGCAGCTCTCTGG + Intronic
1125346820 15:38726874-38726896 GAATAGGAAAGGAAACTCCAGGG + Intergenic
1126799916 15:52289211-52289233 GAAGAGGCTGGGAAGGACCTTGG - Intronic
1127057002 15:55142344-55142366 GAAGGGGAAAGGGAGCTCTTAGG - Intergenic
1128514149 15:68331779-68331801 GATGAGGCACAGAAGCTCCTGGG + Intronic
1128893766 15:71354329-71354351 GGAGAGGCCAGGGAGCTCCGAGG + Intronic
1128965251 15:72051843-72051865 GAGGAGGCAGGCAGGCTCCTGGG + Intronic
1129552226 15:76465299-76465321 GAAGGGGCAAGGCAGCTCTCTGG + Intronic
1129968893 15:79760052-79760074 GGAGAGGCAAGGACTGTCCTTGG - Intergenic
1130423165 15:83768652-83768674 CTAGAGGCATGGAAGCTCCAGGG + Intronic
1130980050 15:88806108-88806130 GAAGAGGAAATGAAGCCTCTGGG - Intronic
1131263710 15:90903326-90903348 GCAGAGGCGACAAAGCTCCTCGG + Exonic
1131393166 15:92065946-92065968 TCAGAGGCCAGGAAGCTCCCAGG + Intronic
1131526285 15:93155288-93155310 GAAGGGGTAAGGCAGCTCCCTGG - Intergenic
1133731611 16:8582974-8582996 GAAAAGGAAAGGAAACTGCTAGG + Intronic
1134903485 16:17959630-17959652 GAAGAGGCTAGGAACTTCCCTGG + Intergenic
1135036068 16:19077851-19077873 GGAAAGGAAATGAAGCTCCTGGG - Intronic
1135496534 16:22956536-22956558 AAAGGGCCAGGGAAGCTCCTGGG + Intergenic
1135503144 16:23014375-23014397 TGAGAGTCAGGGAAGCTCCTGGG - Intergenic
1140144949 16:72297642-72297664 GAAGGGGCAAGGCAGCTCTCTGG - Intergenic
1140681926 16:77393582-77393604 GAAGAAGCAAGGCAGCTCTCTGG - Intronic
1140835983 16:78794161-78794183 GAAGAAGCAAGGCAGCTTCTGGG - Intronic
1140916620 16:79499609-79499631 GAAGGGACAAGGCAGCTCTTTGG - Intergenic
1141244045 16:82290093-82290115 GAACAGGGAATGAAGCTCCCCGG - Intergenic
1141348113 16:83267233-83267255 GAAGGTGCAGGGAAGCTCCAGGG + Intronic
1141405056 16:83785346-83785368 GGAGAGGCAAGGCAGCTCTCTGG + Intronic
1141663266 16:85453072-85453094 GATGAGTCACGGAAGCTCCTGGG + Intergenic
1142689009 17:1593558-1593580 GAAAAGACAAGAAGGCTCCTGGG - Intronic
1142878847 17:2869029-2869051 GAAGGGGCAAGGGAGCTCTCAGG + Intronic
1143346975 17:6256937-6256959 GAATAAGAAAGGAAGCTCCCTGG - Intergenic
1144095792 17:11899741-11899763 GAAGATGAAAGTCAGCTCCTCGG + Intronic
1144342366 17:14320391-14320413 GAAAAGGCAAGGAGGTTCCTAGG + Intronic
1144517157 17:15926600-15926622 GAATGGGCAAGGCAGCTGCTAGG + Intergenic
1144661913 17:17076415-17076437 GAAGAGGAAAGGGAGCTCCCGGG - Intronic
1145869726 17:28263840-28263862 GAAGTGGGAAGGAAGCTTCCAGG + Intergenic
1146647727 17:34586211-34586233 GAAGAAGTAAGGAAGACCCTGGG - Intronic
1147042631 17:37730344-37730366 TAAGAGGCAGAGAAGCCCCTAGG - Intronic
1147185596 17:38711590-38711612 GAAGAGGCAAGGATGCGTCTGGG - Intronic
1147446768 17:40479509-40479531 GAGGAGGCAGGGAAGCTGCCTGG + Intronic
1147981165 17:44275083-44275105 TAAGAGTCAAGGAAGCAACTGGG - Intergenic
1148162938 17:45461924-45461946 GCAGAGGCAAGGAAGCTGGCTGG + Intronic
1148796157 17:50197855-50197877 GAAGAGGTAAGGAAGACCCCAGG + Intronic
1148830401 17:50426948-50426970 GCAGAGGCAGTGAAGCTACTGGG - Intronic
1150394168 17:64808578-64808600 GCAGAGGCAAGGAAGCTGGCTGG + Intergenic
1150611682 17:66738699-66738721 GAAGAGCAAAGGAAGCCACTTGG + Intronic
1151532792 17:74717849-74717871 GAAGGGGCAAGGCAGCTCTCTGG - Intronic
1151822140 17:76502119-76502141 GAAGAGAGAAGGAACCACCTGGG - Intergenic
1152299556 17:79487094-79487116 GAGGAGGGAAGGAAGCCTCTGGG + Intronic
1152334799 17:79694689-79694711 ACAGAAGAAAGGAAGCTCCTGGG - Intergenic
1152477315 17:80526663-80526685 GAAGTGGCCGGGAAGCTCCCCGG + Intergenic
1153409859 18:4781612-4781634 GAGCAGGCAAGGGAGCCCCTGGG + Intergenic
1153528559 18:6020716-6020738 GAGGAGTCAAGGACGCTCCTAGG + Intronic
1155180315 18:23339786-23339808 GAAGAAGCAAGGCAGCTCTCTGG + Intronic
1155374405 18:25139904-25139926 GAAGGGGCAAGGAAGTTATTCGG - Intronic
1155415060 18:25589121-25589143 GAAGAGACTATGTAGCTCCTTGG - Intergenic
1155650921 18:28140529-28140551 GAAGAGGCAAGGAATGTCTCTGG - Intronic
1155765676 18:29629517-29629539 GGAGAGGCAAGAACCCTCCTAGG - Intergenic
1155798533 18:30071386-30071408 GAAGTGGCAAGGAAACTCACTGG + Intergenic
1157182130 18:45507208-45507230 GTAGAGTCAGGGAAGGTCCTAGG + Intronic
1157193493 18:45600647-45600669 GAAGAGGCTGGGCAGGTCCTTGG + Intronic
1157445135 18:47738774-47738796 GAAAGGGCAAGGCAGCTCCCTGG + Intergenic
1157942263 18:51942286-51942308 AGATAGGCAAGGAACCTCCTTGG + Intergenic
1158056091 18:53282415-53282437 GAAGAGGCAAGAAGGCTTCTTGG + Intronic
1158065451 18:53401826-53401848 GAAGAAGCCTGGAAGATCCTTGG + Intronic
1158624819 18:59061981-59062003 GGAGAAGCAAGAGAGCTCCTTGG + Intergenic
1159477720 18:68944517-68944539 GAAGGGGCAAGGCAGCTCCCTGG + Intronic
1159584727 18:70272853-70272875 GAACAGGAAAGGAAGCCCGTGGG - Intergenic
1161768816 19:6220624-6220646 GCAGCGGCAAGGCAGCTCCACGG - Intronic
1163222857 19:15934453-15934475 GAAGGGCCCAGGAAGCTCCAAGG + Exonic
1163355020 19:16804788-16804810 AAAGGGGCAAAGAAGCTCCCTGG + Intronic
1163636678 19:18440198-18440220 GAAAAGGCATGGAAGCTTCACGG + Intergenic
1164010134 19:21194868-21194890 CAAGAGGCAAGGCAGGCCCTGGG + Exonic
1164432945 19:28203995-28204017 TAAGAGGGAAAGAAGCTACTTGG + Intergenic
1164906697 19:31973887-31973909 GCAGAGTCAAGGCAGCTACTAGG + Intergenic
1165119742 19:33551475-33551497 GAAGGGGCCAGGGAGCTCTTTGG + Intergenic
1167269196 19:48498442-48498464 GATGTGACAAGGAACCTCCTGGG - Exonic
1167949636 19:53015848-53015870 GAGCAGGCAAGGAAGCCCCTGGG + Exonic
1168268099 19:55233816-55233838 GAAGACGCAAGGTGGCTTCTTGG + Intronic
1168291168 19:55358425-55358447 GAAGAGGGAAGGAATCTCCCAGG - Exonic
925504414 2:4544729-4544751 GAAGAGGCAAGGATCTCCCTGGG + Intergenic
925533382 2:4889401-4889423 GAAGAGACAAACAAGGTCCTTGG + Intergenic
926041741 2:9679205-9679227 GAAGGGGCAAGGCAGCTCTCTGG - Intergenic
926207020 2:10841042-10841064 GAAGAGGCCAGGAGGATCCCCGG + Intergenic
927204149 2:20596452-20596474 AAAGTGGCAAGGCAGCTCCCTGG - Intronic
927292969 2:21422570-21422592 GAAGTGGCAAGGGAGCTCTCTGG - Intergenic
927326525 2:21811625-21811647 GAAGAGACAAGGAAACTCTTTGG - Intergenic
927720588 2:25379418-25379440 GGAGAAGCAAGGAAGCCCCTGGG - Intronic
928653109 2:33422566-33422588 GAAGGGACAAGGCAGCTCCTTGG - Intergenic
928755460 2:34519296-34519318 GAAGGGGCAAGGGAGCTCTCTGG + Intergenic
929446297 2:42003973-42003995 GAAGGGGCAAGGTAGCTCTCTGG + Intergenic
929686762 2:44041738-44041760 GAAGAGGCAAGAAATATCTTTGG - Intergenic
930019714 2:46994193-46994215 GAAGGAGCAAGGGGGCTCCTTGG + Intronic
930157719 2:48122945-48122967 GAAGGGGCAAGGGAGCTCTCTGG - Intergenic
930638350 2:53830013-53830035 GGAGTGGCAGGCAAGCTCCTGGG - Intergenic
931146627 2:59526658-59526680 GAAGGGGCAAGGCAGCTCTCTGG - Intergenic
931260618 2:60615264-60615286 GAAGGGCCAAGGCAGCTCCCTGG + Intergenic
932217340 2:69975422-69975444 GAGGAGGCAGGGAAGCTTCTCGG - Intergenic
932941323 2:76170137-76170159 GAAAAGGCAAGGCAGCTATTTGG - Intergenic
933042495 2:77487280-77487302 GCAGAGGCAAGGAGCTTCCTGGG - Intronic
933239199 2:79900648-79900670 GAAGAAGGAAGGAAGCTCTGTGG + Intronic
933337939 2:80984145-80984167 CATGAGGGCAGGAAGCTCCTGGG - Intergenic
933842916 2:86302114-86302136 GGGGAGGGAAGGAAGCTGCTTGG - Intronic
935011222 2:99137941-99137963 GAAGGGGCAAGGGAGCTCTCTGG - Intronic
935586971 2:104809444-104809466 GAAGGGGCAAGGAAGCCCCCTGG - Intergenic
937452301 2:122011552-122011574 AACGAGGGCAGGAAGCTCCTGGG + Intergenic
937468697 2:122156939-122156961 TAACAAGCAAGGAAGCTGCTAGG + Intergenic
937589887 2:123600155-123600177 GAAGATGCAAGGGAACTTCTTGG - Intergenic
937635724 2:124153578-124153600 GATGAGGCAAGAAAGCCCCCCGG + Intronic
938109013 2:128551941-128551963 GCAGAGGCAAGAAAGGGCCTTGG - Intergenic
938276168 2:130026079-130026101 GAAGAGCCAAGGAGGCACCAGGG - Intergenic
938327127 2:130416835-130416857 GAAGAGCCAAGGAGGCACCAGGG - Intergenic
938362812 2:130704642-130704664 GAAGAGCCAAGGAGGCACCAGGG + Intergenic
938439200 2:131311255-131311277 GAAGAGCCAAGGAGGCACCAGGG + Intronic
938556857 2:132432288-132432310 GAAGGGGCAAGGCAGCTCTCTGG + Intronic
938775533 2:134538237-134538259 CAAGAGGCAAGGCAGCTCTCGGG - Intronic
938945762 2:136210746-136210768 GTAGAGGGAAGGAAGTGCCTTGG + Intergenic
939060291 2:137413843-137413865 AAAGGGGGAAGGAAGCTGCTGGG + Intronic
939555629 2:143669627-143669649 GAAGGGGCAAGGCAGCTCTCTGG + Intronic
939982903 2:148802143-148802165 GAAAGGGCCATGAAGCTCCTGGG + Intergenic
940848606 2:158667180-158667202 GCAGAGGCAAGCAAGCTGCCTGG - Intronic
941722928 2:168831245-168831267 GAAGGGGCTAGGCAGCTCTTGGG + Intronic
941918045 2:170824643-170824665 GAAGCTGCAAGGAAGGCCCTGGG + Intronic
942586910 2:177490660-177490682 AAAAAGGCAAGAAAGCTCCTGGG - Intronic
942602725 2:177657948-177657970 GAACTGGCCAGGAAGCTGCTGGG + Intronic
942955975 2:181773813-181773835 AAAGGGGCAAGGTAGCTCTTTGG - Intergenic
943129324 2:183837635-183837657 CAAGAGGCAGGCAGGCTCCTGGG + Intergenic
944693388 2:202178872-202178894 AAAGTTGCAAAGAAGCTCCTGGG + Intronic
945650415 2:212551648-212551670 GAAGGGGCAAGGCAGCTCTCTGG + Intergenic
945791386 2:214309856-214309878 GTAGAGGCAAGGCAGCAGCTGGG + Intronic
945940779 2:215947542-215947564 GATTAGCCAAGGAAGCTCTTTGG - Intronic
946472466 2:219974971-219974993 GAACAGGCAACTCAGCTCCTGGG + Intergenic
946878180 2:224151004-224151026 GAAGGGGCAAGGCAGCTCCCTGG - Intergenic
947063123 2:226189218-226189240 GAAGAGGCCAGGAAGCAGCTCGG + Intergenic
947740135 2:232481169-232481191 GAAGAGGCCAGGGGGCTGCTTGG + Intronic
947936466 2:234009064-234009086 AAAGAGGCAAGCAAGTTCCCAGG - Intronic
948582957 2:239000344-239000366 GAAGGGGCAAGGGAGCTCTCTGG + Intergenic
1168928356 20:1600944-1600966 GAAGCGGGAAGGAAATTCCTTGG + Intronic
1168936953 20:1673820-1673842 GTGGAGGCAGGGAGGCTCCTGGG + Intergenic
1169444567 20:5660536-5660558 GAAGGTGAAAGCAAGCTCCTTGG + Intergenic
1169798766 20:9494203-9494225 CAAGAGGCAAGAAGGATCCTTGG + Intergenic
1170020090 20:11827780-11827802 GAAGGGGCAAGGCAGCTCTCTGG - Intergenic
1170075092 20:12410463-12410485 AAAGGGGCAAGGCAGCTCCCTGG - Intergenic
1170468755 20:16647472-16647494 GCAGAGACAAGGAAGATCTTGGG + Intergenic
1170633609 20:18085850-18085872 CAAGAGGCATGGCAGCTGCTGGG - Intergenic
1170766387 20:19292914-19292936 GAAGGGGCAAGGGAGCCCTTTGG + Intronic
1170796939 20:19556063-19556085 GAAGGGGCAAGGCAGCTCTCTGG + Intronic
1173416225 20:42858558-42858580 GAAGAGGCAAGGCAGCTCTCTGG - Intronic
1174052579 20:47777475-47777497 GAAGAGGCTTGAAAGATCCTGGG + Intronic
1174398656 20:50263876-50263898 GAAGAGGGGAGGGAACTCCTAGG + Intergenic
1175321454 20:58091047-58091069 GAAGGGGCAAGGCAGCTCTCTGG + Intergenic
1175434251 20:58931516-58931538 GAAGGGGCAAGGCAGCTCCCTGG - Intergenic
1175865326 20:62172920-62172942 TAAGAGGCGAGCACGCTCCTCGG + Intronic
1175916674 20:62429193-62429215 GAAGGGGCAAGGGACCTCCCTGG - Intergenic
1176869162 21:14072777-14072799 AAAGTGGCAAGAAAGCTCCGGGG - Intergenic
1176926450 21:14755371-14755393 GAAGAGGCAAGCAAGATCACAGG - Intergenic
1176965285 21:15205743-15205765 GAAAGGGCAAGGGAGCTCCAAGG - Intergenic
1177783350 21:25642987-25643009 GAAGAAGCAAGGCAGCTCTGAGG + Intronic
1178255158 21:31045481-31045503 GAAGAGGCAAGCTAGCTCTCTGG + Intergenic
1179350052 21:40600373-40600395 GAAGAGACAAGGCAGCTCTCTGG + Intronic
1179441441 21:41397415-41397437 GAGGAGGGAAGGAAGCTTCCTGG + Intronic
1179781589 21:43704383-43704405 GGAGAGGCCAGGCAGCTCTTTGG + Intergenic
1179954678 21:44731943-44731965 GAAGGGGCAAGGCAGCTCTCTGG + Intergenic
1179985910 21:44920098-44920120 GAGGAGGCAGGGAAGCTCGAGGG + Intronic
1181367670 22:22391145-22391167 CAAGATGCAAGGGTGCTCCTTGG + Intergenic
1181436332 22:22913461-22913483 CAGGAGCCATGGAAGCTCCTGGG - Intergenic
1181591284 22:23886539-23886561 GAAGGGGCAAGGGAGCTCTCTGG + Intronic
1181668981 22:24417090-24417112 GAAGAGGCAAAGTGGCTTCTTGG - Exonic
1181744359 22:24945514-24945536 GAACAGGCAAGGATGCCTCTAGG + Intronic
1182108352 22:27705054-27705076 GAACAGGCAAGGAAGCCCTCTGG + Intergenic
1182782101 22:32876209-32876231 GAAGGGGCAAGGCAGCTCTCTGG + Intronic
1183583804 22:38740564-38740586 GAAGGGGCAAGGCCTCTCCTGGG + Intronic
1183611066 22:38906541-38906563 GAACAGGAAAGGAAGTTCATAGG - Intergenic
1183676491 22:39301703-39301725 GTAGAGGAGAGGAAGCCCCTTGG - Intergenic
1184118282 22:42434509-42434531 GGAGAGGCAGGGACGCACCTTGG + Intergenic
1184541714 22:45130330-45130352 CAAGAGGCAAGGAAGCTTGCAGG - Intergenic
1184782587 22:46656578-46656600 GGACAGGAAAGGAAGCTACTGGG + Intronic
1185004075 22:48265148-48265170 GAAGAAGGAAGGATGCGCCTGGG - Intergenic
949316005 3:2756349-2756371 GAAGGAGCAAGGGAGCTCTTAGG - Intronic
950389086 3:12682561-12682583 GAAGGGGCTGGGAAGCACCTGGG + Intergenic
950570379 3:13796147-13796169 GCAGAGGGAAGGAAGCTCCTAGG - Intergenic
950612131 3:14133510-14133532 CAAGAGGGTAGGAAGCTCCGGGG + Intronic
950809243 3:15635683-15635705 CAAAAGGCAAGAATGCTCCTCGG + Exonic
950848269 3:16035723-16035745 GAAGAGGGAAGGAAGGACTTAGG - Intergenic
951844735 3:27073161-27073183 GAGGAGGAAAGGAAGCACGTGGG - Intergenic
951890471 3:27563565-27563587 GAAGAGGCAAGGAAGCTCCCTGG + Intergenic
952665881 3:35903348-35903370 AAAGAGGCAAGGAAATACCTGGG - Intergenic
952793312 3:37217519-37217541 CAAGAGGCAGAGAGGCTCCTGGG + Intergenic
952859520 3:37801312-37801334 GAAGGGGGAAGGGAGCTTCTAGG + Intronic
953346576 3:42180999-42181021 GAAGAGGCGAGGCAGCCCTTAGG + Intronic
953627919 3:44585948-44585970 GATGAGGGAATGAAGCTCCCAGG - Intronic
954525950 3:51271434-51271456 GAAGGGGCAAGGCAGCTCTCTGG + Intronic
954965461 3:54606537-54606559 GAAGAGACAAGGATGATGCTAGG + Intronic
955478461 3:59364205-59364227 GCAGAGGCCAGAAAGGTCCTGGG + Intergenic
955990313 3:64620104-64620126 GTAGAGGCTAGAAAGATCCTGGG + Intronic
956133648 3:66077700-66077722 GAAGAGGCAATTAAGGTCATAGG + Intergenic
957896938 3:86433212-86433234 TAACAGGCAAGGCAGCTCTTTGG + Intergenic
959117625 3:102196448-102196470 GAAAAGGCAAGGAAGCTTGGGGG + Intronic
959650499 3:108746141-108746163 GAAGATGAAAAGCAGCTCCTGGG + Intronic
959933116 3:112003724-112003746 GAGGAGGAAAAGAAGCTCCTAGG - Intronic
960612676 3:119569438-119569460 GAAGAGTCAGGAAAGCTTCTTGG - Intergenic
961756471 3:129130088-129130110 GAAGAAGCCAGAAGGCTCCTGGG - Exonic
962128492 3:132647925-132647947 GAAGGGGCAAGGCAGTTCTTTGG + Intronic
962783085 3:138739932-138739954 GAAGAGGAGAGGAAGCTCTCTGG - Intronic
963229984 3:142899684-142899706 GAACAGGCAAGGCAGCTCTCTGG + Intergenic
963280316 3:143378062-143378084 GAACAGGCGAGGAGGCTACTTGG - Intronic
964323800 3:155525341-155525363 GAAGGGGCAAGGGAGCTCGTTGG - Intronic
964541820 3:157787880-157787902 GAAGAGTCAAGGATGATCCCTGG - Intergenic
966239732 3:177743132-177743154 GAAGGGACAAGGCAGCTCCCTGG + Intergenic
967684069 3:192399295-192399317 GAAGGGGCAAGGGAGCTCCCTGG - Intronic
968933008 4:3593185-3593207 GAAGACACAAGGAAAATCCTAGG - Intergenic
969081372 4:4621191-4621213 GAAGGGGCAAGGGAGCTCTCTGG + Intergenic
969129232 4:4979231-4979253 GAAGGGGCAAGGGAGCTCTGTGG - Intergenic
969355868 4:6625276-6625298 GAAGGGGCAAGGCAGCTCTCTGG + Intergenic
969409901 4:7021099-7021121 CTAGAGGCAAGGAAGCACCATGG - Intronic
969637286 4:8376729-8376751 GAAGAGGGCAGGAAGCCCCAAGG - Intronic
969965233 4:10987169-10987191 GAAGGGGCAAGGAAGCTCCCTGG - Intergenic
970559068 4:17265200-17265222 GAAGGGGCAAGGAAGTTCTCTGG + Intergenic
970945687 4:21688820-21688842 GGAAAGGCAAGGAAGCAGCTGGG - Intronic
970948584 4:21725395-21725417 GAAGAGGCAAGGAAACCCATTGG + Intronic
971501326 4:27321232-27321254 GAAGAGGCAAGGGAGCTCTGTGG - Intergenic
972727475 4:41757886-41757908 GAAGAGCCAGGGAGGCTGCTAGG + Intergenic
972963825 4:44486061-44486083 GCACAGGTAAGGAATCTCCTGGG + Intergenic
973850532 4:54957223-54957245 GAAGAGTCAAGTAACCTCATGGG + Intergenic
974353958 4:60788165-60788187 AAAGAGGCAGGGAAACTTCTTGG - Intergenic
976334698 4:83871833-83871855 GAAGGGGCAAGGCAGCTCTTCGG + Intergenic
977748462 4:100579846-100579868 GAAGGGGCAAGGAAGCTCTTTGG - Intronic
980206713 4:129729114-129729136 GAAGAGGCAAGGCAGCTCTCTGG - Intergenic
980614583 4:135202314-135202336 GAAGGGGCAAGGCAGCTCACTGG - Intergenic
980841334 4:138264939-138264961 GAAAAGGCAAGGCAGCTTCCTGG - Intergenic
982256362 4:153455189-153455211 GAAGAGGCAAGGCAGCTCTCTGG - Intergenic
982558338 4:156898156-156898178 GAAGAGGCAAGTGAGCTCTCTGG - Intronic
982743197 4:159079319-159079341 GAAGGGGCAAGGAAGCTCTCTGG - Intergenic
982834427 4:160106160-160106182 GGAGACCCAAGGAAGCTCATTGG - Intergenic
983362270 4:166741996-166742018 CAAGGGGTAAAGAAGCTCCTAGG - Exonic
983477059 4:168226407-168226429 GAAGGGGCAAGGGAGCTCTCTGG - Intronic
983858516 4:172675428-172675450 GCAGAGGCAATGCAGCTGCTGGG + Intronic
983860443 4:172699102-172699124 GAAGGGGCAAGAAAGCTCTCTGG + Intronic
984260284 4:177436585-177436607 GAAGGGGCGAGGAAGCTCTCTGG - Intronic
985509018 5:301359-301381 GGTGAGGCAGGGATGCTCCTTGG + Intronic
985739105 5:1604554-1604576 GGTGAGGCAGGGATGCTCCTTGG - Intergenic
985902192 5:2805241-2805263 GAAGAGATGAGGGAGCTCCTTGG - Intergenic
986247374 5:6022505-6022527 GAAGGGGCAAGCAAGCTCGCTGG + Intergenic
986516810 5:8573102-8573124 GAAGAGGGAAGGAAGAGGCTGGG - Intergenic
987700351 5:21390162-21390184 GAAGGGGCAAGGATGCTTTTTGG - Intergenic
988832605 5:35002586-35002608 GAAGGGGCAAGAGAGCTCCCTGG - Intronic
989098547 5:37803446-37803468 GAAGGGGCAAGGCAGCTCCCTGG - Intergenic
989381336 5:40812379-40812401 GAAGAGGTAAGGCAGCTCTCTGG + Intergenic
989450136 5:41577240-41577262 GAAGGGGCAAGGGAGCCCTTTGG + Intergenic
991614705 5:68483923-68483945 GAAGAGGCAAGGCCACTACTAGG + Intergenic
991739822 5:69658719-69658741 GAAGGGGCAAGGACGCTTTTTGG + Intergenic
991757677 5:69894458-69894480 GAAGGGGCAAGGACGCTTTTTGG - Intergenic
991791397 5:70238460-70238482 GAAGGGGCAAGGACGCTTTTTGG + Intergenic
991819285 5:70534844-70534866 GAAGGGGCAAGGACGCTTTTTGG + Intergenic
991837080 5:70770340-70770362 GAAGGGGCAAGGACGCTTTTTGG - Intergenic
991883846 5:71238802-71238824 GAAGGGGCAAGGACGCTTTTTGG + Intergenic
992070527 5:73144588-73144610 AAAGAGGCAAGGGAGCTCTCTGG - Intergenic
992588546 5:78268845-78268867 GAAGAGACAAGAAAAATCCTAGG + Intronic
992872676 5:81022513-81022535 GAAGTGGCACTGAAGCTCTTTGG + Intronic
992873235 5:81026381-81026403 GAAGAGGCAAAAAGGCTCCTTGG - Intronic
993915860 5:93741920-93741942 CAAGAGGTTAGGTAGCTCCTGGG - Intronic
994275908 5:97837047-97837069 GAAAAGGCAAGGAAGCAGATTGG - Intergenic
994913767 5:105946494-105946516 CAAAAGTCAAGGAAGCTGCTGGG + Intergenic
995003690 5:107164955-107164977 GTAGAGGCAAGGATGTTCCCTGG + Intergenic
995065013 5:107851653-107851675 GAAGAGGCAAGACAGCTCTCTGG - Intergenic
995901721 5:117077110-117077132 GAAGAGGCAAGGAGGCCACGTGG + Intergenic
996478407 5:123947210-123947232 GAACAGGCAAGGCAGCTCTCTGG + Intergenic
998068288 5:139176671-139176693 GAAGAGGCAAGGAAGCTCCTCGG + Intronic
998139499 5:139691898-139691920 GAAGAGCCAAGAAGGCTTCTTGG + Intergenic
998249625 5:140543141-140543163 GAAAAGGCAAGCAAGCTTGTAGG + Intronic
998270505 5:140702198-140702220 GAAGTGTTAAGGAAGGTCCTTGG + Intronic
999122217 5:149218297-149218319 GAAGGGGCAAGGCAGCTCTCTGG + Intronic
999747099 5:154600772-154600794 GAAGGGCCAAGGAGTCTCCTTGG - Intergenic
1001441588 5:171747952-171747974 GAAGGGACAAGGAAGCTCTCTGG + Intergenic
1001710795 5:173776320-173776342 GAAGAGGCCAGGCAGCTCTCTGG - Intergenic
1002381848 5:178836318-178836340 GAAGGGGCAAGGAAGCTCTTTGG + Intergenic
1002462892 5:179384876-179384898 GAGGAGGCAAGGCAGCTCTCTGG + Intergenic
1003238732 6:4322792-4322814 GGAAAGGCAAAGAAGCTGCTGGG - Intergenic
1003368845 6:5505262-5505284 GAAGAGCGAAGGAAGCTCCCAGG - Intronic
1003719626 6:8686242-8686264 TAAGAGAAGAGGAAGCTCCTAGG + Intergenic
1004507342 6:16257764-16257786 GAAGAGGCATACAGGCTCCTTGG + Intronic
1004555351 6:16691898-16691920 GAAGAGGCAAAGCAGTTCCTGGG - Intronic
1005901957 6:30224372-30224394 GAAGAGACAAGGGAGCTCTTTGG - Intergenic
1006117958 6:31785278-31785300 GAAGAAGCTTGGCAGCTCCTTGG - Exonic
1006766352 6:36510125-36510147 TAAGAGGCAGAGAGGCTCCTGGG - Intronic
1007295912 6:40820377-40820399 GAAGGGGCAAGGCAGCTCTCTGG - Intergenic
1009041772 6:58188896-58188918 GAAGAGGCAAGGCAGCTCTCTGG + Intergenic
1009217622 6:60943159-60943181 GAAGAGGCAAGGCAGCTCTCTGG + Intergenic
1009338705 6:62526902-62526924 GAAGGGGCAAGGTAGCTCTCTGG - Intergenic
1010507476 6:76678003-76678025 GAAGAGAAAAGAAAGATCCTGGG - Intergenic
1010731027 6:79391523-79391545 GAAGGGGCAAGGCAGCTCTCTGG + Intergenic
1010765552 6:79774435-79774457 GAAGGGGCAAGGCAGCTCTCTGG + Intergenic
1010842116 6:80658784-80658806 GAAGAGGCAAGCAAGCCTCGTGG + Intergenic
1011454609 6:87534772-87534794 GCAGAAGCTAGGAAGCCCCTGGG + Intronic
1012519468 6:100103604-100103626 GAAGAGGCAAGGTAGTTTTTTGG + Intergenic
1013158964 6:107522917-107522939 GAAGAGGCAGGAAAGATGCTGGG + Intronic
1013359772 6:109382929-109382951 GAAGATATAAGGAAGCTCCCTGG - Intergenic
1014798010 6:125748214-125748236 GAAGAGGAAAGGACGCGACTGGG - Intronic
1015399695 6:132775147-132775169 GAATGGGCAAGGGAGCTCTTTGG - Intronic
1015500510 6:133927916-133927938 GAAAAGGCAGGGAAGCTCTCTGG - Intergenic
1017754948 6:157521568-157521590 GGAGAGGCCAGGCAGCTCTTTGG + Intronic
1018052677 6:160024876-160024898 GAGGAGGCATGGAATCTACTGGG - Intronic
1018197247 6:161366154-161366176 GAAGAGGCAAGAGAGCTCTCTGG - Intronic
1018275728 6:162128783-162128805 GAAGAGGCGAGGCAGCTCTCTGG - Intronic
1018741308 6:166731289-166731311 GAAGAGGCAAGTATGTTCGTTGG + Intronic
1018756728 6:166856303-166856325 GAAGGGGCAAGGGAGCTCTCTGG - Intronic
1018768226 6:166950803-166950825 AAGGAGGCAGGGAAGCTCTTGGG + Intronic
1019165985 6:170097848-170097870 ATAGAGGCAAGGAGGCTCCCTGG - Intergenic
1019555754 7:1630390-1630412 GGAGAAGCAGGCAAGCTCCTGGG - Intergenic
1019704399 7:2490589-2490611 GGGCAGGCAAGGAAGCTCCCAGG + Intergenic
1019840132 7:3433433-3433455 GAAGAGGTAAGGAAGGTTCCTGG + Intronic
1019919803 7:4156286-4156308 GATGAGGCAAAGTAACTCCTAGG + Intronic
1021022641 7:15622896-15622918 GAAGAGGCTAGGTAGCTCTCTGG - Intronic
1022955119 7:35373705-35373727 GAAGAGACAAGGCAGCTCTCTGG + Intergenic
1023125132 7:36947770-36947792 GAAGAGAGAAGGATGCTTCTAGG - Intronic
1023603468 7:41904449-41904471 GAAGGGGCAAGAAAGCTCTCTGG - Intergenic
1023823348 7:43992283-43992305 GAAGGGTCAAGGAAGCTCTCTGG + Intergenic
1023854007 7:44169783-44169805 GAAAAGGCAAGGTAGCTCTCTGG - Intronic
1024267773 7:47619860-47619882 GAAGGGCCAAGGGAGCTCTTTGG - Intergenic
1024390587 7:48807193-48807215 GAAGGGGCAAGGCAGCTCCTTGG - Intergenic
1024588317 7:50859850-50859872 GAAGGGGCAAGGGAGCTCTCTGG - Intergenic
1027957670 7:84902311-84902333 GAAAAGGCAGGGAAGATCCGCGG + Intergenic
1028083096 7:86601120-86601142 GCAGAGGCAAGGCAGCTGATAGG - Intergenic
1028351427 7:89854596-89854618 GATGAGCCAAGGAAGCTCTGTGG + Intergenic
1028766765 7:94568784-94568806 GAAGGGGCAAGGAAACTCTCTGG - Intergenic
1029029697 7:97454576-97454598 GAAGGGGCAAGGCAGCTCTCTGG - Intergenic
1029751608 7:102545735-102545757 GAAGGGTCAAGGAAGCTCTCTGG + Intronic
1029769561 7:102644826-102644848 GAAGGGTCAAGGAAGCTCTCTGG + Intronic
1030225839 7:107149511-107149533 GAAGGGGCAAGGGAGCTCATTGG + Intronic
1031310632 7:120192755-120192777 GAAGCAGCAAGGCAGCTCTTTGG + Intergenic
1031642136 7:124178354-124178376 GAAGAAGCAAGGCAGCTCTCTGG + Intergenic
1031681056 7:124675192-124675214 GAAGGGGCAAGGCAGCTCTTTGG - Intergenic
1032556812 7:132844763-132844785 GATAAGCCAAGTAAGCTCCTAGG + Intronic
1032696186 7:134338555-134338577 GAAGAGGCATAGGAGCTCCCTGG + Intergenic
1033653058 7:143356416-143356438 GGAGAGGACTGGAAGCTCCTGGG + Exonic
1034112150 7:148547576-148547598 GGAGAGGAAGGGAAGCTACTAGG - Intergenic
1034657582 7:152741661-152741683 GGAGAGGCACGGAAGCTTCCGGG + Intergenic
1034860974 7:154594553-154594575 AGAGAGGCAAGGAACATCCTAGG - Intronic
1035003711 7:155638953-155638975 GGAGGGGCAAGGCAGCTCTTGGG + Intronic
1035026846 7:155831772-155831794 CAAGAGGCAAAGAGGCTCCCAGG - Intergenic
1035332184 7:158103519-158103541 GGAGAGGAAGGGAATCTCCTGGG - Intronic
1037649690 8:20825151-20825173 GAAGAGGCAAACAAGTTCCCTGG + Intergenic
1038143980 8:24876801-24876823 GAAGGGGCAAACAAGCTCCCTGG + Intergenic
1039121631 8:34154409-34154431 GAAAAGGGAAGGGAGCCCCTTGG + Intergenic
1040071811 8:43194804-43194826 GAAGAGGCAAGGCAGGTCTCTGG - Intronic
1040614582 8:49021290-49021312 GAAGGGCCAAGGAAGTTCTTAGG - Intergenic
1040770615 8:50970840-50970862 GAAGAGACAAGGAAACTGTTTGG - Intergenic
1040909305 8:52502193-52502215 GAACAGGCAAGGGAGCCCCTGGG - Intergenic
1041117393 8:54553428-54553450 GAAGAGGCAAGGGAGCTCTCTGG + Intergenic
1041258214 8:55997503-55997525 GAAGGGGCAAGGCAGCTCTCTGG + Intronic
1041460740 8:58108831-58108853 GAAGGAGGAATGAAGCTCCTGGG - Intronic
1041908868 8:63066608-63066630 GAAGAGCCACGGAAGCACTTAGG + Intronic
1042938756 8:74086790-74086812 GAAGGAGCAAGGAAGCTCACTGG - Intergenic
1043202451 8:77387416-77387438 GAAGAGGAAAGGAATCTCTCGGG - Intergenic
1043398021 8:79857434-79857456 GAAGAGGAAAGCATGCTCCATGG - Intergenic
1043808106 8:84699537-84699559 GAAGAGGCAAGGGATCTCTCTGG + Intronic
1044409730 8:91869401-91869423 GAAGAGGCAAGGAAGCTCTCTGG - Intergenic
1044497589 8:92906370-92906392 GAAGAGGTAAGGAAATTCCTGGG + Intronic
1044897374 8:96906706-96906728 GAAGGGGCAAGGCAGCTCTCTGG + Intronic
1045683610 8:104688768-104688790 AAAGAGAAAAGGAAGCTCCTGGG - Intronic
1046149645 8:110206938-110206960 AAAAAGGCAAGGAAATTCCTAGG - Intergenic
1046646070 8:116787042-116787064 GAAGGGGCAAGGCAGCTCTCTGG - Intronic
1046855564 8:119027819-119027841 GAAGAGGCAAGGTAGCATCGAGG - Intronic
1047322634 8:123802342-123802364 GAAGAGGGAAGAAAGATTCTGGG + Intronic
1047734759 8:127755443-127755465 GAAGAGGGAAGGCACTTCCTTGG - Intergenic
1048367785 8:133753523-133753545 GAAGAGGCAAGGAAGGGGATAGG - Intergenic
1048465557 8:134662165-134662187 GAAGGGGCAAGGTAGCTCTTTGG + Intronic
1048530140 8:135240459-135240481 GAGGAGGCATGGAAAGTCCTTGG + Intergenic
1049004859 8:139848038-139848060 AAAGAGGCTATGGAGCTCCTGGG - Intronic
1049265854 8:141667521-141667543 GAAGGGACAAACAAGCTCCTCGG - Intergenic
1049614841 8:143571615-143571637 GAAGAGGGAAGGAAGCCGCGTGG + Intronic
1050029912 9:1374914-1374936 GAAGAGGCAAATAAGCTCTCAGG - Intergenic
1050093660 9:2041441-2041463 GAAGAGACAAGGCAGCTCTCTGG + Intronic
1050327502 9:4511342-4511364 GAAGTGGCAAGGCAGCTCTCTGG + Intronic
1051344198 9:16137772-16137794 GAAGAGGCAAGGAAGATGGGGGG + Intergenic
1051589858 9:18766711-18766733 GAAGGGGCAAGGCAGCTCTCTGG + Intronic
1051910702 9:22152179-22152201 GAAGGGGCAAGGAAGCTTTGTGG - Intergenic
1051921237 9:22268290-22268312 GGAAAGGCAAGGAAGCTCAAAGG - Intergenic
1051921343 9:22269592-22269614 GAAGAGGCAAGGGATCTCTCTGG - Intergenic
1052014326 9:23447339-23447361 GAAGAGGGAAGGGAGCTGCCAGG - Intergenic
1052100302 9:24437998-24438020 GAAGGGGTGAGGAAGCTCTTTGG + Intergenic
1053023033 9:34708872-34708894 TGAGAGGCAAGGAAACTCTTGGG + Intergenic
1053241603 9:36500108-36500130 GAAGAGGCAAGGAAGTTCTCTGG - Intergenic
1053409406 9:37905888-37905910 GAAGAGCCAATGAAGGGCCTGGG - Intronic
1053471413 9:38348269-38348291 GAACAGAGAAGGAAGATCCTGGG - Intergenic
1054457123 9:65438792-65438814 GAAGACACAAGGAAAATCCTAGG + Intergenic
1054702238 9:68424417-68424439 GAAGGGGCAAGGCAGCTCTCAGG + Intronic
1055085881 9:72313969-72313991 GAAGAGGCAAGGCAGCTCTTGGG + Intergenic
1055088804 9:72341673-72341695 GAAGAGGTAAGGCAGCTCTCTGG + Intergenic
1055793507 9:79949076-79949098 GAAGATACAAGGATGATCCTTGG - Intergenic
1055921591 9:81466640-81466662 GAAGAGGCAGGTATGCTCTTAGG - Intergenic
1055966975 9:81874840-81874862 GAAGATTCAAGGATGCTGCTTGG + Intergenic
1056192364 9:84196742-84196764 GAAGAGGCAAGCTAGCTCTCTGG + Intergenic
1056383305 9:86075072-86075094 GAAGGGGCAAGGCAGCTCTCTGG - Intronic
1056423477 9:86453185-86453207 GAAGGGGCAAGGCAGCTCCCTGG + Intergenic
1056629106 9:88278070-88278092 GAGGAGGCAAGCAGCCTCCTGGG - Intergenic
1056943765 9:90976682-90976704 GAAGAGACAAAGAGGCTCCTTGG - Intergenic
1057552877 9:96064978-96065000 GCAGAGGCAAGGAGAGTCCTGGG - Intergenic
1057907710 9:98995166-98995188 GGAGAGGAGAGGAACCTCCTGGG + Intronic
1058188422 9:101883885-101883907 GAAGGGGCAAGGCAGCTTCTGGG - Intergenic
1058788517 9:108416798-108416820 GGAGAAGGAAGGCAGCTCCTAGG - Intergenic
1058940343 9:109807533-109807555 GAAGGGGCAAGGCAGCTCTCTGG + Intronic
1059074687 9:111180247-111180269 GAAGAGACAAGAAATCTCATGGG + Intergenic
1059149465 9:111936196-111936218 GAAGAGGCAAGAAAGCTCTCTGG - Intergenic
1059965335 9:119608303-119608325 GAAGAGGCAAGGCAGCTTTCTGG - Intergenic
1062177026 9:135169044-135169066 GAAGGGGCACGGCAGCTCCCTGG - Intergenic
1062377298 9:136267934-136267956 GAAGGGCCAAGGCAGGTCCTGGG - Intergenic
1062416057 9:136450845-136450867 AGATAGGCAAGGAGGCTCCTGGG + Intronic
1062475449 9:136724500-136724522 GAACAGGCAAGGACCCTCGTGGG + Intergenic
1062589601 9:137267433-137267455 GGGGAGACAAGGCAGCTCCTGGG - Intronic
1185513572 X:681053-681075 GAAGGGGCGAGGAAGCTCTCTGG + Intergenic
1185705485 X:2263331-2263353 GAAGGGGCAAGGGAGCTCTCTGG - Intronic
1185827379 X:3264891-3264913 GAAGGGGCAAGGGAGCTCTCTGG - Intergenic
1185828582 X:3276612-3276634 GAAGGGGCAAGGGAGCTCTCTGG - Intronic
1185938507 X:4285990-4286012 GAAGGGGCAAGGGAGCTCTCTGG - Intergenic
1185962723 X:4563364-4563386 GAAGGGGCAAGGGAGCTCTCTGG + Intergenic
1186035914 X:5423523-5423545 GAAGGGGCAAGGAAGCTCTCTGG - Intergenic
1186174515 X:6910919-6910941 GAAGGGGCAAGGGAGCTCTCTGG + Intergenic
1186275318 X:7931993-7932015 GAAGGGGCAAGGGAGCTCTCTGG + Intergenic
1186287433 X:8060625-8060647 GAAGAGGCAAGGGAGCTCTCTGG - Intergenic
1186450919 X:9673020-9673042 GAAGAGGCAAGGGAGCTCTCTGG + Intronic
1186717076 X:12263573-12263595 GAAGCGGCAGGGAAACTACTTGG + Intronic
1187974578 X:24692441-24692463 GAAGGGGCAAGGCAGCTCTCTGG + Intergenic
1189080319 X:37964166-37964188 GAAGGGGCAAGGGAGCTCTTTGG - Intronic
1189902175 X:45717969-45717991 GAAGAGGCAAGTGAGCTCTTTGG + Intergenic
1190170883 X:48110712-48110734 AAAATGGCAAGGCAGCTCCTGGG + Intergenic
1191183211 X:57583590-57583612 AAAAAGGCAAGGTAACTCCTGGG + Intergenic
1191251095 X:58260542-58260564 AAAGCGGCAAGGAAGCCCCAGGG + Intergenic
1192867628 X:75152334-75152356 GAAGAGACAAGGCAGCTCTTTGG - Intronic
1193231491 X:79052159-79052181 GAAGAGGCAAGGCAGCTGTCTGG + Intergenic
1193668454 X:84353413-84353435 GAAGGGGCAAGGAGTCTCCCTGG - Intronic
1193921013 X:87425764-87425786 GAGCAGGCAAGGGAGCTCCCTGG - Intergenic
1194196887 X:90905022-90905044 GAAGGGGCAAGGCAGCTCTTTGG + Intergenic
1194746783 X:97636818-97636840 GAAGAGGCAAGGCTGTTCCAAGG - Intergenic
1194764764 X:97837073-97837095 GAAGGGGCAAGGCAGCTCTTTGG + Intergenic
1196172428 X:112604421-112604443 GAAGAGACAATGAAGTTTCTGGG - Intergenic
1196744374 X:119056321-119056343 GAACAGGCAAAGGAGCCCCTGGG - Intergenic
1196928175 X:120654911-120654933 GAAGAGGCCAGAAAGTTCTTTGG - Intergenic
1197233661 X:124033940-124033962 GAAGGGGCAAGGCAGCTCTCAGG + Intronic
1197374880 X:125670426-125670448 GAAGAGGCAAGGTAACTCCCAGG - Intergenic
1197865991 X:131017809-131017831 GAAGAGAAAAGGAAGGTCTTGGG - Intergenic
1197867688 X:131036275-131036297 GAAGAGACAAGGCAGCCCTTGGG + Intergenic
1198738192 X:139810719-139810741 TAAGAGGTAAAGAAGCTCCTTGG - Intronic
1198896715 X:141463582-141463604 GAAGGGGGAAGGAATCTCATTGG + Intergenic
1200542736 Y:4479228-4479250 GAAGGGGCAAGGCAGCTCTTTGG + Intergenic
1200789038 Y:7283451-7283473 GAAGGGGCGAGGGAGCTCCCTGG - Intergenic
1201313212 Y:12616389-12616411 GAACAGCCAAGGATGCTGCTGGG - Intergenic
1201896922 Y:19001452-19001474 GATCAGGCAAGAAATCTCCTAGG + Intergenic