ID: 998068289

View in Genome Browser
Species Human (GRCh38)
Location 5:139176672-139176694
Sequence AAGAGGCAAGGAAGCTCCTC GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 361
Summary {0: 1, 1: 0, 2: 7, 3: 34, 4: 319}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
998068284_998068289 3 Left 998068284 5:139176646-139176668 CCTTCTTACTGGGTCCTCACATG 0: 1
1: 58
2: 666
3: 1875
4: 3104
Right 998068289 5:139176672-139176694 AAGAGGCAAGGAAGCTCCTCGGG 0: 1
1: 0
2: 7
3: 34
4: 319

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
998068289 Original CRISPR AAGAGGCAAGGAAGCTCCTC GGG Intronic
901052394 1:6431890-6431912 ACGAGGCAGGGAAGCTTGTCTGG - Intronic
901211311 1:7527641-7527663 AAGAGGCCAGAATGCTCATCGGG + Intronic
903077237 1:20780777-20780799 CAAGGGCAAGGAAGCTCCTAAGG + Intronic
903171458 1:21557059-21557081 AAGGGGGAAGGAAAATCCTCAGG - Intronic
904840870 1:33371057-33371079 AATAGACAAGGAAGCACTTCAGG - Exonic
907323863 1:53622728-53622750 AAGAGGCAAAGATTCTCCCCCGG + Intronic
907715278 1:56920739-56920761 CAGAGGCAGGGAGGCTCATCAGG + Intergenic
907885727 1:58590907-58590929 AAAAGGCAAAGAGGCTACTCTGG + Intergenic
908732477 1:67240486-67240508 AATAGGCCAGGAAGCTTTTCTGG - Intronic
910146413 1:84085758-84085780 CTGAGGCCAGGAACCTCCTCAGG - Intronic
911311179 1:96293831-96293853 AAGAGGAAAGGATGTGCCTCTGG + Intergenic
913405525 1:118486611-118486633 AAGAGGGAAGGAAGCCTCTTGGG - Intergenic
915908858 1:159899937-159899959 AAGAAGCAAGGGAGATCCTGAGG - Intronic
916398396 1:164417524-164417546 AAGAGTCTAGGAAGGTTCTCAGG - Intergenic
916600657 1:166290327-166290349 AAGAGACAAGGCAGTTCCACAGG + Intergenic
916631607 1:166620410-166620432 AACATGCAAGGAAGTTCCTCAGG - Intergenic
917241728 1:172956051-172956073 AAGAGGCAAGGAAGCTCTCTGGG - Intergenic
919513198 1:198491772-198491794 AAGCAGGCAGGAAGCTCCTCCGG + Intergenic
919687783 1:200500193-200500215 AAGAGGCTGGGAAGCTGGTCAGG + Intergenic
921770546 1:219033766-219033788 AAGAGTCAAAGAAACTCCTAGGG + Intergenic
922131960 1:222788711-222788733 AAGGGGCAAGGAAGCTTCCTTGG - Intergenic
922809695 1:228408671-228408693 AAGAGCCGAGGTAGCGCCTCTGG + Exonic
923478338 1:234358535-234358557 AAGAGGCAAGGGAGCTCTCTGGG - Intergenic
923625818 1:235612969-235612991 AAGGGGCAAACAGGCTCCTCAGG + Intronic
924139645 1:241009073-241009095 AAGAGGCAAGGGGTCTTCTCTGG - Intronic
924209322 1:241748445-241748467 AAGGGGCAAGGCAGATCCTTGGG + Intronic
924212510 1:241785387-241785409 AAGAGGCAAACAAGCTCCCTCGG + Intronic
924226203 1:241923613-241923635 AGGAGGGAAGGCATCTCCTCTGG + Intergenic
924814052 1:247427166-247427188 AAGAGGCAAGGCAGCTCTCTGGG + Intronic
1063957551 10:11280815-11280837 AAGAGGCAGGGGAGGTCCTAGGG + Intronic
1064171506 10:13037818-13037840 AAGATCAAAGGATGCTCCTCTGG - Intronic
1065185655 10:23168691-23168713 AAGAGAAAAGGAAGAGCCTCAGG - Intergenic
1065361028 10:24889159-24889181 AAGGGGCAAGCAAGCTCTTTGGG - Intronic
1066049337 10:31619928-31619950 AGGAGGGAAGGAAGAGCCTCTGG + Intergenic
1067796806 10:49326888-49326910 GAGGGGGAAGTAAGCTCCTCTGG - Exonic
1067805020 10:49386355-49386377 AGGAGGCGAGGAAGCTGCACAGG + Intronic
1068340568 10:55696585-55696607 AAGGGACAAAGAAGCTCCTGGGG - Intergenic
1068450094 10:57175148-57175170 AAGAGGGAAATAAGCTCCTTTGG - Intergenic
1068790813 10:61029285-61029307 AAGAAGCAAGGAAGCTCTCTGGG + Intergenic
1069073110 10:64010415-64010437 TAGAAGCAAGGAAGCTACTTAGG - Intergenic
1070043147 10:72802208-72802230 AGGAGGCAGGGAAAATCCTCAGG - Intronic
1070168140 10:73913231-73913253 AGGAGGCAGGGAAGGCCCTCTGG + Intronic
1070988853 10:80713831-80713853 AAGAGGCCTGGAAGTTCCTGTGG + Intergenic
1071027127 10:81128349-81128371 AAGAGGGAAAGTAGCTCCTTTGG + Intergenic
1071131805 10:82403147-82403169 AAGTCCCATGGAAGCTCCTCTGG - Intronic
1071388303 10:85144016-85144038 AAGGGGCAAACAAGCTCCTTTGG - Intergenic
1073303050 10:102482566-102482588 TAGAGGGGAGGAAGCTCCTAAGG - Intronic
1073473994 10:103741104-103741126 AATGGTCAAGGAAGCTTCTCTGG + Intronic
1074126093 10:110530136-110530158 AAGAGGCAGGGAGGCTGGTCGGG - Intergenic
1074919205 10:117990157-117990179 CAGAGGGATGGAAGTTCCTCTGG - Intergenic
1075333890 10:121595780-121595802 TGGAGCCAAGGAGGCTCCTCTGG - Intronic
1075342208 10:121655993-121656015 AAGAGGCCAGGAAGCCCCCGAGG + Intergenic
1076123524 10:127955079-127955101 TGGAGGCAAGGAAGATCTTCTGG + Intronic
1076537100 10:131186670-131186692 ACGAGGAAAGGGGGCTCCTCGGG - Intronic
1077144183 11:1037354-1037376 CAGAGACACGGTAGCTCCTCAGG - Intergenic
1078107994 11:8370701-8370723 AGGAGACAAGGTAGCTCCTGGGG + Intergenic
1080823996 11:35832597-35832619 AAGAGGTAAGGGAGCTCTCCAGG - Intergenic
1081265316 11:41014111-41014133 AAGGGGCAAGGAAGCTCTCTGGG + Intronic
1081779263 11:45698795-45698817 AAGAGCCCAGGCTGCTCCTCAGG - Intergenic
1082777395 11:57257532-57257554 AAGGGGCAAGGCAGCTCTTTGGG - Intergenic
1085664640 11:78402989-78403011 AAGAGGGAAAGAAGCTCCTCAGG - Intronic
1085727498 11:78967008-78967030 AAGAGGAAAGGAAGTGCCCCAGG - Intronic
1086118885 11:83285565-83285587 AAGAGGCTAGTAATCTCGTCAGG - Intronic
1086478610 11:87208261-87208283 GTGTGGCAAGGAAGCTCATCAGG + Intronic
1086783614 11:90937392-90937414 AAGTGGCAAAGAAGCTCCCTTGG - Intergenic
1086986959 11:93261336-93261358 AAGAGGTGAGGAATCTCCACTGG + Intergenic
1087186369 11:95201944-95201966 AAAAGGGAAGGCAGATCCTCAGG - Intronic
1087680062 11:101210249-101210271 CAGAGGAAGGGAAGCTCCTCAGG - Intergenic
1087889489 11:103520528-103520550 AAGAGGCAAGGGAGCTCTCTGGG - Intergenic
1089286728 11:117412223-117412245 AAGAAGGCAGGCAGCTCCTCAGG - Exonic
1090478928 11:127050507-127050529 AAGAGCCCATGCAGCTCCTCTGG + Intergenic
1090798789 11:130157967-130157989 GAGAGGGAAGGAAACTCCTGGGG + Intergenic
1091908762 12:4211797-4211819 AGGAGGCAAACAAGATCCTCTGG + Intergenic
1093399788 12:18731756-18731778 ATGAGGCAAGAAAGCTACACTGG - Intronic
1093610857 12:21154332-21154354 AAGAGGCAAGGAAGCTCTATTGG - Intronic
1095715004 12:45334515-45334537 AAGAGGGAAGAAAGCTCCTCTGG + Intronic
1095777791 12:46028516-46028538 AAGATGGAAGCCAGCTCCTCAGG + Intergenic
1096456715 12:51793448-51793470 AAGTGGCAAGAAAGCAACTCAGG + Intronic
1096693883 12:53336778-53336800 AAGAGGCATGGAAGGTTCTGAGG + Intronic
1096848308 12:54419591-54419613 ATGAGGAAAGGAATCACCTCTGG + Intergenic
1099302085 12:80909595-80909617 AAGGGGCAATGAAGCTACTTGGG + Intronic
1099579667 12:84428176-84428198 AAGAGGCAAAGAACCTCCCTTGG - Intergenic
1099924023 12:88995371-88995393 AAGAGGCAAAGAACCTCCTCAGG + Intergenic
1100188807 12:92168035-92168057 AAGGGGCAAGGAAGCTCTCTGGG + Intergenic
1100494471 12:95111601-95111623 AAGAGGCAGGGAAGCTTTGCAGG - Intronic
1103148677 12:118617992-118618014 AGGAGGCAAGGAAGGGACTCTGG - Intergenic
1103299061 12:119913567-119913589 AAGAGGCAAGGGGTCTTCTCTGG - Intergenic
1103764050 12:123269568-123269590 CAGAGGCCAGGAAGCTCCTGGGG + Intronic
1103990425 12:124795378-124795400 AAGATACAAGCAAGCTCCACTGG - Intronic
1106401827 13:29438525-29438547 AAGGGGCAAGGCAGCTCCCTGGG + Intronic
1109369287 13:61400249-61400271 AAGAGGCAAACAAGCTCCCTTGG - Intergenic
1110355059 13:74558069-74558091 AAGAGGGAAGGAGGCTTCCCTGG - Intergenic
1110734978 13:78925956-78925978 CAGAGGCAAGAAAACCCCTCAGG + Intergenic
1111159877 13:84380855-84380877 GATAGGCAAGGAAGATCCTGGGG + Intergenic
1111311495 13:86493118-86493140 AAGAGGCAAGGAATCTCTTCAGG - Intergenic
1114550645 14:23531032-23531054 AAGAGGCTGGGAAGCTTGTCAGG + Intronic
1114562222 14:23601578-23601600 AAGAGGCAAGGCAGCTCTCTGGG - Intergenic
1114694662 14:24615186-24615208 AAGAGGCAAGGTCCCTCCCCTGG + Intergenic
1117679202 14:58185820-58185842 AAGGGGCAAGGCAGCTCCCTGGG - Intronic
1119911474 14:78353451-78353473 AAGGGGCAAGGCAGCTCTCCGGG + Intronic
1120234383 14:81874408-81874430 AAGATCCAAGAAAGATCCTCTGG + Intergenic
1120897041 14:89542806-89542828 AAGAGGCAAGGAAACACATTTGG + Intronic
1122037155 14:98957220-98957242 AAGAGACAAGGCCCCTCCTCAGG + Intergenic
1122121861 14:99558782-99558804 AAGAGGCAAGGAAGGTGATGTGG + Intronic
1124888964 15:33713822-33713844 AAGAGGCAAGGCAGCTCTCTGGG + Intronic
1126317445 15:47385596-47385618 AAAAAGCAAGGAAGAACCTCTGG - Intronic
1128005259 15:64233478-64233500 AAGAGGCAGGGAAGGACCACAGG + Intronic
1128224107 15:65989730-65989752 AAGAGGGAAGGAGGCTGCCCAGG - Intronic
1130035723 15:80359759-80359781 AAGGGCCAAGGGAGCTGCTCTGG - Intronic
1130210250 15:81915728-81915750 AAGGGGCAAACAAGCTCCCCTGG + Intergenic
1131020404 15:89093120-89093142 GGGAGGCCAGGAAGCTTCTCTGG - Intronic
1133060643 16:3172249-3172271 AAGGGACAAGGATGCTCCTGAGG + Intergenic
1134347797 16:13407367-13407389 AAGAGGCAAGGGATCTCTTTAGG + Intergenic
1135503143 16:23014374-23014396 GAGAGTCAGGGAAGCTCCTGGGG - Intergenic
1138605657 16:58086596-58086618 CTGAGGCAAGGAAGGGCCTCAGG + Intergenic
1140020818 16:71237098-71237120 AAGAGGCAAGGAAGTGACGCAGG + Intergenic
1140323200 16:73974054-73974076 AAGAGCCAAGAAAGCTGCTCCGG + Intergenic
1140835982 16:78794160-78794182 AAGAAGCAAGGCAGCTTCTGGGG - Intronic
1141244044 16:82290092-82290114 AACAGGGAATGAAGCTCCCCGGG - Intergenic
1144661912 17:17076414-17076436 AAGAGGAAAGGGAGCTCCCGGGG - Intronic
1146390028 17:32413566-32413588 AAAAGCAAAGCAAGCTCCTCAGG - Intergenic
1147303030 17:39544970-39544992 AAAAGCTAAGGAAACTCCTCTGG - Intronic
1148909708 17:50934866-50934888 AAGAGGCAGGGAAGCTGTTATGG - Intergenic
1149792896 17:59494686-59494708 AAGAGTCAAGGAAGCCTCCCAGG - Intergenic
1150464143 17:65377522-65377544 GAGACGAAAGGAAACTCCTCTGG + Intergenic
1150532116 17:65995047-65995069 CAAAGGCAAGGGAGCTCTTCGGG - Intronic
1150636721 17:66918393-66918415 CAGAGCCAGGGAAGCTCCGCAGG - Intergenic
1152477316 17:80526664-80526686 AAGTGGCCGGGAAGCTCCCCGGG + Intergenic
1152778722 17:82217139-82217161 TGGAGGCAGGGAGGCTCCTCTGG + Intergenic
1155374404 18:25139903-25139925 AAGGGGCAAGGAAGTTATTCGGG - Intronic
1155908259 18:31478186-31478208 AAGAGCAATGGAACCTCCTCAGG - Exonic
1158051956 18:53233087-53233109 AACAGGCAAGGTAGTTCATCAGG - Intronic
1159003950 18:62996480-62996502 AAGAGGCAAGGCAGTTCCCTTGG - Intergenic
1159477721 18:68944518-68944540 AAGGGGCAAGGCAGCTCCCTGGG + Intronic
1160403634 18:78629454-78629476 TAGAGGCAAGGAAGGACCTGAGG + Intergenic
1160483838 18:79269878-79269900 TGGAGGCAAGGATGCGCCTCAGG - Intronic
1160510983 18:79453266-79453288 AAAAAGCAAGGAGGCTGCTCAGG - Intronic
1163197369 19:15732565-15732587 GAGAGGCCAGGAAGAGCCTCAGG - Intergenic
1163355021 19:16804789-16804811 AAGGGGCAAAGAAGCTCCCTGGG + Intronic
1164010135 19:21194869-21194891 AAGAGGCAAGGCAGGCCCTGGGG + Exonic
1164432946 19:28203996-28204018 AAGAGGGAAAGAAGCTACTTGGG + Intergenic
1164846531 19:31437632-31437654 AACAGGAAGGGAAGCTCCTTTGG - Intergenic
1164972369 19:32543541-32543563 AAGAGTCATGGAAACTCTTCAGG - Intergenic
1165662928 19:37597975-37597997 GGGAGGCCAGGAAGCTCCTAAGG + Intronic
1166570831 19:43796068-43796090 AAGGGGCAAGGCAGCTCTCCAGG + Exonic
1167771681 19:51524830-51524852 ATGAGACAAGGCAGCTCCCCAGG + Intronic
1168457049 19:56520669-56520691 AAGGGGCAAGGAAGCTCCTTTGG - Intronic
925259579 2:2517944-2517966 GAGATGCAAGGAAGACCCTCTGG - Intergenic
926207021 2:10841043-10841065 AAGAGGCCAGGAGGATCCCCGGG + Intergenic
926898302 2:17719989-17720011 AAGAGGTAAGTAAGCTACACTGG + Intronic
927720587 2:25379417-25379439 GAGAAGCAAGGAAGCCCCTGGGG - Intronic
927854799 2:26521325-26521347 AACAGCCAAGGCAGCTCCCCAGG + Intronic
928653108 2:33422565-33422587 AAGGGACAAGGCAGCTCCTTGGG - Intergenic
930237055 2:48898514-48898536 AAGAGGCAAGCAAGCTACGTTGG - Intergenic
931714388 2:65017511-65017533 ATTAGGGAAGGAAGTTCCTCTGG + Intronic
932217339 2:69975421-69975443 AGGAGGCAGGGAAGCTTCTCGGG - Intergenic
932660684 2:73648902-73648924 AAGGGGCAAACAAGCTCCTTTGG - Intergenic
936697535 2:114967821-114967843 AAGAGGCAAGGAAAATGCCCTGG - Intronic
936863226 2:117047207-117047229 AAGGGAAAAGGAAGCCCCTCAGG + Intergenic
937452302 2:122011553-122011575 ACGAGGGCAGGAAGCTCCTGGGG + Intergenic
937454103 2:122026383-122026405 CAGAGGGAAGGAACCTCCTTAGG + Intergenic
937635725 2:124153579-124153601 ATGAGGCAAGAAAGCCCCCCGGG + Intronic
938945435 2:136208100-136208122 AACCAGCAAGGAAGCTCTTCTGG + Intergenic
939833022 2:147095356-147095378 CAGAGGCAAGAAAGCTCCAGAGG - Intergenic
941534063 2:166701720-166701742 AAGAGGAAAGAAAATTCCTCAGG + Intergenic
942145547 2:173023138-173023160 ACGAGGAAAGGAAGATGCTCCGG + Intronic
942493407 2:176512480-176512502 AAGGGGCAAACAAGCTCCTTTGG - Intergenic
942955974 2:181773812-181773834 AAGGGGCAAGGTAGCTCTTTGGG - Intergenic
943307031 2:186275702-186275724 AAGGGGCAAGAGAGCTCTTCAGG + Intergenic
944924586 2:204451391-204451413 AAAAGGCAAAGTATCTCCTCTGG + Intergenic
945271536 2:207945356-207945378 AACAGCCAAGGAGGCTCTTCAGG - Intronic
946045330 2:216816237-216816259 GAGAGGCTTGGAAGCTCCACTGG + Intergenic
946357271 2:219195799-219195821 AAGAAGCCAGGAAGCTTCTCAGG + Intronic
946878179 2:224151003-224151025 AAGGGGCAAGGCAGCTCCCTGGG - Intergenic
947063124 2:226189219-226189241 AAGAGGCCAGGAAGCAGCTCGGG + Intergenic
947779023 2:232740388-232740410 AGGAGCCAAGAAAGCTCCTTTGG + Intronic
1168859740 20:1037336-1037358 AAGAGGAAAGGAAGTTGCTCAGG + Intergenic
1170075091 20:12410462-12410484 AAGGGGCAAGGCAGCTCCCTGGG - Intergenic
1171564631 20:26169660-26169682 AAGAGGAAAGGAAATTCATCTGG - Intergenic
1171977515 20:31605012-31605034 AGGAGGCAAGGAAGCTAAGCAGG - Intergenic
1172099555 20:32476974-32476996 GAGAGGCAAGGAGGCTGCTGTGG + Intronic
1173416224 20:42858557-42858579 AAGAGGCAAGGCAGCTCTCTGGG - Intronic
1174098186 20:48106253-48106275 AAGAGGCAAGGAATTGCCTGCGG - Intergenic
1174312616 20:49669747-49669769 AAAAAGCAAGGCAACTCCTCCGG - Intronic
1174547949 20:51340385-51340407 AGGAGGCTAGGAGGGTCCTCTGG - Intergenic
1175166401 20:57047528-57047550 AGGAGGCCAGCAAGCCCCTCAGG + Intergenic
1175434250 20:58931515-58931537 AAGGGGCAAGGCAGCTCCCTGGG - Intergenic
1175865295 20:62172804-62172826 AAGAGGCGAGCACGGTCCTCGGG + Intronic
1175865327 20:62172921-62172943 AAGAGGCGAGCACGCTCCTCGGG + Intronic
1176869161 21:14072776-14072798 AAGTGGCAAGAAAGCTCCGGGGG - Intergenic
1177341387 21:19805665-19805687 TAGAGGCAAGGATGCTCATCTGG - Intergenic
1178097877 21:29234908-29234930 AAGAGGGAAGGGGTCTCCTCTGG - Intronic
1178113506 21:29394028-29394050 AAGTGTCTAGGAAGCTCCTGTGG + Intronic
1179596760 21:42448181-42448203 AAAAGGCAAGGATCCTCCCCTGG - Intergenic
1179655928 21:42844761-42844783 CAGAGGCAAGGAAGCTTAGCAGG + Intronic
1181436331 22:22913460-22913482 AGGAGCCATGGAAGCTCCTGGGG - Intergenic
1181901636 22:26160834-26160856 CAGAGACCAGGAATCTCCTCAGG - Intergenic
1183983982 22:41559319-41559341 AAGGGGAAGGGAGGCTCCTCTGG + Intergenic
1184704484 22:46201300-46201322 AAGAGGCAAGTGAGCCCCTGAGG + Intronic
1185214309 22:49589790-49589812 AAGAGGCAAGGAGGCCCCGCTGG - Intronic
949242081 3:1885562-1885584 AACAGGCCAGAAAGCTTCTCAGG - Intergenic
950408313 3:12818005-12818027 CAGAGGCAAGGAAGCTACAGAGG + Intronic
950570378 3:13796146-13796168 CAGAGGGAAGGAAGCTCCTAGGG - Intergenic
951551135 3:23876189-23876211 AAGAGGAAAGGAAGAGGCTCTGG - Intronic
953244936 3:41182543-41182565 AAGAGGCCAGGAGGATGCTCAGG + Intergenic
953537969 3:43790258-43790280 CACAGGCAAGCAAGCTCCCCAGG + Intergenic
953976949 3:47389216-47389238 AACAGGGAAGGAAGATGCTCAGG - Intronic
954554282 3:51505951-51505973 AAGGGGCAAGGGTGCTCCTCTGG - Intergenic
955706544 3:61733315-61733337 AAACGGAAAGGAAGCTCCACTGG - Intronic
955796069 3:62638479-62638501 AAGTGGCAAGTAATCTTCTCTGG + Intronic
956821802 3:72960464-72960486 AAGAAGCAATTAAACTCCTCTGG - Intronic
957428319 3:80069323-80069345 AAGAGGCAAGAAAGCTTCTTAGG + Intergenic
957566662 3:81892765-81892787 CACAGTCAAGGAAGCTACTCAGG - Intergenic
961316098 3:126036595-126036617 AAGAGGCAGCGAAGCACCCCAGG - Intronic
961505456 3:127368251-127368273 AAGATGAAAGGCAGCTTCTCAGG + Intergenic
961570124 3:127791678-127791700 AAAAGGCAAGGAAGGAACTCCGG - Intronic
961958766 3:130832101-130832123 AAGTGGAAAAGAAGTTCCTCAGG + Intergenic
962637380 3:137345010-137345032 TAGAGAGAAGGAAGCTTCTCGGG - Intergenic
963877921 3:150497600-150497622 AGGAGGGAAGGAGGCTTCTCTGG - Intergenic
965061705 3:163791972-163791994 GAGAGGCAAGGAAGGTCAACAGG + Intergenic
965499501 3:169440841-169440863 AAGAGTCAAGTAATCACCTCTGG + Intronic
967137159 3:186522100-186522122 AAGAGGAAAGAAAGCCCATCTGG + Intergenic
967684068 3:192399294-192399316 AAGGGGCAAGGGAGCTCCCTGGG - Intronic
969409900 4:7021098-7021120 TAGAGGCAAGGAAGCACCATGGG - Intronic
969426121 4:7125073-7125095 AAAAGGCAAGGAGGCTCAGCTGG + Intergenic
969490637 4:7497496-7497518 ACGGGGCAAGGAATCTCCACAGG - Intronic
969965232 4:10987168-10987190 AAGGGGCAAGGAAGCTCCCTGGG - Intergenic
971501325 4:27321231-27321253 AAGAGGCAAGGGAGCTCTGTGGG - Intergenic
972840139 4:42921172-42921194 AAGGGGCAAGCAAGCTCCCTTGG - Intronic
973604393 4:52572062-52572084 AAGAGGCAAGCTAGCTCCCTCGG + Intergenic
974619053 4:64332161-64332183 AAGAGGCGAGGAAGCTGAGCAGG + Intronic
974824594 4:67111551-67111573 AAGAGACAAGAATCCTCCTCTGG - Intergenic
975393010 4:73841868-73841890 AAGTTGCAAGGACGCTTCTCTGG + Intronic
976334699 4:83871834-83871856 AAGGGGCAAGGCAGCTCTTCGGG + Intergenic
977748461 4:100579845-100579867 AAGGGGCAAGGAAGCTCTTTGGG - Intronic
977995012 4:103491018-103491040 AAAAGGTAAGGGAGCTCGTCTGG - Intergenic
980206712 4:129729113-129729135 AAGAGGCAAGGCAGCTCTCTGGG - Intergenic
980267119 4:130531213-130531235 AAGAGGCAAGGCAGCTCACTTGG + Intergenic
981160903 4:141497392-141497414 AAGTGGCAAAGAAGCTTCTGTGG - Intergenic
981918058 4:150056496-150056518 AAGAGTCAAGTTAGCTCCACTGG + Intergenic
982256361 4:153455188-153455210 AAGAGGCAAGGCAGCTCTCTGGG - Intergenic
982764662 4:159331712-159331734 AAAAGGCAAAGGAGCTTCTCGGG - Exonic
986797169 5:11223475-11223497 GAGAGGAAAGGAAGCTACACTGG - Intronic
986867288 5:12004757-12004779 AAAAGATAAGGAAGCTCCTCTGG + Intergenic
987157639 5:15106831-15106853 AAGAGGTTAGGAGGCTGCTCTGG + Intergenic
987556200 5:19454029-19454051 AAGTGGCAAGGCAGCTCTCCAGG + Intergenic
988485161 5:31662608-31662630 AAGAGGCAAGGCAGCTCTCTTGG + Intronic
988488191 5:31684694-31684716 AAGAGGCAAGGAAGATAGGCAGG - Intronic
988554995 5:32228944-32228966 CAGAGGAATGGACGCTCCTCAGG + Exonic
989098546 5:37803445-37803467 AAGGGGCAAGGCAGCTCCCTGGG - Intergenic
990400972 5:55436975-55436997 AAGGGGCAAGGGAGCTCCCCTGG - Intronic
991619023 5:68526024-68526046 CAGAGGCAGGGAAGCTGCTCAGG - Intergenic
992070526 5:73144587-73144609 AAGAGGCAAGGGAGCTCTCTGGG - Intergenic
992873234 5:81026380-81026402 AAGAGGCAAAAAGGCTCCTTGGG - Intronic
993915859 5:93741919-93741941 AAGAGGTTAGGTAGCTCCTGGGG - Intronic
994124155 5:96151023-96151045 TCCAGGCAAGGAAGCTCATCAGG - Intergenic
995399199 5:111721382-111721404 AGTAGGCAAGGAACCTCATCAGG - Intronic
995479251 5:112578663-112578685 AAGAGGCAAATAAGCTCCCCTGG - Intergenic
997286739 5:132685143-132685165 GAGAGTCATGGAGGCTCCTCAGG + Intergenic
997630000 5:135360246-135360268 AAGAGGGCAGGCAGCTCCTGTGG - Intronic
998068289 5:139176672-139176694 AAGAGGCAAGGAAGCTCCTCGGG + Intronic
998399900 5:141843229-141843251 AAGAGCCAGGGATCCTCCTCTGG - Intergenic
999379625 5:151110955-151110977 AACAGGCCTGGAATCTCCTCTGG - Intronic
1001277049 5:170358715-170358737 AAGAGGCAAGGAAGGTGCCTAGG - Intronic
1001487112 5:172127618-172127640 AAGCAGCCAAGAAGCTCCTCTGG - Intronic
1002139515 5:177130546-177130568 AAGAGGCAGGTAAGGCCCTCAGG + Intergenic
1002381849 5:178836319-178836341 AAGGGGCAAGGAAGCTCTTTGGG + Intergenic
1002437585 5:179241256-179241278 AAGGTGCCTGGAAGCTCCTCGGG + Intronic
1003073267 6:2961026-2961048 GAAAGGCAAGGAGGATCCTCTGG + Exonic
1003251272 6:4430955-4430977 AAGAGGCAAGGGAGCTCTCTTGG - Intergenic
1003368844 6:5505261-5505283 AAGAGCGAAGGAAGCTCCCAGGG - Intronic
1003486821 6:6587254-6587276 AAGAGACAAGGTGGCCCCTCTGG - Intergenic
1003858019 6:10295486-10295508 AAAAGAGAAAGAAGCTCCTCGGG + Intergenic
1004555350 6:16691897-16691919 AAGAGGCAAAGCAGTTCCTGGGG - Intronic
1005901956 6:30224371-30224393 AAGAGACAAGGGAGCTCTTTGGG - Intergenic
1006307168 6:33230080-33230102 AAGGGGCAAACAAGCTCCTTTGG - Intergenic
1006548911 6:34804131-34804153 AAGACGCTAGGAAGCTCACCTGG - Intronic
1007501262 6:42298979-42299001 AAAAGCTAAGGTAGCTCCTCGGG + Intronic
1007720699 6:43883857-43883879 AAGAGGCAAAGTAGCTGCCCTGG - Intergenic
1007924480 6:45640433-45640455 CAGAGGCTGGGAAACTCCTCAGG + Intronic
1008568406 6:52791864-52791886 AAGAAGCAAGGAAGATTTTCAGG - Exonic
1008572860 6:52831854-52831876 AAGAAGCAAGGAAGATTTTCAGG - Exonic
1009041773 6:58188897-58188919 AAGAGGCAAGGCAGCTCTCTGGG + Intergenic
1009217623 6:60943160-60943182 AAGAGGCAAGGCAGCTCTCTGGG + Intergenic
1013572042 6:111438116-111438138 TTGAGGCAAGGCAGCTACTCAGG - Intronic
1017399886 6:154047964-154047986 AAGAGGCAAGGAAGCTCTCTAGG + Intronic
1018223095 6:161601347-161601369 AAGGGGCAAACAAGCTCCTTTGG + Intronic
1019938205 7:4269957-4269979 ACGCAGCAAGGAAGCTACTCTGG + Intergenic
1020920831 7:14262387-14262409 AAGGGGCAAGCAAGGTCCCCTGG - Intronic
1021438309 7:20647608-20647630 AATATGAAAGGCAGCTCCTCGGG - Exonic
1022444780 7:30460929-30460951 AAGATTCAGGGAAGCTGCTCTGG + Intronic
1023093589 7:36638791-36638813 AAGAGGAAAAGATGCTCTTCAGG + Intronic
1024390586 7:48807192-48807214 AAGGGGCAAGGCAGCTCCTTGGG - Intergenic
1024638457 7:51309969-51309991 AAGGGGCAAGAAAGCTCTCCAGG + Intronic
1024777264 7:52802004-52802026 AAGAAGCAAGGTAGCTGCTCAGG - Intergenic
1024853241 7:53745249-53745271 TAATGGCAAGGAAGCTCATCAGG + Intergenic
1026253826 7:68693621-68693643 AAGGGGCAAACAAGCTCCTTTGG + Intergenic
1030145408 7:106348928-106348950 AATGGCCAAGGAAGTTCCTCAGG + Intergenic
1030225840 7:107149512-107149534 AAGGGGCAAGGGAGCTCATTGGG + Intronic
1031681055 7:124675191-124675213 AAGGGGCAAGGCAGCTCTTTGGG - Intergenic
1032558577 7:132863850-132863872 AAGAGGCAAGGAAGCTTCAGAGG - Intronic
1032646457 7:133830169-133830191 AAGAAGCAATTAAGCTCCTGTGG - Intronic
1032770481 7:135048992-135049014 AAAAGGCAAGGATGCTCACCTGG - Intronic
1035487062 7:159234302-159234324 AAGAGAAAAGAAATCTCCTCTGG - Intergenic
1036756968 8:11477227-11477249 GTGAGGAAAGGCAGCTCCTCTGG + Intergenic
1037881043 8:22573637-22573659 AAGAGGAAAGGGAGGTACTCGGG + Intronic
1037892187 8:22629251-22629273 AAGAGGCAAGGAAGTGCAGCTGG + Intronic
1038930824 8:32191791-32191813 AAGAGCCAAGGCAGCTCCAAAGG + Intronic
1041117394 8:54553429-54553451 AAGAGGCAAGGGAGCTCTCTGGG + Intergenic
1041872603 8:62652053-62652075 AAGGGGCAAGGAAGCTCTCTAGG + Intronic
1041909355 8:63072033-63072055 CAGAGGAAAGGCAACTCCTCTGG - Intronic
1042478113 8:69272691-69272713 AAGAGGTAAAGGAGCTTCTCAGG - Intergenic
1043055908 8:75438241-75438263 AAAAGGCAAGAAAGTTCATCTGG - Intronic
1044409729 8:91869400-91869422 AAGAGGCAAGGAAGCTCTCTGGG - Intergenic
1045139560 8:99265724-99265746 AAGAGGCCAGGAAGCTCTGAAGG - Intronic
1046149644 8:110206937-110206959 AAAAGGCAAGGAAATTCCTAGGG - Intergenic
1046962409 8:120125085-120125107 AAGAGGAAAGGAAGGCCCGCCGG - Intronic
1048465558 8:134662166-134662188 AAGGGGCAAGGTAGCTCTTTGGG + Intronic
1049192390 8:141295554-141295576 AAGATGCAAAGAAGCTGGTCTGG + Intronic
1050315894 9:4400568-4400590 AAGAGGAAAGGAGTCTTCTCTGG - Intergenic
1051699319 9:19802948-19802970 AAGAGGCAAAGAAGCTCCCCAGG - Intergenic
1051781399 9:20692279-20692301 AAGAGTCAAGGATGATACTCAGG - Intronic
1053023034 9:34708873-34708895 GAGAGGCAAGGAAACTCTTGGGG + Intergenic
1056135947 9:83629512-83629534 AAGAGGCCAGGGAGCTCCTGTGG - Intronic
1056423478 9:86453186-86453208 AAGGGGCAAGGCAGCTCCCTGGG + Intergenic
1056943764 9:90976681-90976703 AAGAGACAAAGAGGCTCCTTGGG - Intergenic
1057479083 9:95430038-95430060 ATGGGGCAAGGCAGCTCTTCAGG - Intergenic
1058188421 9:101883884-101883906 AAGGGGCAAGGCAGCTTCTGGGG - Intergenic
1059149464 9:111936195-111936217 AAGAGGCAAGAAAGCTCTCTGGG - Intergenic
1059226141 9:112674917-112674939 AAGAGGCAAGGAAGCCACTCAGG - Intergenic
1060188110 9:121576083-121576105 AAGAGGCAAGGCAGCTGTGCAGG - Intronic
1060671612 9:125474620-125474642 AAGAGTCAAGCAGTCTCCTCTGG - Intronic
1061700991 9:132415453-132415475 AAGAGGACAGCAGGCTCCTCCGG - Intronic
1062416058 9:136450846-136450868 GATAGGCAAGGAGGCTCCTGGGG + Intronic
1185484352 X:470964-470986 ATGAGGCAAGGAAGCCACTTTGG - Intergenic
1186035913 X:5423522-5423544 AAGGGGCAAGGAAGCTCTCTGGG - Intergenic
1186450920 X:9673021-9673043 AAGAGGCAAGGGAGCTCTCTGGG + Intronic
1187049212 X:15679321-15679343 TAGAGGTAAGGAACCTCCACAGG + Intergenic
1187339116 X:18405641-18405663 GAGGGGCAAGGAAGCCACTCTGG + Intergenic
1189080318 X:37964165-37964187 AAGGGGCAAGGGAGCTCTTTGGG - Intronic
1189902176 X:45717970-45717992 AAGAGGCAAGTGAGCTCTTTGGG + Intergenic
1191183212 X:57583591-57583613 AAAAGGCAAGGTAACTCCTGGGG + Intergenic
1191250731 X:58259012-58259034 AAGCAGCAAGGAACCCCCTCAGG + Intergenic
1191251096 X:58260543-58260565 AAGCGGCAAGGAAGCCCCAGGGG + Intergenic
1192252878 X:69427935-69427957 AATAGGCAAGGAAGCTGGTATGG + Intergenic
1192304504 X:69944592-69944614 AAGAGGGAAGGAATCTCTCCTGG + Intronic
1192306642 X:69967354-69967376 AAGAGTCAAGGAAGCCACCCAGG + Intronic
1192534979 X:71919618-71919640 CAGAGGAAAGGAAAATCCTCGGG - Intergenic
1193726459 X:85045372-85045394 AAGAGCAAGGGAAGCTACTCAGG - Intronic
1194196888 X:90905023-90905045 AAGGGGCAAGGCAGCTCTTTGGG + Intergenic
1194268331 X:91780879-91780901 GAGAGGCAAGGAAGCGGCTCTGG - Intronic
1194764765 X:97837074-97837096 AAGGGGCAAGGCAGCTCTTTGGG + Intergenic
1196795914 X:119501794-119501816 TAGAGGCAGGAAAGCTCATCAGG + Intergenic
1197565444 X:128078753-128078775 AAAAGGCCAGGTAGCTCCACAGG - Intergenic
1198738191 X:139810718-139810740 AAGAGGTAAAGAAGCTCCTTGGG - Intronic
1199301300 X:146217424-146217446 AAGAAGCAAACAAGCTCCTTTGG - Intergenic
1199858774 X:151781088-151781110 AAGAGCCAAGAAGGCTCCTCTGG - Intergenic
1199876951 X:151940177-151940199 AAGAGGCAAAGAACAGCCTCTGG + Intergenic
1200542737 Y:4479229-4479251 AAGGGGCAAGGCAGCTCTTTGGG + Intergenic
1200585530 Y:5001791-5001813 GAGAGGCAAGGAAGCGGCTCTGG - Intronic
1201977499 Y:19868905-19868927 AAGAGGCCAGGATGCTCAGCCGG + Intergenic