ID: 998068290

View in Genome Browser
Species Human (GRCh38)
Location 5:139176686-139176708
Sequence CTCCTCGGGCCTCTTTTATA AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 1115
Summary {0: 1, 1: 3, 2: 41, 3: 237, 4: 833}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
998068286_998068290 3 Left 998068286 5:139176660-139176682 CCTCACATGCAGAAGAGGCAAGG 0: 1
1: 0
2: 1
3: 32
4: 264
Right 998068290 5:139176686-139176708 CTCCTCGGGCCTCTTTTATAAGG 0: 1
1: 3
2: 41
3: 237
4: 833
998068284_998068290 17 Left 998068284 5:139176646-139176668 CCTTCTTACTGGGTCCTCACATG 0: 1
1: 58
2: 666
3: 1875
4: 3104
Right 998068290 5:139176686-139176708 CTCCTCGGGCCTCTTTTATAAGG 0: 1
1: 3
2: 41
3: 237
4: 833

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
998068290 Original CRISPR CTCCTCGGGCCTCTTTTATA AGG Intronic
900765926 1:4505336-4505358 TTCCTTGGACCTTTTTTATAAGG - Intergenic
900949139 1:5847785-5847807 GGCCTGGGGCCTCTTTTATGAGG - Intergenic
901219701 1:7576463-7576485 TCTCTTGGGCCTCTTTTATAAGG - Intronic
902611256 1:17598547-17598569 TCTCTAGGGCCTCTTTTATATGG + Intronic
902652893 1:17848206-17848228 CTCCTGGGGTCTCTTTTATAAGG + Intergenic
903558870 1:24212813-24212835 TCTCTGGGGCCTCTTTTATAAGG - Intergenic
903696479 1:25211094-25211116 CTCCTAGTGCCTCTTCTACATGG + Intergenic
904000009 1:27333579-27333601 TCCCTCAGGGCTCTTTTATAAGG + Intronic
904450202 1:30606147-30606169 CTCCTCAGGCCCCTTGTGTAGGG + Intergenic
904869872 1:33609971-33609993 TCTCTCAGGCCTCTTTTATAAGG - Intronic
905336895 1:37250883-37250905 TCCCTTGGGGCTCTTTTATAAGG - Intergenic
905372238 1:37489084-37489106 CTCCTCAGGCCTCTTTTATAAGG - Intergenic
905530652 1:38676103-38676125 TCCCTTAGGCCTCTTTTATAAGG + Intergenic
905749013 1:40445474-40445496 TCTCTGGGGCCTCTTTTATAAGG + Intergenic
905917000 1:41691526-41691548 TTTCTTTGGCCTCTTTTATAAGG - Intronic
906896814 1:49782980-49783002 TTTCTGGGGCCTCTTATATAAGG - Intronic
907082927 1:51641268-51641290 TGACTGGGGCCTCTTTTATAAGG + Intronic
907148760 1:52262210-52262232 TCCCTCAGGCTTCTTTTATAGGG + Intronic
907446637 1:54512345-54512367 TGTCTGGGGCCTCTTTTATAAGG + Intergenic
907626916 1:56039603-56039625 TTGCTCAAGCCTCTTTTATAAGG + Intergenic
907964172 1:59313163-59313185 TTCCTTGGGCCTCTTTTATGAGG + Intronic
908540879 1:65120878-65120900 TTCCTCAGGCATCTTTTATAAGG - Intergenic
908554639 1:65245585-65245607 CTCTCTGGGCCTCTTTTATAAGG + Intergenic
908570910 1:65409084-65409106 TTGCTCAGGCCTCTTTCATAAGG + Intronic
908592614 1:65650337-65650359 TCCCTGGGGTCTCTTTTATAAGG + Intergenic
908631475 1:66114100-66114122 TCTCTCGGGCCTCTTTTATAAGG - Intronic
908810247 1:67974940-67974962 ATTCTGGGGCCTCTTTTATAAGG + Intergenic
908927114 1:69269397-69269419 CTCTCTGGGTCTCTTTTATAAGG + Intergenic
909103442 1:71379411-71379433 TTTCCAGGGCCTCTTTTATAAGG - Intergenic
909134598 1:71782186-71782208 CTCGTGGGGTCTATTTTATAAGG - Intronic
909395189 1:75163867-75163889 CCCCTTAGGTCTCTTTTATAAGG - Intergenic
909600349 1:77455348-77455370 AAGCTGGGGCCTCTTTTATAAGG - Intronic
909831831 1:80202004-80202026 TTCCCCAGGCCTCTTTTATAAGG + Intergenic
909945369 1:81657260-81657282 TCCCTCAGACCTCTTTTATAAGG - Intronic
910011462 1:82468786-82468808 TCCCTTGGTCCTCTTTTATAAGG + Intergenic
910138990 1:84005559-84005581 TGGCTGGGGCCTCTTTTATAAGG - Intergenic
910965757 1:92806537-92806559 CTCTGGGGGCCTCTTTGATAAGG - Intergenic
911197584 1:95011256-95011278 ATTCTAGGGTCTCTTTTATAAGG - Intronic
911228538 1:95334468-95334490 TTTCTAGGGCCTCTTTTAAAAGG + Intergenic
911314462 1:96339380-96339402 TCACTCAGGCCTCTTTTATAAGG + Intergenic
911377537 1:97069556-97069578 TCCCTAGGCCCTCTTTTATAAGG + Intergenic
911724138 1:101223954-101223976 TCTCTGGGGCCTCTTTTATAAGG - Intergenic
911754579 1:101538164-101538186 TTCCTGGGGTCTCTTTTATAAGG + Intergenic
912666435 1:111584484-111584506 ACCCTCAAGCCTCTTTTATAAGG + Intronic
913240049 1:116822112-116822134 ACCCTCAGGCCTCTTTTATATGG + Intergenic
913348242 1:117829317-117829339 CCTCTGGAGCCTCTTTTATAAGG + Intergenic
913446508 1:118956014-118956036 TTTCTGGGGCCTCTTTTATAAGG - Intronic
913530298 1:119729277-119729299 CTCCTCCATCCTCTTTTGTAAGG + Intronic
914759912 1:150590334-150590356 CTTCTGGGGCCTCTTATAAATGG + Intergenic
916086081 1:161270546-161270568 AGCCTGGGGTCTCTTTTATAAGG - Intronic
916118610 1:161509089-161509111 TCCCTCGGCCCTCTTTTATAAGG - Intronic
916490002 1:165293781-165293803 TCCCTCAGGCCCCTTTTATAAGG + Intronic
916523239 1:165584736-165584758 CAGATCAGGCCTCTTTTATAAGG - Intergenic
916526777 1:165617804-165617826 TCCCTCAAGCCTCTTTTATAAGG - Intergenic
916821579 1:168403981-168404003 TTTCTGGGGCCTCTTTTATAGGG + Intergenic
917005030 1:170405593-170405615 GTTCTTGAGCCTCTTTTATATGG - Intergenic
917201604 1:172522760-172522782 GGGCTTGGGCCTCTTTTATAAGG - Intergenic
917255402 1:173110506-173110528 CTCCTCTGGGCTCTTCTACAGGG - Intergenic
917354799 1:174115838-174115860 TTCTTGGGGCCTCTTTTATAAGG - Intergenic
917652956 1:177096874-177096896 TCACTGGGGCCTCTTTTATAAGG - Intronic
917744260 1:177992489-177992511 TCCCTCAGGCCTCTTTTGTAAGG + Intergenic
917851213 1:179065954-179065976 TCCCTCTGGCCTCATTTATAAGG + Intronic
918402065 1:184173492-184173514 ATCCTCAGGCCTTCTTTATAAGG - Intergenic
918920968 1:190709140-190709162 TCTCTTGGGCCTCTTTTATAAGG + Intergenic
919187289 1:194168769-194168791 TCTCTCGGGCCACTTTTATAAGG - Intergenic
919412725 1:197266363-197266385 TCCCTCAGGCCTCTTTTATAAGG + Intergenic
919484930 1:198134251-198134273 TCTCTGGGGCCTCTTTTATAAGG - Intergenic
920670569 1:208001004-208001026 CTCCTCTGGTCTCTTTTATAAGG - Intergenic
920814424 1:209318098-209318120 TTCCTTAGGCCTCTTTTATAAGG + Intergenic
920969722 1:210732777-210732799 TCTCTGGGGCCTCTTTTATAAGG + Intronic
921184307 1:212656663-212656685 CCTCTTGGGCCTCTTTTATAAGG - Intergenic
921718988 1:218449812-218449834 CATCTCAGGCCACTTTTATAAGG + Intergenic
921753482 1:218824904-218824926 TTCCTCAGGCCCCTTTTATAAGG - Intergenic
921918536 1:220641347-220641369 TCCCTTGGGCCTCTTTTGTAAGG - Intronic
922131958 1:222788696-222788718 TTCCTTGGGCCTCTGTTGTAAGG - Intergenic
922171846 1:223162080-223162102 TCCCTCAAGCCTCTTTTATAAGG - Intergenic
922254283 1:223879070-223879092 TCCCTTGGGCCTCTTTTATAAGG + Intergenic
922277624 1:224093635-224093657 TTCCTTGGACCTCTTTTATAAGG - Intergenic
922514231 1:226195015-226195037 GGCCTGGGGTCTCTTTTATAAGG + Intergenic
922860350 1:228811011-228811033 TCTCTAGGGCCTCTTTTATAAGG + Intergenic
923358212 1:233181779-233181801 ATTCTAGGGCCTCTTTTACAAGG + Intronic
923390870 1:233513802-233513824 TCTCTCAGGCCTCTTTTATAAGG + Intergenic
923625819 1:235612983-235613005 CTCCTCAGGCTTCTTTTATAAGG + Intronic
923757375 1:236804287-236804309 GCCCTTGAGCCTCTTTTATAAGG - Intronic
924152608 1:241143859-241143881 TCCCTCAGGCCTCCTTTATAAGG - Intronic
924415635 1:243853406-243853428 CATCTTGAGCCTCTTTTATAAGG + Intergenic
924433337 1:244016482-244016504 TCCATGGGGCCTCTTTTATAAGG - Intergenic
924696716 1:246408045-246408067 TCCCTTGGGCCTCTTTTATGAGG + Intronic
924721646 1:246628647-246628669 TCCCTTGGGCCTCTTTTGTAAGG + Intronic
1064218094 10:13417278-13417300 TCCCTTGGGCCTCTTTTATAAGG - Intergenic
1064669472 10:17696017-17696039 CCTCTGGGGTCTCTTTTATAAGG + Intronic
1064829868 10:19450882-19450904 TCCCTTGGGCCTATTTTATAAGG + Intronic
1064847145 10:19668006-19668028 CCTCTGGGGCCTCTTTTACAAGG + Intronic
1065362172 10:24898913-24898935 ATTCTGGGGACTCTTTTATAAGG - Intronic
1065710572 10:28513178-28513200 TTTCTTGAGCCTCTTTTATAAGG - Intergenic
1065801204 10:29354348-29354370 TCCCTCAGGCTTCTTTTATAAGG - Intergenic
1066232568 10:33451194-33451216 TCCCCCGGGCCTCTTTTATAAGG + Intergenic
1067050198 10:43011555-43011577 TCCCTCAGGCCTCTTTTATAGGG - Intergenic
1067221234 10:44345825-44345847 TCCCTCAGGCCTCTTTTATAAGG + Intergenic
1068909343 10:62361552-62361574 CTCTCTGGGCCTCTTTTATAAGG - Intergenic
1069013582 10:63401835-63401857 CTGCTGGGTCCTCTTTTATTAGG - Intronic
1069243861 10:66176657-66176679 TCTCTGGGGCCTCTTTTATAAGG - Intronic
1069656359 10:70092129-70092151 TCCCTCAGGCCTCTTTTATAAGG - Intronic
1069732646 10:70628458-70628480 CCCTTGGGGCTTCTTTTATAAGG + Intergenic
1070487163 10:76942254-76942276 GGCCTCAGGCTTCTTTTATAAGG + Intronic
1070578912 10:77704041-77704063 TTTCTGGGGTCTCTTTTATAAGG - Intergenic
1071009069 10:80916012-80916034 TCTCTGGGGCCTCTTTTATAAGG + Intergenic
1071151399 10:82639299-82639321 TCCCTTGGGCCTCTTTTATAAGG + Intronic
1071200580 10:83217665-83217687 TTCCTCTGGTATCTTTTATAAGG + Intergenic
1071734744 10:88285925-88285947 TTCCTTGGGCCTGTTTTATAAGG - Intronic
1071954748 10:90745342-90745364 TCCCTCAGGCCTCTTTTATAAGG + Intronic
1072036849 10:91570600-91570622 TCACTCAGGCCTCTTTTATAGGG - Intergenic
1072422332 10:95299628-95299650 TCCCTTGGGCCTCTTTTACAAGG + Intergenic
1072512241 10:96139426-96139448 CCTCTGGGGTCTCTTTTATAAGG - Intronic
1072530865 10:96317647-96317669 TCTCTCGGGCCTCTTTTTTAAGG - Intronic
1072597892 10:96892552-96892574 CTCTTGGTGCCTCTTTTATAAGG + Intronic
1072708673 10:97700998-97701020 TCTCTGGGGCCTCTTTTATAAGG + Intergenic
1072716383 10:97755531-97755553 TCTCTGGGGCCTCTTTTATAAGG + Intronic
1073955359 10:108864534-108864556 CATCTGGAGCCTCTTTTATAAGG - Intergenic
1074079709 10:110157824-110157846 TCTCTCTGGCCTCTTTTATAAGG + Intergenic
1074431959 10:113401853-113401875 GCCCTCAGGCCTCTTTTATAAGG + Intergenic
1074489559 10:113927000-113927022 TCCCTCAAGCCTCTTTTATAAGG - Intergenic
1075098256 10:119487890-119487912 TTTCTGGGGCCTCTTTGATAAGG - Intergenic
1075312184 10:121423663-121423685 TCCCTTAGGCCTCTTTTATAAGG + Intergenic
1075321516 10:121495000-121495022 CTCATCGGCCCCCTTTTATCTGG + Intronic
1075580729 10:123616167-123616189 ACTCTGGGGCCTCTTTTATAAGG - Intergenic
1076595024 10:131620022-131620044 TTCCTCTGGCCTGTTTCATAAGG + Intergenic
1077280336 11:1741872-1741894 TCCCTGGGGCCCCTTTTATAAGG - Intronic
1077993591 11:7433660-7433682 TTCCTTGGGCCTCTTTTATAAGG - Intronic
1078412689 11:11140405-11140427 TTTCTGGGGCCCCTTTTATAAGG - Intergenic
1078772763 11:14366011-14366033 TTCCTCAAGCCTCTTTTATAAGG - Intergenic
1078884216 11:15483989-15484011 CTCCTTGGGACTCTAATATAGGG + Intergenic
1078908964 11:15713238-15713260 GACCCTGGGCCTCTTTTATAAGG + Intergenic
1078963240 11:16304388-16304410 TCCCTCAGACCTCTTTTATAAGG - Intronic
1079018880 11:16892976-16892998 TCCCTAGGGCCCCTTTTATAGGG + Intronic
1079091582 11:17484314-17484336 TCTCTGGGGCCTCTTTTATAAGG - Intergenic
1079147832 11:17869595-17869617 TCCCTTGGACCTCTTTTATAAGG + Intronic
1079503119 11:21124951-21124973 TTCCTGGGGTCTCCTTTATAAGG + Intronic
1079794969 11:24789790-24789812 TTCCTTGGGCTTCTTGTATAAGG + Intronic
1080282224 11:30570279-30570301 ACTCTGGGGCCTCTTTTATAAGG + Intronic
1080593027 11:33740016-33740038 TTCCTCAGGCCTCTTTTATAAGG - Intergenic
1080743948 11:35091040-35091062 CCTCTGAGGCCTCTTTTATAAGG - Intergenic
1080801409 11:35613653-35613675 TTACTGGGGTCTCTTTTATAAGG + Intergenic
1080961864 11:37169881-37169903 CTTCTGGGGCCTCTTTCACAAGG + Intergenic
1081205289 11:40267962-40267984 CTCCTTGTGCCTCTTTTTTCTGG + Intronic
1081418263 11:42841274-42841296 TTTCTTGGGCCTCTTTTATACGG - Intergenic
1081515465 11:43824568-43824590 TCCCTCAGGCCTCTTTTATAAGG + Intronic
1081609844 11:44554792-44554814 CTCCTTGGGCCTCTTTTAAAAGG - Intergenic
1081795955 11:45819779-45819801 TGGCTCTGGCCTCTTTTATAAGG + Intergenic
1082267973 11:50140052-50140074 TCCCTGGGGTCTCTTTTATAAGG + Intergenic
1082990234 11:59201177-59201199 TCTCTGGGGCCTCTTTTATAAGG + Intronic
1085250247 11:75138715-75138737 TCTCTCAGGCCTCTTTTATAAGG + Intronic
1085792720 11:79509796-79509818 CTCCTCAGTACTCTTTTATAAGG - Intergenic
1086567030 11:88238945-88238967 CTCCAAGGGCCTCTTTAATGAGG - Intergenic
1087038434 11:93775835-93775857 TCCCTCAGGTCTCTTTTATAAGG - Intronic
1087426619 11:97995807-97995829 CACATGGGGCCTCTTTTATAAGG + Intergenic
1087545284 11:99576798-99576820 TCTCTGGGGCCTCTTTTATAAGG + Intronic
1087702203 11:101447915-101447937 CCTCTAGGGCCTCTTTCATAAGG - Intergenic
1088438615 11:109843273-109843295 GGTCTGGGGCCTCTTTTATAAGG + Intergenic
1088758366 11:112906281-112906303 TTCCTCAGGCCTATTTTATAAGG - Intergenic
1088974524 11:114803877-114803899 CCCCTCAGGTCTCTTGTATAAGG + Intergenic
1089604341 11:119633120-119633142 CCCTCTGGGCCTCTTTTATAAGG - Intronic
1089757578 11:120697758-120697780 CTCCTAGGGCGTGATTTATATGG + Intronic
1089998444 11:122931034-122931056 TTCCTTGAGCCTATTTTATAGGG + Intronic
1090155820 11:124437719-124437741 AGCCTCAGGACTCTTTTATAAGG + Intergenic
1090200925 11:124855630-124855652 TCTCTGGGGCCTCTTTTATAAGG + Intergenic
1090687146 11:129134785-129134807 CAGCTCATGCCTCTTTTATAAGG - Intronic
1090909415 11:131105448-131105470 TCCCTGGGGCATCTTTTATAAGG + Intergenic
1090925832 11:131249793-131249815 TTTCTGGGGTCTCTTTTATAAGG + Intergenic
1091848489 12:3676550-3676572 TTCCTCTGGCCTCTTTTATAAGG - Intronic
1092933844 12:13341656-13341678 TCCCTCAGGCCTCCTTTATAAGG - Intergenic
1093241534 12:16682735-16682757 TTTCTCAGGCCTCTTTTATAAGG - Intergenic
1093241942 12:16687457-16687479 TTCCTTGGGCCTTTTTTATGAGG + Intergenic
1093641637 12:21533961-21533983 TCTCTGGGGCCTCTTTTATAAGG + Intronic
1093738581 12:22654095-22654117 TTCTTTGGGCCTCTTTTATAAGG - Intronic
1093794672 12:23297326-23297348 TTCCCTGAGCCTCTTTTATAAGG + Intergenic
1094083115 12:26559494-26559516 TTGCACGGGCCTATTTTATAGGG + Intronic
1094803127 12:34061366-34061388 TTCCTCAGGCCTCTTTTACAAGG + Intergenic
1095116537 12:38359874-38359896 TTCCTCAGGCCTCTTTTACAAGG + Intergenic
1095408485 12:41894725-41894747 TCCCTCTGGCCTTTTTTATAAGG + Intergenic
1095910018 12:47416756-47416778 AGCCTGGGGTCTCTTTTATAAGG - Intergenic
1096384541 12:51186347-51186369 CTCCCTTGGCCTCTTTTATAAGG - Intergenic
1096488683 12:52001584-52001606 TCCCTCAAGCCTCTTTTATAAGG + Intergenic
1097640178 12:62171567-62171589 TCCCTTCGGCCTCTTTTATAAGG - Intronic
1097690951 12:62734083-62734105 TCCCTGGAGCCTCTTTTATAAGG - Intronic
1098111156 12:67123203-67123225 TCCCTTGGGCCTCTTTTATAAGG + Intergenic
1098471221 12:70846629-70846651 CTCTCCTGGCCTCTTTTTTAAGG - Intronic
1098724025 12:73939367-73939389 TCCCTCAGGCCTCTTTTATAAGG - Intergenic
1098854148 12:75633327-75633349 CACCTTGGACCTTTTTTATAAGG - Intergenic
1099415144 12:82375287-82375309 TTCCTTGTACCTCTTTTATACGG - Intronic
1099438483 12:82671077-82671099 CCCCTTGGGCCTCTTTTATAAGG - Intergenic
1099579664 12:84428161-84428183 TCCCTTGGGCCTATTTTATATGG - Intergenic
1099753869 12:86814749-86814771 TCTCTGGGGCCTCTTTTATAAGG - Intronic
1100074283 12:90759843-90759865 ATCCTCAGGTCTCTTTTACAAGG + Intergenic
1100134046 12:91533128-91533150 ACCCTTGAGCCTCTTTTATAAGG - Intergenic
1100298062 12:93281082-93281104 TTTCTGGGGCCTCTTTCATAAGG + Intergenic
1100343969 12:93708985-93709007 TCTCTCGGGCTTCTTTTATATGG + Intronic
1100476543 12:94940542-94940564 TTTCTGGGGCCTCTTTTATAAGG - Intronic
1100747294 12:97660476-97660498 TCTCTGGGGCCTCTTTTATAAGG + Intergenic
1100779320 12:98007477-98007499 CTCTCTGGGCCTCTTTTGTAAGG - Intergenic
1100841160 12:98612818-98612840 AATCTGGGGCCTCTTTTATAGGG - Intergenic
1100881184 12:99018252-99018274 TCCCTTGGGCCTCTTTTAGAAGG - Intronic
1100984654 12:100192419-100192441 CCACTCTGGCCTCTTCTATAAGG - Intergenic
1101423428 12:104567834-104567856 TCCCTCAGGCCTCTTTTATAAGG - Intronic
1101646004 12:106631553-106631575 TCTCTGGGGCCTCTTTTATAAGG - Intronic
1101674549 12:106906070-106906092 TCCCTCGAGCCACTTTTATAAGG + Intergenic
1102163897 12:110790916-110790938 CTCCTTTTGCATCTTTTATAAGG + Intergenic
1102487941 12:113270777-113270799 CCTCTGGGACCTCTTTTATAGGG + Intronic
1103076399 12:117986282-117986304 TCTCTGGGGCCTCTTTTATAAGG - Intergenic
1103441057 12:120963480-120963502 TCCCTTGGGCCTCTTTGATAAGG + Intergenic
1103466048 12:121142712-121142734 CTCCTTCTGCCTCTCTTATAAGG + Intronic
1104085742 12:125472683-125472705 TCCCTTAGGCCTCTTTTATAAGG - Intronic
1104236370 12:126941786-126941808 TCCCTGGGGCCTCTTTTATAGGG + Intergenic
1104562678 12:129856734-129856756 CTCCCCCGGACTCTGTTATAAGG - Intronic
1104562944 12:129857568-129857590 CTCCCCCGGACTCTGTTATAAGG - Intronic
1104563129 12:129858157-129858179 CTCCCCCGGACTCTGTTATAAGG - Intronic
1104596359 12:130122747-130122769 TCCCTTGGGCCTCTTTTCTAAGG + Intergenic
1106497508 13:30294068-30294090 CTCCTCGGGCCTCCTTTTCCCGG + Intronic
1106551129 13:30772009-30772031 TCCCTTGGGCCTATTTTATAAGG - Intergenic
1106592343 13:31108867-31108889 CCTCTTGGGCCCCTTTTATAAGG + Intergenic
1106678952 13:31990154-31990176 TCTCTGGGGCCTCTTTTATAAGG - Intergenic
1107043154 13:35969881-35969903 CTTCTGGGGCCTCTTTTATAAGG - Intronic
1107065393 13:36209550-36209572 TTTCTTGGGCCTCTTTTATAAGG + Intronic
1107299579 13:38950813-38950835 TTTCTGGGGTCTCTTTTATAAGG - Intergenic
1107348423 13:39488118-39488140 TCCCTGGAGCCTCTTTTATAAGG - Intronic
1107601924 13:42022565-42022587 TCCCTCGGGCCTCTTTTATAAGG - Intergenic
1107999509 13:45893503-45893525 TTCCTCAAGCCTCTTTTATAAGG + Intergenic
1108134948 13:47346090-47346112 CCTCTGGGGTCTCTTTTATAAGG - Intergenic
1108276180 13:48812026-48812048 CTCCTAGGGTCTCTTTTATAAGG + Intergenic
1108601677 13:52000350-52000372 TCCCTCAAGCCTCTTTTATAAGG + Intronic
1108606069 13:52039963-52039985 TTCCTTGGGCTTCTTTTATAAGG - Intronic
1108780116 13:53820115-53820137 CTCTTGGGGCTTCTTTTTTAAGG - Intergenic
1109042212 13:57354023-57354045 TTCCCAAGGCCTCTTTTATATGG - Intergenic
1109052386 13:57500290-57500312 CTCTTGGGACCTATTTTATAAGG + Intergenic
1109147820 13:58803534-58803556 TTTCTGGGGTCTCTTTTATAAGG + Intergenic
1109200153 13:59421254-59421276 TCTCTGGGGCCTCTTTTATAAGG + Intergenic
1109232995 13:59781879-59781901 TTCCTTGAACCTCTTTTATAAGG - Intronic
1109310458 13:60686755-60686777 CTCCTGGGACCTCTTTTCTAAGG - Intergenic
1109436726 13:62313220-62313242 TTCCTCAGGCCTCTTTTGTAAGG - Intergenic
1110241261 13:73269864-73269886 TCTCTGGGGCCTCTTTTATAAGG - Intergenic
1110413910 13:75231800-75231822 TCCCTCAGGCCTCTTTTATAAGG - Intergenic
1110417064 13:75264699-75264721 CCCCTCAGGCCTCTCTGATAAGG + Intergenic
1110522886 13:76501633-76501655 CTCCTGGGGACTCTTTAATAAGG - Intergenic
1110559528 13:76896059-76896081 TCCCTCAGGCCTCTTTTATCAGG + Intergenic
1110685066 13:78362814-78362836 TTTCTTAGGCCTCTTTTATATGG + Intergenic
1110753021 13:79137575-79137597 CCCCTTGGGGATCTTTTATAGGG - Intergenic
1110942856 13:81372085-81372107 TTCCTCTGGCATCTTTTGTAAGG + Intergenic
1111080655 13:83302386-83302408 TTCCTCACACCTCTTTTATATGG - Intergenic
1111260559 13:85734345-85734367 TTCTCTGGGCCTCTTTTATAAGG - Intergenic
1111312330 13:86504729-86504751 TTCCTCAGGCCTCTTTTGTAAGG - Intergenic
1111500822 13:89118179-89118201 TTCCTTAGACCTCTTTTATAAGG - Intergenic
1111851400 13:93580224-93580246 CTCTTGGGGTCTCTTTTATGAGG + Intronic
1111954587 13:94742606-94742628 TCCATCAGGCCTCTTTTATAAGG + Intergenic
1112122138 13:96424674-96424696 TTTCTCCAGCCTCTTTTATAAGG + Intronic
1112262868 13:97893703-97893725 CTCCTTCAGCCTATTTTATAAGG + Intergenic
1112414590 13:99193715-99193737 GCCCTCAGGCCTCTTTTATAAGG + Intergenic
1113086006 13:106570175-106570197 TTCCTTGGGCCCCTTTTATAAGG - Intergenic
1113211990 13:107994189-107994211 TCCCTTGGGCCTCTTTTATAAGG + Intergenic
1113223973 13:108139039-108139061 CTCCCTAGGCCTCTTTTATCAGG + Intergenic
1113873451 13:113579260-113579282 CTTCTTGAGCCTCTTTTATCAGG + Intergenic
1114148975 14:20013025-20013047 CTCCTGGGGCATCATTTATTAGG - Intergenic
1114168457 14:20246402-20246424 CTCCTTTCGCCTATTTTATAAGG - Intergenic
1114731295 14:24995218-24995240 TCTCTGGGGCCTCTTTTATAAGG + Intronic
1114838351 14:26231993-26232015 CCCCTAGTGTCTCTTTTATAAGG - Intergenic
1114838571 14:26234260-26234282 CCCTTTGGGCCTCTTTTATAAGG + Intergenic
1114888273 14:26882574-26882596 CTCCTCAGGCTTCTTTTATAAGG - Intergenic
1115208537 14:30941011-30941033 TCCTTTGGGCCTCTTTTATAAGG - Intronic
1115229144 14:31139356-31139378 TCTCTCAGGCCTCTTTTATAAGG - Intronic
1115319220 14:32061014-32061036 TCTCTTGGGCCTCTTTTATAAGG - Intergenic
1115808572 14:37079941-37079963 TCCCTGGGGCCTCTTCTATAAGG - Intronic
1115913535 14:38283607-38283629 CTCTCTGGGCCTCTTTTATAAGG - Intergenic
1116010953 14:39351619-39351641 TCCCTTGAGCCTCTTTTATAAGG - Intronic
1116127723 14:40809436-40809458 TCCCTAGAGCCTCTTTTATAAGG - Intergenic
1116549058 14:46210950-46210972 TTCCTTGGGCCTGTTTTATAAGG + Intergenic
1116637454 14:47415852-47415874 TCTCTGGGGCCTCTTTTATAAGG + Intronic
1116948520 14:50857835-50857857 TTTCTCCTGCCTCTTTTATAAGG + Intergenic
1116990327 14:51269236-51269258 CTCCTCGAGCCCCTTTATTAAGG - Intergenic
1117160641 14:52986205-52986227 TCCCTTGGGCCTCTTTTCTAAGG + Intergenic
1117186582 14:53246162-53246184 CCTCTCAGGCCTCTTTTATAAGG - Intergenic
1117218347 14:53575574-53575596 TCCCTGGGGCCTCTTTTACAAGG + Intergenic
1117816720 14:59606462-59606484 TCCCTTGGGCCTCTTTTCTAAGG - Intronic
1117846313 14:59915098-59915120 TTCTTTGGGCCTCTTTTATGAGG - Intergenic
1118029319 14:61804930-61804952 TCTCTGGGGCCTCTTTTATAAGG - Intergenic
1118049938 14:62015663-62015685 CTTCTGGGGCCTCTTTTATAAGG - Intronic
1118068283 14:62216396-62216418 TCTCTCAGGCCTCTTTTATAAGG - Intergenic
1118089879 14:62462124-62462146 TCCCTGGAGCCTCTTTTATATGG - Intergenic
1118226656 14:63906949-63906971 TCTCTTGGGCCTCTTTTATAAGG + Intronic
1118367922 14:65111255-65111277 CTCCTTGTGCCTCTTTTATAAGG - Intergenic
1118467448 14:66043761-66043783 TCCCTTGGGCCTCTTTTATAGGG - Intergenic
1119876158 14:78061096-78061118 TCCCTCAGGCCTATTTTATAGGG - Intergenic
1120224309 14:81773554-81773576 CTACTCAGGCCTCTTGTATAGGG + Intergenic
1120395629 14:83963573-83963595 TCCCTCAGGCCTCTTTTATATGG + Intergenic
1120579452 14:86227962-86227984 TCTCTTGGGCCTCTTTTATAAGG - Intergenic
1120713670 14:87818134-87818156 TCACTAGGGCCTCTTTTATAAGG - Intergenic
1120767018 14:88337584-88337606 CTCCTCTTGCCTCTCTTATAAGG - Intergenic
1120916471 14:89714985-89715007 TTCCTGGGGCCTCTTTGATAAGG + Intergenic
1121369622 14:93345100-93345122 TCTCTAGGGCCTCTTTTATAAGG - Intronic
1121383061 14:93491134-93491156 TCTCTGGGGCCTCTTTTATAAGG + Intronic
1121484447 14:94303948-94303970 TCTCTGGGGCCTCTTTTATAAGG - Intergenic
1121577701 14:95001787-95001809 CTTCTGGGGTCCCTTTTATAAGG + Intergenic
1121579551 14:95017529-95017551 TCCCTCCTGCCTCTTTTATAAGG + Intergenic
1121694218 14:95899719-95899741 CTTCTGGGGTCCCTTTTATAAGG + Intergenic
1121851968 14:97229484-97229506 TCCCTCAGGACTCTTTTATAAGG + Intergenic
1122110217 14:99494902-99494924 CCCCTTGGGCCTCTTTTATAAGG + Intronic
1122965239 14:105120700-105120722 TTCCTAGGGCCTCTTTTAAAAGG - Intergenic
1123416173 15:20097168-20097190 TCCCTCAGGCTTCTTTTATAAGG - Intergenic
1123525513 15:21104273-21104295 TCCCTCAGGCTTCTTTTATAAGG - Intergenic
1123726296 15:23105731-23105753 TCACTCAGGCCTCTTTTATAAGG + Intergenic
1124200451 15:27674589-27674611 CTCCTGCGACCTCTTTTATAAGG - Intergenic
1124783234 15:32655706-32655728 TTCCTCTGGCCTCTTTCATAAGG - Intronic
1125024183 15:35013856-35013878 TCTCTTGGGCCTCTTTTATAAGG - Intergenic
1125106610 15:35979142-35979164 TTCTTAGGGCCCCTTTTATAAGG + Intergenic
1125146924 15:36481798-36481820 AGTCTGGGGCCTCTTTTATAAGG + Intergenic
1125370047 15:38965630-38965652 CCTCTCAGGCCTCTTTTGTAAGG + Intergenic
1125372111 15:38989112-38989134 TTCCTTAGGCCTCTTTTATAGGG - Intergenic
1125935857 15:43635059-43635081 CTCCTCTTTCATCTTTTATAAGG + Intronic
1126991197 15:54377738-54377760 TCCCTCAGGCCTCTTTTGTAAGG + Intronic
1127046971 15:55036197-55036219 TTCCTCAGGCCTCTTTTATGAGG - Intergenic
1127972450 15:63972036-63972058 CCTCTGGGGTCTCTTTTATAAGG - Intronic
1129056307 15:72822902-72822924 AGCCTGGGGCATCTTTTATATGG + Intergenic
1129120414 15:73393123-73393145 TCCCTAGGGCCTCTTCTATAAGG + Intergenic
1129524197 15:76203811-76203833 CTCCTCGGACCTCTTCTCTCTGG + Exonic
1129751679 15:78069677-78069699 CCACTCTGGCCTCTTTCATAAGG - Intronic
1130121233 15:81049309-81049331 TCCCTTGGGCCTCTTTTATAAGG - Intronic
1130177756 15:81592848-81592870 TCTCTGGGGCCTCTTTTATATGG - Intergenic
1130331591 15:82926332-82926354 TCTCTCAGGCCTCTTTTATAAGG + Intronic
1131382047 15:91972392-91972414 TCTCTGGGGCCTCTTTTATAAGG - Intronic
1131743289 15:95417606-95417628 CTCCACAGGCCTCTATTAAAAGG + Intergenic
1131788143 15:95935002-95935024 TCCCTCAGGCCTCTTTTCTAAGG - Intergenic
1133173162 16:3994156-3994178 CCTCTGGGGCCTCTTTTATGAGG - Intronic
1134186417 16:12088455-12088477 CTCCCCAGCCCTCATTTATATGG + Intronic
1134606935 16:15578741-15578763 TCCCTTGGGTCTCTTTTATAAGG + Intronic
1135018470 16:18943929-18943951 TTCTTGGTGCCTCTTTTATAAGG - Intergenic
1135097629 16:19577753-19577775 GCCCTTGGACCTCTTTTATAGGG - Intronic
1135596233 16:23745419-23745441 TCCCTCGGGTCTTTTTTATAAGG - Intergenic
1136183494 16:28571150-28571172 TCCCTCAGGCCTCTTTCATAAGG - Intronic
1136930034 16:34410378-34410400 TCCCTTGGGCCTCTTTTATAAGG + Intergenic
1136974540 16:35001427-35001449 TCCCTTGGGCCTCTTTTATAAGG - Intergenic
1137390045 16:48073823-48073845 CCCCTTTGGCCTCTTTTATAAGG + Intergenic
1138693220 16:58788208-58788230 TCCCTCGAGCCTCTTTTACAAGG + Intergenic
1138753102 16:59447891-59447913 TTTCTAGGGCCTCCTTTATAGGG + Intergenic
1139336386 16:66234683-66234705 GGCCTGGGGCTTCTTTTATATGG - Intergenic
1139362900 16:66413510-66413532 CTTCTGGGGCCTCTTTTGTCAGG - Intergenic
1140334828 16:74095490-74095512 TCTCTGGGGCCTCTTTTATAAGG + Intergenic
1140694035 16:77514110-77514132 CCTCTGGAGCCTCTTTTATAAGG + Intergenic
1140721397 16:77775537-77775559 GCCTTCAGGCCTCTTTTATAAGG - Intergenic
1140835981 16:78794146-78794168 CTTCTGGGGTCACTTTTATAAGG - Intronic
1141000947 16:80307424-80307446 CCCCTTGGGCCTTTTTAATAAGG + Intergenic
1141417097 16:83884101-83884123 TCTTTCGGGCCTCTTTTATAAGG - Intergenic
1141777461 16:86133880-86133902 TTTCTCAGGCCTCTTTTACAAGG - Intergenic
1141778291 16:86139004-86139026 TCTCTGGGGCCTCTTTTATAAGG + Intergenic
1141906599 16:87030815-87030837 TCCCTCAGGCCGCTTTTATAAGG + Intergenic
1143454334 17:7056382-7056404 TGCCTCAGGCCTCTTTCATAAGG - Intergenic
1144009843 17:11136532-11136554 TCCCTCAGGCCTCTTTTATAAGG + Intergenic
1144220202 17:13092809-13092831 CTCCATGGGCCTCTTTCATAAGG - Intergenic
1144341223 17:14311859-14311881 CTCCTCGAGCCTGTTTTAAGTGG - Intronic
1144457005 17:15426976-15426998 CTCCTGGGGCATATTTTATAAGG - Intergenic
1144720766 17:17468383-17468405 TCCCTTGGGCCTCTTTGATAAGG + Intergenic
1145060515 17:19730299-19730321 CCCCTCAGGCCTTTTTTGTAAGG - Intergenic
1145837533 17:27965890-27965912 TCTCTCAGGCCTCTTTTATAAGG + Intergenic
1146026591 17:29326836-29326858 TCCCTCAGGCCTCCTTTATAAGG - Intergenic
1146366758 17:32234891-32234913 TCCCTTGGGCCTATTTTATAAGG + Intronic
1146618013 17:34372047-34372069 CTCCTAGGCCCTCTTGTACATGG + Intergenic
1146840152 17:36146410-36146432 TCCCTTGGGCCTATTTTATAAGG + Intergenic
1146993451 17:37296601-37296623 CGCCTGGAGCCTATTTTATAAGG + Intronic
1147117361 17:38311385-38311407 ATCCCCGGGTCTCCTTTATAAGG - Intronic
1147883324 17:43668189-43668211 CACCTCCGGCCTTTTTTATGGGG - Intergenic
1148197330 17:45723548-45723570 TCCCTTGGGCCTCTTTTATAAGG + Intergenic
1148412322 17:47478201-47478223 ATCCCCAGGTCTCTTTTATAAGG + Intergenic
1148534177 17:48424524-48424546 CCTCTGGGACCTCTTTTATAAGG + Intronic
1148971886 17:51490911-51490933 CATCTGGGCCCTCTTTTATAAGG - Intergenic
1149060276 17:52413448-52413470 TCTCTGGGGCCTCTTTTATAAGG + Intergenic
1149200613 17:54181885-54181907 TTTCTGCGGCCTCTTTTATAAGG - Intergenic
1149619651 17:58033846-58033868 TCCCTCAGGCCTCTTTTAGAAGG - Intergenic
1149632432 17:58137577-58137599 TCTCTGGGGCCTCTTTTATAAGG + Intergenic
1150151412 17:62811830-62811852 TCCCTCAAGCCTCTTTTATAAGG + Intergenic
1150476620 17:65480500-65480522 CCGCTTGGGCCTCTTTCATAAGG - Intergenic
1150609061 17:66718621-66718643 CTTCCAAGGCCTCTTTTATAAGG + Intronic
1151184763 17:72355669-72355691 TTCCTGAGGCTTCTTTTATAAGG + Intergenic
1152100204 17:78296980-78297002 TCCCTCAAGCCTCTTTTATAAGG - Intergenic
1153273025 18:3341964-3341986 TCCCTGAGGCCTCTTTTATAAGG + Intergenic
1153646368 18:7199603-7199625 TCCCTTGGGCCTCTTTTATAAGG + Intergenic
1153782078 18:8503873-8503895 GTTCTGGGGCCTCTTTTATAAGG - Intergenic
1154000533 18:10478586-10478608 ACTCTCAGGCCTCTTTTATAAGG + Intronic
1154063712 18:11087082-11087104 CCCCTGGAGTCTCTTTTATAAGG - Intronic
1154093531 18:11387880-11387902 CTCTTGGGGCCTCTTTGTTAAGG - Intergenic
1155217178 18:23653629-23653651 CTCCCCTCCCCTCTTTTATATGG + Intronic
1155229727 18:23760906-23760928 CTTTCTGGGCCTCTTTTATAAGG + Intronic
1155666693 18:28317712-28317734 TCCCTTGGGCCACTTTTATAAGG - Intergenic
1156071982 18:33222555-33222577 TTCTTGGGGCCTCTCTTATAGGG + Intronic
1156155016 18:34291357-34291379 TCCCTAGGGCCTCATTTATAAGG + Intergenic
1156195514 18:34770017-34770039 GGCCTGGGGCCTCTTTTATAAGG + Intronic
1156226344 18:35112982-35113004 CCCCTTAGGCCTGTTTTATAAGG + Intronic
1156418947 18:36929685-36929707 TTCCTGGAGCCTCTTTTATAAGG - Intronic
1156524773 18:37756514-37756536 TTTCTTGGGCCTCTTTTATAAGG - Intergenic
1157035106 18:43962233-43962255 CCTCTGGGGTCTCTTTTATAAGG - Intergenic
1157090046 18:44626314-44626336 TCTCTCAGGCCTCTTTTATAAGG - Intergenic
1157437341 18:47682059-47682081 TTCCTGGGGCCTCTTTTATAGGG + Intergenic
1157873350 18:51249974-51249996 CCCCTTGGGTCTCTTTTATAAGG + Intergenic
1157911396 18:51620343-51620365 TTGCTCAAGCCTCTTTTATAAGG - Intergenic
1158218520 18:55126134-55126156 TTTCTAGGGCCTCTTTTATAAGG + Intergenic
1158299529 18:56035713-56035735 CTCCTGGAATCTCTTTTATAAGG + Intergenic
1158313050 18:56179379-56179401 CTGTCTGGGCCTCTTTTATAAGG - Intergenic
1158630192 18:59106814-59106836 CTCTGGGGGTCTCTTTTATAAGG + Intergenic
1158804098 18:60948236-60948258 TTCCTTGGGCCTCTTATGTAAGG + Intergenic
1158939851 18:62397393-62397415 CTCTCTGGGCCTCTTTTATGAGG + Intergenic
1159003948 18:62996465-62996487 TCCCTTGGGCCTCTTTTATAAGG - Intergenic
1159147129 18:64468692-64468714 TCCCTCAGGCTTCTTTTATAAGG - Intergenic
1159190837 18:65039979-65040001 TTTCTTGGGCCTCTTTTATAAGG + Intergenic
1159473625 18:68889253-68889275 CACCTTGGGCCTCTTTCATAAGG - Intronic
1159806326 18:72962272-72962294 TCCCTTGGGACTCTTTTATAAGG - Intergenic
1159904305 18:74076386-74076408 CTCTGTGGGCCTCTTTTATAAGG - Intronic
1160144949 18:76356171-76356193 CCTCTCGGGCCTCTTTGATGAGG - Intergenic
1160183347 18:76655156-76655178 CTCTTGGGGCCTCTTTTATAAGG + Intergenic
1160382480 18:78471176-78471198 CTCCCCAGGCCTCTTTTCTAAGG - Intergenic
1160449024 18:78949364-78949386 CCTCTGGGGCCTCTTTTCTAAGG - Intergenic
1163296983 19:16418754-16418776 CTTCTGGGGCCTCTTTTATAAGG - Intronic
1163627988 19:18401906-18401928 CTCTTGGGGCCTCTTTTATAAGG + Intergenic
1164603314 19:29578132-29578154 CCTCTGGGGTCTCTTTTATAAGG - Intergenic
1164610361 19:29627625-29627647 CCGGTCTGGCCTCTTTTATAGGG + Intergenic
1165253987 19:34561974-34561996 TGTCTGGGGCCTCTTTTATAAGG + Intergenic
1165267429 19:34672839-34672861 AAGCTTGGGCCTCTTTTATAAGG + Intronic
1165387499 19:35519437-35519459 CTCACCGGGCATCTTTTACAGGG - Intergenic
1165728352 19:38128209-38128231 CACGTCAGGCCTCTTTTATATGG + Intronic
1166582904 19:43918463-43918485 TCTCTCAGGCCTCTTTTATAAGG - Intronic
1167548777 19:50145144-50145166 CTCCTCTGCCCCCTCTTATAAGG - Intergenic
1168249020 19:55130523-55130545 TCCCTCAAGCCTCTTTTATAAGG + Intergenic
1168474764 19:56667793-56667815 CTTCTGGGTCCTCTTTTATAAGG - Intronic
1168689754 19:58369240-58369262 CTCCTCGGGCCTCTTCTCCCGGG + Exonic
924979702 2:208207-208229 TCTCTGGGGCCTCTTTTATAAGG - Intergenic
925400738 2:3570460-3570482 CTCCAGGGGCCTCCTTCATAAGG - Intergenic
925423966 2:3733684-3733706 TCCCTGAGGCCTCTTTTATAAGG + Intronic
925533385 2:4889417-4889439 TCCTTGGGGCCTCTTTTATAAGG + Intergenic
925584506 2:5450775-5450797 CCTTTGGGGCCTCTTTTATATGG + Intergenic
925847030 2:8043685-8043707 TCCCTTGGGCCTATTTTATAAGG - Intergenic
926041894 2:9680117-9680139 TCTCTGGGGCCTCTTTTATAAGG + Intergenic
926396440 2:12447352-12447374 CTCCTCTGAGCTCTTTTGTAAGG - Intergenic
926582854 2:14649895-14649917 TTCCTTGGACCTATTTTATAAGG - Intronic
926933888 2:18067616-18067638 TCTCTGGGGCCTCTTTTATAAGG - Intronic
927084690 2:19662801-19662823 TCTCTGGGGCCTCTTTTATAAGG + Intergenic
927203879 2:20594867-20594889 TTCCTCAGGTCTCTTTTATAAGG + Intronic
927204148 2:20596436-20596458 TCCCTGGAGCCTCTTTTATAAGG - Intronic
927359781 2:22219472-22219494 CTCCTTGGGACTCTTTTATAAGG - Intergenic
927384378 2:22516107-22516129 CTCTCTGGGCCTATTTTATAAGG - Intergenic
927409456 2:22807601-22807623 TTCCTGGGGCCTCTTTTATAAGG + Intergenic
927417282 2:22892406-22892428 GGCCTCAGGCCTCTTTCATAGGG + Intergenic
928044704 2:27917546-27917568 TCCCTCAGGCCTCTTTTATAAGG + Intronic
928136891 2:28694570-28694592 TCCCTTGGGCCTCTTTCATAAGG + Intergenic
929018922 2:37530931-37530953 CTCCTCAATCCTCTTTTATAAGG - Intergenic
929058670 2:37901117-37901139 CTCTCCAGGTCTCTTTTATAAGG + Intergenic
929129031 2:38547936-38547958 TCCCTGGGACCTCTTTTATAGGG - Intergenic
929633194 2:43487697-43487719 TCACTGGGGCCTCTTTTATAAGG - Intronic
929698374 2:44140010-44140032 TTTCTCAAGCCTCTTTTATAAGG + Intergenic
929831127 2:45347378-45347400 TCCCTCAAGCCTCTTTTATAAGG + Intergenic
930100442 2:47599077-47599099 TCTCTGGGGCCTCTTTTATAAGG - Intergenic
930163228 2:48178930-48178952 TCCCTCAGGCCTCTTTTGTAAGG + Intergenic
930337131 2:50062297-50062319 TTTCTGGAGCCTCTTTTATAAGG - Intronic
930547115 2:52782369-52782391 TTCCTCAGGTCTCTTTTCTAAGG - Intergenic
930620645 2:53639811-53639833 TTTCTCAGGCCTCTTTTGTAAGG - Intronic
930683677 2:54285136-54285158 CCCTTGGGCCCTCTTTTATAAGG + Intronic
931260622 2:60615280-60615302 TCCCTGGGGCCTCTTTTATAAGG + Intergenic
931685503 2:64788910-64788932 TCTCTCTGGCCTCTTTTATAAGG + Intergenic
931987205 2:67753732-67753754 GCCCTAGTGCCTCTTTTATAAGG - Intergenic
932001146 2:67886253-67886275 CCTCTCAGGCCTCTTTTATAAGG + Intergenic
932078177 2:68686171-68686193 CTCCTCAAGCCTCTTTTATAAGG + Intronic
932837671 2:75052223-75052245 TTTCTCAGGCCTATTTTATAAGG - Intronic
932924590 2:75958146-75958168 TGCCTGAGGCCTCTTTTATAAGG - Intergenic
933238370 2:79890917-79890939 CCCCTCAAGCCTCTTTTATAAGG + Intronic
933270546 2:80228370-80228392 TCCCTCAGGCCTCTTTTACATGG + Intronic
933285998 2:80385327-80385349 CCTCTGGGGTCTCTTTTATAAGG - Intronic
933807449 2:86010679-86010701 CTGCACAGTCCTCTTTTATAAGG - Intergenic
933869737 2:86554062-86554084 TACCTTGGGCCTATTTTATAAGG - Intronic
933993763 2:87652494-87652516 TCTCTGGGGCCTCTTTTATAAGG + Intergenic
934694298 2:96387906-96387928 TCCCTCAGGCCTCTTTTATAAGG - Intergenic
934992920 2:98933998-98934020 CTCCTTGCGCTTCTTTTATAAGG + Intronic
935194311 2:100802999-100803021 TCTCTCAGGCCTCTTTTATAAGG + Intergenic
935623204 2:105146426-105146448 TCCCTTGGGCCTCTTTTATAAGG + Intergenic
935809663 2:106785228-106785250 TTTCTTAGGCCTCTTTTATAAGG + Intergenic
935978885 2:108607114-108607136 TCCCTTGGGCCTATTTTATAAGG - Intronic
936300100 2:111298389-111298411 TCTCTGGGGCCTCTTTTATAAGG - Intergenic
936406810 2:112212196-112212218 TCCCCAGGGCCTCTTTTATAAGG + Exonic
936561885 2:113546443-113546465 TCTCTGGGGCCTCTTTTATAAGG + Intergenic
936656688 2:114496543-114496565 TCTCTCGGGCCTCTTTTATGAGG + Intronic
936687806 2:114848989-114849011 TATCTGGGGCCTCTTTTATAAGG + Intronic
936707126 2:115088117-115088139 TTTCTCCAGCCTCTTTTATAAGG + Intronic
937029718 2:118728357-118728379 TCCATCGGGCCTATTTTATAAGG - Intergenic
937358607 2:121213577-121213599 TCCCTAGGGCCTCTTTTACAAGG - Intergenic
937714126 2:125012211-125012233 CTTCTGTGGCCTCTTTTATAAGG - Intergenic
937847885 2:126601528-126601550 TCTCTGGGGCCTCTTTTATAAGG + Intergenic
938234767 2:129696786-129696808 TCCCTCATGCCTCTTTTATAAGG - Intergenic
938241313 2:129744447-129744469 TTTCTGGGGCCTCTTTTAAAAGG + Intergenic
938775532 2:134538223-134538245 GCTCTCGGGCCTCTTTTATGAGG - Intronic
938928675 2:136066991-136067013 TCTCTCAGGCCTCTTTTATAAGG - Intergenic
938945049 2:136204806-136204828 TTCCTCAGGCCTCTTTTATAAGG + Intergenic
939079791 2:137646258-137646280 TCCTTCAGGCCTCTTTTATAAGG - Intronic
939871744 2:147533684-147533706 TCCCTGGGACCTCTTTTATAAGG + Intergenic
940131691 2:150389053-150389075 TCCCTCAGGCCTCTTTTATAAGG - Intergenic
940170494 2:150824938-150824960 TCCCTCTGGCCTCTTTTATAAGG + Intergenic
940413434 2:153392893-153392915 TCCCTTGGACCTCTTTTATAAGG - Intergenic
940644558 2:156377094-156377116 TCCCAAGGGCCTCTTTTATAAGG - Intergenic
941135066 2:161705663-161705685 TCTCTGGGGCCTCTTTTATAAGG - Intronic
941462619 2:165789309-165789331 TTTCTCAGTCCTCTTTTATAAGG + Intronic
941529595 2:166650390-166650412 TCCCTTGAGCCTCTTTTATAAGG - Intergenic
941722930 2:168831260-168831282 CTCTTGGGGTCTCTTTTATAAGG + Intronic
941723507 2:168837071-168837093 TCCCTGGGGCCTCTTCTATAAGG + Intronic
942471599 2:176266660-176266682 TCCCTTGGGCCTCTTTTATAAGG - Intergenic
942513079 2:176723248-176723270 TCCCTCAAGCCTCTTTTATAAGG - Intergenic
942614073 2:177771510-177771532 CTCTTTGGGTCTCATTTATAAGG + Intronic
942718235 2:178919048-178919070 CCTCTCAGGCCTCTTTCATAAGG - Intronic
942882609 2:180880227-180880249 TCCCTGGGGCCTCATTTATAAGG + Intergenic
943083534 2:183284547-183284569 TCTCTGGGGCCTCTTTTATAAGG - Intergenic
943101948 2:183497628-183497650 TCTCTGGGGCCTCTTTTATAAGG - Intergenic
943115944 2:183670487-183670509 CCTCTGGGGCTTCTTTTATAAGG - Intergenic
943195620 2:184744452-184744474 TCTCTAGGGCCTCTTTTATAAGG - Intronic
943580948 2:189683038-189683060 TCTCTGGGGCCTCTTTTATAAGG - Intronic
943667565 2:190626127-190626149 CTCTCTGGGTCTCTTTTATAAGG + Intergenic
944214755 2:197243745-197243767 TCCCTTGGGCCTCTTTCATAAGG + Intronic
944217576 2:197271299-197271321 TCCCTCAGGCCTGTTTTATAAGG - Intronic
944636485 2:201680426-201680448 TCCCTCAGGCCTCTTTTATAAGG + Intronic
944637928 2:201692627-201692649 CTCTTGGGGTCTCTTGTATAAGG - Intronic
944667707 2:201970915-201970937 GCCCTCAGGCCTCTTTTGTAAGG - Intergenic
944814273 2:203359723-203359745 TCCCTTGGACCTCTTTTATAAGG + Intronic
944900924 2:204215265-204215287 CCTCTCAGGACTCTTTTATAAGG + Intergenic
945007805 2:205428081-205428103 CCTCTGGGGCCACTTTTATATGG - Intronic
946331530 2:219011984-219012006 TTCCACAGGCCTCTTTTATAAGG - Intronic
946735671 2:222752088-222752110 CCACTGAGGCCTCTTTTATAAGG - Intergenic
947364106 2:229376281-229376303 TCTCTTGGGCCTCTTTTATAAGG - Intronic
947407641 2:229796883-229796905 CTCCCCTGCCCTCTTTTTTAAGG - Intronic
947845140 2:233237735-233237757 TCTCTGGGGCCTCTTTTATAAGG + Intronic
948398244 2:237663400-237663422 CTCCCCGGGTTTGTTTTATAAGG - Intronic
948512463 2:238477914-238477936 TATCTGGGGCCTCTTTTATAAGG - Intergenic
1168788411 20:559293-559315 TCTCTGGGGCCTCTTTTATAAGG - Intergenic
1168820077 20:766841-766863 ATCCTTGGCCCTCTTCTATATGG - Intronic
1169594567 20:7183246-7183268 TCTCTGGGGCCTCTTTTATAAGG - Intergenic
1169701956 20:8456841-8456863 TCCCTGGGACCTCTTTTATAAGG + Intronic
1169752336 20:9007085-9007107 TCCCATGGGCCTCTTTTATAAGG - Intergenic
1170022369 20:11850506-11850528 TCTCTTGGGCCTCTTTTATAAGG - Intergenic
1170075089 20:12410447-12410469 TCCCTGGGGCCTCTCTTATAAGG - Intergenic
1170460075 20:16569041-16569063 TCCCTTGGGCCTGTTTTATAAGG - Intronic
1170542260 20:17401406-17401428 TCCCTCAGGCCTCTTTTATAAGG + Intronic
1170562034 20:17566948-17566970 GGCCTAGGACCTCTTTTATAAGG + Intronic
1170796942 20:19556079-19556101 TCTCTGGGGCCTCTTTTATAAGG + Intronic
1170828375 20:19817381-19817403 TCACTCAGGCCTCTTTTATAAGG + Intergenic
1172580684 20:36044967-36044989 CTCCTTGTTCCTCTTGTATATGG - Intergenic
1173179461 20:40793313-40793335 TACCTTGGGCCTCTTTTATAAGG - Intergenic
1173414374 20:42842856-42842878 TCCCTCAAGCCTCTTTTATAAGG + Intronic
1173419450 20:42887924-42887946 TGCCTAGGGCATCTTTTATAAGG - Intronic
1173957570 20:47046183-47046205 TTTCTGGGGCTTCTTTTATAAGG + Intronic
1174184101 20:48693416-48693438 TCTCTGGGGCCTCTTTTATAAGG - Intronic
1174602262 20:51734281-51734303 CCCCTCCTGCCTCTTTTATAAGG + Intronic
1174944095 20:54965798-54965820 TTTCTCAGGCCTCTTTTATAAGG + Intergenic
1177007136 21:15687329-15687351 TTTCTCGAGCCTCTTTTGTATGG - Intergenic
1177052788 21:16258862-16258884 CTGATAGGGCCTGTTTTATAAGG + Intergenic
1177083555 21:16673693-16673715 TCCCTTGGGCCTCTTTTATAAGG + Intergenic
1177163087 21:17570555-17570577 TTCCTCTAGCCTCTTTCATAAGG + Intronic
1177197046 21:17914301-17914323 TCTCTAGGGCCTCTTTTATAAGG + Intronic
1177472379 21:21575745-21575767 TCTCTGGGGCCTCTTTTATAAGG + Intergenic
1177502634 21:21977944-21977966 TTCCTGGGGCCTCTTATATAAGG + Intergenic
1177636279 21:23790679-23790701 TTCCTTGGGCATCTTTTACAAGG - Intergenic
1178036276 21:28586841-28586863 TCCCTTGGGCCTCTTTTATAAGG + Intergenic
1178222854 21:30680809-30680831 CTTCTCTGTTCTCTTTTATAAGG + Intergenic
1178482064 21:32988088-32988110 CTCCTGGGGTCCCTTTTAAAAGG + Intergenic
1178821525 21:35979470-35979492 TTCCTCAGTTCTCTTTTATAAGG - Intronic
1178969760 21:37162928-37162950 TCTCTGGGGCCTCTTTTATAAGG + Intronic
1179149818 21:38800183-38800205 CTCCTCAGGCCTGATTCATAAGG - Intergenic
1179161154 21:38900486-38900508 CCTCTCAGGCCTCTTTTATAAGG - Intergenic
1179194056 21:39149145-39149167 CTCCTCAAGCCTGTTTGATAAGG + Intergenic
1179284865 21:39968590-39968612 CACTTTGGGCCTATTTTATAAGG + Intergenic
1179368053 21:40777192-40777214 TCCCTTGGGCTTCTTTTATAAGG + Intronic
1179954681 21:44731959-44731981 TCTCTGGGGCCTCTTTTATATGG + Intergenic
1181337353 22:22147816-22147838 CTCCTCAGTCCTCTTCAATATGG - Intergenic
1181432782 22:22893395-22893417 CTCGTCTGGCCTCATTTAAAGGG - Intronic
1181643292 22:24216101-24216123 CTTCTGGGGTCTCTTTTATAGGG - Intergenic
1181886328 22:26025000-26025022 CCTCTGGGGCCTCTTTTATAAGG + Intronic
1181936424 22:26442163-26442185 TCCCTTGGGCCTGTTTTATAAGG + Intronic
1182543513 22:31058839-31058861 TCCCTCAGGCTTCTTTTATAAGG + Intergenic
1182757214 22:32689874-32689896 CCTCTTGGGCCTCTTTTATAAGG - Intronic
1182853452 22:33496424-33496446 CTCTCTGTGCCTCTTTTATAAGG - Intronic
1184622587 22:45693502-45693524 CTCTCTGGGCCCCTTTTATAAGG + Intronic
1184971700 22:48026949-48026971 TCTCTTGGGCCTCTTTTATAAGG - Intergenic
1185005083 22:48271091-48271113 CTCTGGGGGCCTCTTTTATAAGG + Intergenic
1185294907 22:50048394-50048416 TTTCTGGGGCCTCTTTTATAAGG - Intronic
949237840 3:1832096-1832118 CCCCTTAGGCCTCTTTTATAAGG + Intergenic
949329430 3:2905446-2905468 TCTCTTGGGCCTCTTTTATAAGG + Intronic
949525215 3:4896631-4896653 CTCCCTTGGCCTCTTTCATAAGG + Intergenic
949591159 3:5495793-5495815 TCCCTTGGGCCTATTTTATAAGG - Intergenic
949787073 3:7753484-7753506 TCTCTGGGGCCTCTTTTATAAGG - Intergenic
950912707 3:16611529-16611551 TCCCTCAGTCCTCTTTTATAAGG - Intronic
951760344 3:26140659-26140681 TCTCTCAGGCCTCTTTTATAAGG - Intergenic
951811551 3:26706156-26706178 TCTCTGGGGCCTCTTTTATAAGG + Intronic
951884566 3:27511256-27511278 TTTCTCCAGCCTCTTTTATAAGG - Intergenic
952597623 3:35037609-35037631 TTCTTTGGACCTCTTTTATAAGG + Intergenic
952686802 3:36159421-36159443 TCCCTTGGGCCTTTTTTATAAGG + Intergenic
952725060 3:36574989-36575011 TCCCTCAAGCCTCTTTTATAAGG + Intergenic
953239568 3:41136664-41136686 TCCCTTGGGCCTATTTTATAAGG - Intergenic
953299510 3:41758080-41758102 TCACTCAGGCCTCTTTTATAAGG - Intronic
953367909 3:42362605-42362627 TCTCTGGGGCCTCTTTTATAAGG + Intergenic
953549586 3:43891076-43891098 TCCCTCAAGCCTCTTTTATAAGG - Intergenic
953955940 3:47232104-47232126 TCCCTCAGGCCCCTTTTATAGGG - Intronic
954100894 3:48371906-48371928 GTTCTGGGGTCTCTTTTATAAGG + Intergenic
954504765 3:51059220-51059242 GGCCTTGGGCCTATTTTATAAGG + Intronic
955042329 3:55329759-55329781 TTTTTCGGGCCTCTTTTACATGG - Intergenic
955133980 3:56198067-56198089 CTCCTCTGGCCTCTTTTTGTTGG - Intronic
955417122 3:58702909-58702931 TTTCTTGGGCCTCTTTTGTAAGG + Intergenic
955940803 3:64145854-64145876 TCCCTTGGACCTCTTTTATAAGG + Intronic
955941218 3:64148703-64148725 TCCCTTGGGCCTCTGTTATAAGG - Intronic
956040944 3:65144165-65144187 TCCCTCAAGCCTCTTTTATAAGG - Intergenic
956057473 3:65315543-65315565 TCCATCCGGCCTCTTTTATAAGG + Intergenic
956417983 3:69052950-69052972 TCCCTTGGGCCTCTCTTATAAGG - Intergenic
956571867 3:70705602-70705624 TCTCTTGGGCCTCTTTTATAAGG + Intergenic
957217811 3:77344466-77344488 TTTCTTGGGCCTCTTTTATAAGG - Intronic
957219280 3:77361646-77361668 TGCCCTGGGCCTCTTTTATAAGG + Intronic
957404677 3:79762270-79762292 TTACTCAGACCTCTTTTATAAGG + Intronic
957428368 3:80069650-80069672 CCCTTAGGGCCTATTTTATAAGG + Intergenic
957587401 3:82149779-82149801 TTGCTTGGGCCTATTTTATAGGG + Intergenic
959311939 3:104749486-104749508 CTCCCTGGGTCTCTTTTATAAGG - Intergenic
959547650 3:107615495-107615517 TCTCTGGGGCCTCTTTTATAAGG + Intronic
959633715 3:108537510-108537532 TCCCTCTAGCCTCTTTTATATGG - Intergenic
959653044 3:108770713-108770735 TTCCTCAAGCCTCTTTTATAAGG + Intergenic
959942970 3:112098808-112098830 CTTTCTGGGCCTCTTTTATAAGG + Intronic
960653167 3:119974421-119974443 CTTCTGGGGCATCTTTTATAAGG - Intronic
960695657 3:120393814-120393836 TCCCTTAGGCCTCTTTTATAAGG - Exonic
960777647 3:121277242-121277264 TCTCTAGGGCCTCTTTTATAAGG + Intronic
961184501 3:124902819-124902841 GGCCTGGGGTCTCTTTTATAAGG - Intergenic
961506975 3:127376529-127376551 TCCTTCAGGCCTCTTTTATAAGG + Intergenic
961843320 3:129737162-129737184 CCCCTCTAGCCTCTTTTATAAGG - Intronic
961927167 3:130493244-130493266 TCCCTCAGGCCTCTTTTATAAGG - Intergenic
962058404 3:131899201-131899223 CTCCAGGGGCCACTTTTGTAGGG + Intronic
962250932 3:133835756-133835778 TCCCTCGGGCCTCATTCATAAGG - Intronic
962607623 3:137045603-137045625 TCCCTTAGGCCTCTTTTATAAGG + Intergenic
962782972 3:138739143-138739165 CCTCTGGGGTCTCTTTTATAAGG - Intronic
962956498 3:140271590-140271612 TCCCTCAGGCCTCTTTCATAAGG + Intronic
963052452 3:141153632-141153654 TCCCTAGGGCCTCTTTTATAAGG + Intergenic
963230040 3:142900021-142900043 GGCCTGGGGCTTCTTTTATAAGG + Intergenic
963633501 3:147763885-147763907 TTCCTCAGGGTTCTTTTATAAGG + Intergenic
964011223 3:151894330-151894352 TCTCTGGGGCCTCTTTTATAAGG - Intergenic
964359336 3:155878072-155878094 CCCCTAGGGCCTCTTTTATAAGG + Intronic
964434405 3:156636584-156636606 TTCCTCCAACCTCTTTTATAAGG + Intergenic
964662585 3:159136668-159136690 TTTCTGGGGTCTCTTTTATAAGG + Intronic
964761812 3:160141641-160141663 TTTCTGGGGCCTCTTTAATAAGG + Intergenic
964838475 3:160967512-160967534 TATCTGGGGCCTCTTTTATAAGG + Intronic
965350386 3:167604765-167604787 TTCCTTGGACCTCCTTTATAAGG - Intronic
965431752 3:168597375-168597397 CTCCTAGGACCTCTTTTACTAGG - Intergenic
965523831 3:169696215-169696237 TCCCTCAAGCCTCTTTTATAAGG + Intergenic
965767154 3:172142959-172142981 CTTCTTGGGCCTCCTTTATAAGG + Intronic
965797569 3:172457277-172457299 TTTCTGGGACCTCTTTTATATGG + Intergenic
966131457 3:176645121-176645143 TTTCTCAGGCCTCTTTTATAAGG - Intergenic
966239735 3:177743148-177743170 TCCCTGGGGTCTCTTTTATAAGG + Intergenic
966312105 3:178605202-178605224 CTCTTCAGAGCTCTTTTATAAGG - Intronic
966716645 3:183019432-183019454 CTCTTCAGGCCTCTTTCATAAGG - Intronic
968818132 4:2832275-2832297 CTCCTCGGGCAGCTTTCACACGG - Intronic
969141502 4:5078132-5078154 CTTCTCTTGCCTCTTTTATAAGG + Intronic
969343152 4:6555144-6555166 CTGCCTCGGCCTCTTTTATAAGG + Intronic
969431594 4:7158107-7158129 CCCCTCAGGCTGCTTTTATAAGG - Intergenic
969547108 4:7837373-7837395 TCTCTGGGGCCTCTTTTATAAGG - Intronic
970069290 4:12138374-12138396 TCTCTAGGGCCTCTTTTATAAGG + Intergenic
970128235 4:12838470-12838492 CTTCTAGGGCCTCTTTTATAAGG + Intergenic
970340071 4:15096936-15096958 CTCTCTGGGTCTCTTTTATAAGG - Intergenic
970599547 4:17630390-17630412 CTCCCTGAGCCTCTTTTGTAAGG - Exonic
970931707 4:21519201-21519223 TCCCTGGGACCTCTTTTATAAGG - Intronic
970970455 4:21977289-21977311 CTCCCTAGGCTTCTTTTATAAGG + Intergenic
970971377 4:21988128-21988150 TTTCCCTGGCCTCTTTTATAAGG + Intergenic
971032864 4:22660015-22660037 TTCCTGGGGCCTCTTGTATAAGG + Intergenic
971118764 4:23680252-23680274 TTTCTGGGACCTCTTTTATAAGG - Intergenic
971246679 4:24935555-24935577 TTTCTGGGGTCTCTTTTATAAGG - Intronic
971390454 4:26180573-26180595 TCCCTGGGGCCTCTTTTATAAGG + Intronic
971459636 4:26881161-26881183 CCCGTCTGGCCTCTTTTATAAGG - Intronic
971770511 4:30889731-30889753 TCCCTTGTGCCTCTTTTATAAGG + Intronic
971822769 4:31580206-31580228 CCTCTGGGGCCTCTTTCATAAGG - Intergenic
972108955 4:35530868-35530890 TCCCTTTGGCCTCTTTTATAAGG + Intergenic
972382018 4:38527824-38527846 TTCCTCAGGCCTCTTTTCTAAGG - Intergenic
972662063 4:41125956-41125978 GTCCTCGGGTTTCATTTATATGG - Intronic
972684909 4:41342816-41342838 TCCCTCGGGCCTCTTTCATAAGG - Intergenic
972803751 4:42506276-42506298 CCTCTGAGGCCTCTTTTATAAGG - Intronic
972873549 4:43329896-43329918 TCCCTGGGGCCGCTTTTATAAGG + Intergenic
973132797 4:46669514-46669536 TTCCTTGGGTCTCTTCTATAAGG + Intergenic
973534175 4:51864661-51864683 TCCCTCAGGCCTCTTTTATAAGG + Intronic
973576407 4:52294199-52294221 TCTCTGGGGCCTCTTTTATAAGG + Intergenic
973627915 4:52791155-52791177 CTCCTCTGGACTCTTATATGAGG + Intergenic
973815881 4:54618675-54618697 GGCCTGGGGTCTCTTTTATAAGG - Intergenic
973860168 4:55056053-55056075 TCTCTTGGGCCTCTTTTATAAGG - Intergenic
974015753 4:56647471-56647493 TTGCTCAGGCCTCTTTTATAAGG + Intergenic
974489351 4:62544729-62544751 CTCTCTGGCCCTCTTTTATAGGG - Intergenic
974584957 4:63861735-63861757 TTCCTGGGACCTCTTTTATATGG - Intergenic
974601328 4:64084560-64084582 TCCCTTAGGCCTCTTTTATAAGG - Intergenic
974623881 4:64397504-64397526 TTTCTCAGGCCTCTTTTGTAAGG - Intronic
975364219 4:73509825-73509847 TCCCTTGGGCTTCTTTTATAAGG + Intergenic
975373454 4:73614415-73614437 CTTCTGGGGTCTCTTTTATAAGG - Intronic
975449015 4:74502834-74502856 TATCTTGGGCCTCTTTTATAAGG + Intergenic
975745311 4:77469425-77469447 TTCCTCGGGCTTCTTTCATAAGG - Intergenic
975867095 4:78735189-78735211 TCCCAAGGGCCTCTTTTATAAGG + Intergenic
975871699 4:78786227-78786249 TCTCTGGGGCCTCTTTTATAAGG - Intronic
976021355 4:80631989-80632011 TCTCTGGGGCCTCTTTTATAAGG - Intronic
976493866 4:85703558-85703580 TCTCTGGGGCCTCTTTTATAAGG - Intronic
976755807 4:88496929-88496951 TCCCTTGGGCCTCTTTCATAGGG - Intronic
976839800 4:89418811-89418833 CTCCCTTGGGCTCTTTTATAAGG + Intergenic
977085462 4:92591178-92591200 TCCCTTGGGCCTGTTTTATAAGG - Intronic
977127365 4:93187041-93187063 TTCCTCACACCTCTTTTATAAGG + Intronic
977210861 4:94216138-94216160 TCTCTTGGGCCTCTTTTATAAGG + Intronic
977228338 4:94421420-94421442 TTCCTCATACCTCTTTTATAAGG - Intergenic
977697712 4:99985124-99985146 TCTCTCTGGCCTCTTTTATAAGG - Intergenic
977750073 4:100599046-100599068 TTCCTCGGGCCTCTTTTATGAGG - Intronic
977933656 4:102776394-102776416 CTTCTCAGGCTTCCTTTATAAGG + Intergenic
978669275 4:111226892-111226914 TCCCTCAAGCCTCTTTTATAAGG + Intergenic
978828935 4:113059053-113059075 CTTCTGGGGCGTCTTTTATATGG + Intronic
979006379 4:115303111-115303133 TTTCTTTGGCCTCTTTTATAAGG - Intergenic
979071215 4:116209106-116209128 TCCCTTGGGCTTCTTTTATAAGG - Intergenic
979386577 4:120072697-120072719 CTCCTAAGGCCTCTTTGATTTGG + Intergenic
979862845 4:125715879-125715901 GCTCTTGGGCCTCTTTTATAAGG - Intergenic
979870987 4:125821906-125821928 TTCCTGGGGTCTCTTTTATAAGG - Intergenic
980174840 4:129332174-129332196 CTCTCAGGGCCTCTTTTATAAGG - Intergenic
980196843 4:129600356-129600378 TTCTTTGGGTCTCTTTTATAAGG - Intergenic
980267121 4:130531228-130531250 TCACTTGGGCCTCTTTTATAAGG + Intergenic
980603928 4:135064472-135064494 TCTCTGGGGCCTCTTTTATAAGG - Intergenic
980684204 4:136203926-136203948 TTTCTCAGGCCTCTTTTATAAGG - Intergenic
980972153 4:139576821-139576843 TCCCTAGGGCCTCTTTTATAAGG + Intronic
981134955 4:141200272-141200294 TCTCTAGGGCCTCTTTTATAAGG + Intronic
981330139 4:143498781-143498803 TCTCTCTGGCCTCTTTTATAAGG + Intergenic
981422501 4:144567293-144567315 CCCCTCAGGCCTCTGTTATAAGG - Intergenic
981665128 4:147215523-147215545 TCCCTTGGGCCTCTTTCATAAGG - Intergenic
981686533 4:147460695-147460717 TCCCTCAGGCCTCTTTTATAAGG - Intergenic
982099605 4:151955065-151955087 TCCCTCAGGCCTCTTTTATAAGG - Intergenic
982177352 4:152718521-152718543 TTCCTCAGGCCTCTTTTATCAGG + Intronic
982203748 4:152981763-152981785 GTCCTCGGGCCTTCTTTATAAGG - Intergenic
982680469 4:158422220-158422242 TTTCTCGGGCCTCTTTTTTAAGG - Intronic
983054782 4:163089152-163089174 GCCTTCAGGCCTCTTTTATAAGG + Intergenic
983366873 4:166802546-166802568 TCCCTTGGGCCTCCTTTATAAGG + Intronic
983514081 4:168638715-168638737 TCCCTTGGGCCTATTTTATAGGG + Intronic
983817934 4:172155305-172155327 CTCCCCGGGCCTATTTTAAAAGG - Intronic
984012576 4:174388317-174388339 TCCCTCAAGCCTCTTTTATAAGG - Intergenic
984431752 4:179659729-179659751 TCCTTCAGGCCTCTTTTATAAGG - Intergenic
984432003 4:179661799-179661821 TCCCTCAGGCCTCTTTTATAAGG - Intergenic
984468893 4:180140094-180140116 CCTCTGGGGCCTCTTTTATAAGG + Intergenic
984561515 4:181276380-181276402 TCTCTGGGGCCTCTTTTATAAGG + Intergenic
985139885 4:186828990-186829012 TCCCTTCGGCCTCTTTTATAAGG - Intergenic
985388810 4:189472954-189472976 CTCCTCGGGCATCTTGGCTAAGG - Intergenic
985738699 5:1601700-1601722 CCCTTCAGGCCTCTTTAATATGG - Intergenic
986447581 5:7836046-7836068 CCCCTCACGCTTCTTTTATAAGG + Intronic
986556422 5:9014603-9014625 CTCCTGGAGCATCTTCTATAAGG + Intergenic
986666939 5:10112718-10112740 CCCCTAGGGCCTCTTATATAAGG + Intergenic
986788311 5:11136039-11136061 TCCCTCAGGCATCTTTTATAAGG - Intronic
986844206 5:11734008-11734030 TCTCTCAGGCCTCTTTTATAAGG - Intronic
987070216 5:14329400-14329422 TCTCTCAGGCCTCTTTTATAAGG - Intronic
987081045 5:14425734-14425756 CTCCCTGGGCCTCTTTTGTAAGG - Intronic
987331194 5:16859335-16859357 TCCCTTAGGCCTCTTTTATATGG + Intronic
987333438 5:16876983-16877005 TCTCTTGGGCCTCTTTTATAAGG - Intronic
988006546 5:25418820-25418842 TCCCTCTGGCCTCTTTTATAAGG - Intergenic
988049708 5:26011151-26011173 TGTCTTGGGCCTCTTTTATAAGG + Intergenic
988178908 5:27764474-27764496 TCCCTCAGGCCTCTTTTATCAGG + Intergenic
988194813 5:27991313-27991335 TATCTTGGGCCTCTTTTATAAGG - Intergenic
988232119 5:28492619-28492641 CTCATTGGACCTCTTTTATAAGG + Intergenic
988545759 5:32156070-32156092 TCTCTGGGGCCTCTTTTATAAGG - Intronic
988704926 5:33716160-33716182 TCTCTCAGGCCTCTTTTATAAGG - Intronic
989098544 5:37803430-37803452 TCCCTGGGGTCTCTTTTATAAGG - Intergenic
989118172 5:37977047-37977069 TCTCTGGGGCCTCTTTTATAAGG - Intergenic
989162436 5:38404333-38404355 CCCTTTGGGCCTCTTTAATAAGG - Intronic
989290786 5:39762520-39762542 TCTCTGGGGCCTCTTTTATAAGG + Intergenic
989299743 5:39876668-39876690 TCTCTGGGGCCTCTTTTATAAGG + Intergenic
989399639 5:40994845-40994867 TTCCTCAGGCCTCTATTATAAGG - Intergenic
989631283 5:43484700-43484722 CTCCTTGGGCCTCTTCTTTTGGG - Intergenic
989709049 5:44374253-44374275 CTCCTTGTGTCTCTCTTATAAGG + Intronic
990500887 5:56396302-56396324 TTCCTCAAGCCTCTTTTATAAGG + Intergenic
990532040 5:56683787-56683809 TTCCTTGAGTCTCTTTTATAGGG - Intergenic
990746903 5:58967852-58967874 TCCCTTGGGCCTCTTTTATAAGG + Intergenic
990845214 5:60130009-60130031 TCTCTGGGGCCTCTTTTATAAGG - Intronic
991036659 5:62134434-62134456 TCTCTGGGGCCTCTTTTATAAGG + Intergenic
991274511 5:64828607-64828629 TGTCTTGGGCCTCTTTTATAAGG - Intronic
991322088 5:65385013-65385035 TCCCTCAGGCTTCTTTTATAAGG + Intronic
991402868 5:66272440-66272462 ATTCGGGGGCCTCTTTTATAAGG + Intergenic
991514200 5:67415787-67415809 CCTCTGGGGTCTCTTTTATAAGG + Intergenic
991571694 5:68061250-68061272 TTCCTCTAGCCTCTTTTATAAGG - Intergenic
991597421 5:68319975-68319997 TTCCTCAAGCCTCTTTTATAAGG + Intergenic
991953717 5:71971759-71971781 TCTCTGGGGCCTCTTTTATAGGG + Intergenic
992181859 5:74205274-74205296 TCCCTGGGACCTCTTTTATAAGG - Intergenic
992295136 5:75320088-75320110 CTCCTCAGGCTTCTTTCCTAGGG - Intergenic
993281724 5:85933648-85933670 TCTCTTGGGCCTCTTTTATAAGG - Intergenic
993334071 5:86635056-86635078 TCCCTCAGGCCTCTTGTATAAGG + Intergenic
993399641 5:87432570-87432592 CTCATAGTGTCTCTTTTATAAGG - Intergenic
993488426 5:88515497-88515519 TCTCTTGGGCCTCTTTTATAAGG + Intergenic
993552328 5:89288847-89288869 TTTCTCAGGCCTGTTTTATAAGG - Intergenic
993878408 5:93336125-93336147 CCCTTCAAGCCTCTTTTATAAGG + Intergenic
994223737 5:97227987-97228009 TCCCTCCGGCCTCTTTTGTAAGG + Intergenic
994527547 5:100925669-100925691 CTCTACGGGTCTCTTTTATAAGG - Intergenic
994615650 5:102100899-102100921 TTGCTTGGGCCTCTTTTACAAGG + Intergenic
995512005 5:112919620-112919642 TCCCTCAAGCCTCTTTTATAAGG - Intronic
995793449 5:115917895-115917917 TCCCTCAGGCCTCTTTTATAAGG + Intergenic
996049042 5:118910905-118910927 TCCCTCAGGCCTCTTTTATAAGG + Intronic
996400014 5:123052303-123052325 CTCCCTGCACCTCTTTTATAAGG + Intergenic
996400018 5:123052332-123052354 CTCCCTGCACCTCTTTTATAAGG + Intergenic
996428285 5:123339449-123339471 TTTCTGGGTCCTCTTTTATAAGG + Intergenic
996516291 5:124373136-124373158 ATCCTCAGGCCTCTTTTATAAGG + Intergenic
996690800 5:126337736-126337758 TCCCTGGGGCCTCTTTTATAAGG - Intergenic
997087263 5:130816425-130816447 TTCCTCTGGCCTCTTTCACAAGG + Intergenic
998068290 5:139176686-139176708 CTCCTCGGGCCTCTTTTATAAGG + Intronic
998291467 5:140918734-140918756 CTCTCTGGGCCTCTTTTATAAGG - Intronic
998495370 5:142583814-142583836 TCCATCAGGCCTCTTTTATAAGG + Intergenic
998585519 5:143422571-143422593 TCCCTGAGGCCTCTTTTATATGG - Intronic
998696486 5:144646097-144646119 TACCTTGGGCCTCTTTTATAAGG - Intergenic
998806346 5:145920854-145920876 TTTCTTGGGCCTTTTTTATAAGG - Intergenic
999343940 5:150798103-150798125 TCCCTCAGGCCTCTTTTACATGG + Intergenic
999364685 5:151014524-151014546 TTTCTTGGGCCTTTTTTATAAGG - Intergenic
999818017 5:155197359-155197381 TCTCTTGGGCCTCTTTTATAAGG - Intergenic
1000250719 5:159492112-159492134 CTTCTCAGGCTTCTTTTATAGGG - Intergenic
1000259047 5:159568426-159568448 CTCTTTGGGCCTCTTTTATAAGG + Intergenic
1000524462 5:162339286-162339308 TTCCTCTAGCCTCTTTTATAAGG - Intergenic
1000786329 5:165548985-165549007 TCCCTCTGACCTCTTTTATATGG + Intergenic
1001630409 5:173170853-173170875 CTCTTTGGGCCTCTTTTATAAGG - Intergenic
1002398604 5:178977309-178977331 ACCCTGGGGTCTCTTTTATAAGG - Intergenic
1002447521 5:179298375-179298397 CTCCCTGGGCCTCTCTGATAAGG - Intronic
1002462894 5:179384891-179384913 CTCTCTGGGCCTCTTGTATAAGG + Intergenic
1003310994 6:4969894-4969916 TCCCTGGAGCCTCTTTTATAAGG + Intergenic
1003613023 6:7630305-7630327 TCCCTGGGGCCTCTTTTATACGG - Intergenic
1003621451 6:7704618-7704640 TGCCTTGGGCCTGTTTTATAAGG - Intergenic
1003687618 6:8320204-8320226 CCTCTAGGGCCTCTTTTATAAGG + Intergenic
1003756405 6:9125837-9125859 TCCCTGGGGCCTCTGTTATAAGG - Intergenic
1003980908 6:11388902-11388924 TCCTTCAGGCCTCTTTTATAAGG - Intergenic
1004212396 6:13662572-13662594 CTTCTCACGCCTCTTTTATTAGG - Intronic
1004271571 6:14200757-14200779 TCTCTCAGGCCTCTTTTATAAGG + Intergenic
1004769114 6:18761902-18761924 TTTCTGGGGCCTCCTTTATAAGG - Intergenic
1004826320 6:19425355-19425377 TCCCTTGGGCCTCTTTAATAAGG + Intergenic
1004904116 6:20220319-20220341 AGCCTCTGGCCGCTTTTATAAGG + Intergenic
1004969798 6:20897151-20897173 TTTCTTGGGCTTCTTTTATAAGG + Intronic
1005446861 6:25932935-25932957 TTCCTTGGGTTTCTTTTATAAGG - Intergenic
1005550221 6:26904633-26904655 TTTCTGGGGTCTCTTTTATAAGG + Intergenic
1005717020 6:28559136-28559158 TCCCTCAGGCCTCTTTTATAAGG - Intergenic
1005827100 6:29639466-29639488 TCCCTGGGGCCTCTTTTAGAAGG + Intergenic
1007008850 6:38395129-38395151 GCTCTCTGGCCTCTTTTATAAGG - Intronic
1007233808 6:40375786-40375808 TCTCTCAGGCCTCTTTTATAAGG - Intergenic
1007364330 6:41380495-41380517 CTCTCTGGGCCTTTTTTATAAGG + Intergenic
1007888170 6:45256414-45256436 TCCCTCAAGCCTCTTTTATAAGG + Intronic
1008357302 6:50569779-50569801 CCCCTGGGGCCTCTTTCATAAGG - Intergenic
1008372622 6:50751632-50751654 ATCCCCTGGGCTCTTTTATAAGG + Intronic
1008377901 6:50811911-50811933 GCCCTCAGGCTTCTTTTATAAGG - Intergenic
1008810151 6:55486967-55486989 TCCCTTGGGCCTCTTTTATGAGG + Intronic
1009304798 6:62075248-62075270 TTCCTCAGGCCTCTTTTATAAGG - Intronic
1009465323 6:63961681-63961703 CCCCTCAAGTCTCTTTTATAGGG + Intronic
1009532039 6:64830119-64830141 TCCCTTGGGCCTATTTTATAAGG - Intronic
1009623149 6:66101376-66101398 TCCCTTGGGCCTCTTTTATAAGG + Intergenic
1009790427 6:68394539-68394561 TTTCTGGGGCCTCTTTTACAAGG + Intergenic
1009929813 6:70163945-70163967 TCCCTTGGGCCTCCTTTATAAGG + Intronic
1009974376 6:70657399-70657421 GGCCTTGGGCCTCTTTTAGAAGG + Intergenic
1010010555 6:71043194-71043216 TCTCTTGGGCCTCTTTTATAAGG - Intergenic
1010015833 6:71104220-71104242 TCTCTCGGGCTTCTTTTATAAGG - Intergenic
1010247447 6:73674749-73674771 CTCTTGGGGCCTCTTTTATGAGG - Intergenic
1010278330 6:73994674-73994696 CTCCCAGGGTCTCTTTTATAAGG + Intergenic
1010496582 6:76539903-76539925 TCCCTTGGACCTCTTTTATAAGG + Intergenic
1010551939 6:77234331-77234353 TCCCTCAAGCCTCTTTTATAAGG - Intergenic
1010610588 6:77950315-77950337 TCCCATGGGCCTCTTTTATAGGG - Intergenic
1010726308 6:79337613-79337635 CTCTCTGAGCCTCTTTTATAAGG - Intergenic
1010751563 6:79621368-79621390 CTCTCCAGGTCTCTTTTATATGG - Intergenic
1010765554 6:79774450-79774472 CTCTCTGGGCCTCTTTTATTTGG + Intergenic
1010831340 6:80534265-80534287 TCCCTCAAGCCTCTTTTATAAGG - Intergenic
1010903601 6:81457920-81457942 TCCTTCGAGCCTCTTTTATAAGG - Intergenic
1011171806 6:84513154-84513176 TACCTTGGGCATCTTTTATAAGG - Intergenic
1011352799 6:86441135-86441157 TCTCTGGGGCCTCTTTTATAAGG - Intergenic
1011384618 6:86781856-86781878 CCTCTCAGGCCTCTTTTATACGG + Intergenic
1011441376 6:87390950-87390972 AGCCTGGGGTCTCTTTTATAAGG + Intronic
1012166245 6:95956277-95956299 TTTCTAGGGACTCTTTTATAAGG + Intergenic
1012181617 6:96161265-96161287 TTCCTTGAGCCTATTTTATAAGG - Intronic
1012357488 6:98333663-98333685 CTCTCTGGGTCTCTTTTATAAGG + Intergenic
1013250376 6:108327556-108327578 TCCCTCAGGCCTCTTTTGTAAGG + Intronic
1013340098 6:109205589-109205611 TCCCTCAGGCCTCTTTTGTAAGG + Intergenic
1013478174 6:110529090-110529112 CTCTTGGGGCCTGTTTTATGGGG - Intergenic
1013590096 6:111612565-111612587 TCCCTTGGGCCTCTTTTAAAGGG - Intergenic
1013632058 6:111995555-111995577 TCCCTCTGGCTTCTTTTATATGG + Intergenic
1013759389 6:113499221-113499243 TTCCTCAGTCCTCTTTTATAAGG + Intergenic
1013775667 6:113676073-113676095 TTCCTCAGGCCTCTTTTCTAAGG - Intergenic
1014244615 6:119054468-119054490 TCCCTTGGACCTCTTTTATAAGG + Intronic
1014303480 6:119712272-119712294 TCCCTCAAGCCTCTTTTATAAGG - Intergenic
1014710008 6:124795768-124795790 CTTCCGGGGCCTCTTTTAGAAGG + Intronic
1014912310 6:127109674-127109696 TTCCTGGAGCCACTTTTATAAGG + Intergenic
1015797243 6:137025289-137025311 TCTCTGGGGCCTCTTTTATAAGG - Intronic
1015975586 6:138787258-138787280 TCTCTTGGGCCTCTTTTATAAGG - Intronic
1016256334 6:142109824-142109846 TCCCTTGGGCCTCTTTTATGAGG - Intergenic
1016345336 6:143106906-143106928 TCTCTCGGGCCTCTTTTATAAGG + Intronic
1016507251 6:144796245-144796267 GATCTTGGGCCTCTTTTATAAGG + Intronic
1016732412 6:147440777-147440799 TCTCTCTGGCCTCTTTTATAAGG + Intergenic
1016926619 6:149356588-149356610 TCCCTCGGGCCTCTTTTATAAGG + Intronic
1017087284 6:150725211-150725233 TCCCTCTGTCCTCTTTTATAAGG + Intronic
1017363254 6:153602181-153602203 CCTCTGGGGCCTTTTTTATAAGG + Intergenic
1017371474 6:153714259-153714281 TCTCTAGGGCCTCTTTTATAAGG + Intergenic
1017807640 6:157959904-157959926 TCCCTTGGGCCTCTTTTATAAGG - Intergenic
1017904279 6:158746117-158746139 CTCTTCGGGCCTCTTTTATGAGG + Intronic
1018072680 6:160179403-160179425 TTCCCCAGGCCTCTTTTATAAGG + Intronic
1018275725 6:162128767-162128789 TCTCTGGGGCCTCTTTTATAAGG - Intronic
1018564146 6:165133762-165133784 TTCCTTGGACCTCTTTTATTAGG - Intergenic
1019124759 6:169830793-169830815 TCCCTGGGGCCTCTTTTGTAGGG + Intergenic
1019271795 7:153535-153557 CAGCTCAGGCCTCGTTTATAAGG + Intergenic
1020366577 7:7387002-7387024 TCCCTGGGGCCTCCTTTATAAGG + Intronic
1020490755 7:8781010-8781032 TCTCTCGGGCCTCTTTTCTAAGG - Intergenic
1021113922 7:16727507-16727529 CTCTGGGGGTCTCTTTTATAAGG - Intergenic
1021342497 7:19481288-19481310 TCTCTGGGGCCTCTTTTATAAGG - Intergenic
1021525390 7:21580683-21580705 TCTCTCAGGCCTCTTTTATATGG + Intronic
1021927782 7:25550011-25550033 CTGATCATGCCTCTTTTATAAGG + Intergenic
1021966104 7:25920665-25920687 TGCCTTGGGCCTATTTTATAAGG - Intergenic
1022863995 7:34398430-34398452 TTTCTTGGGTCTCTTTTATAAGG + Intergenic
1023368833 7:39491700-39491722 TTCCTTGCACCTCTTTTATAAGG - Intronic
1023508405 7:40924006-40924028 TCCCTCAGACCTCTTTTATAAGG - Intergenic
1023555947 7:41423236-41423258 CTGCTGGGGCCTCTTTTATAAGG - Intergenic
1023724179 7:43125129-43125151 ATTCTGGGGCCTCTTTTATAAGG + Intronic
1023988871 7:45115956-45115978 TCCCTCGGGCCTCTTTTATAAGG - Intergenic
1024133908 7:46387253-46387275 TCCCTTGGGCCTATTTTATAAGG - Intergenic
1024218572 7:47268979-47269001 TCCCTTGGGCCTCTTTTATAAGG + Intergenic
1024338998 7:48238176-48238198 CTCCCTGGGTCTCTTTTATCAGG + Intronic
1024700305 7:51899362-51899384 CTCCCTGGGTCTCTTTTATAAGG + Intergenic
1024717884 7:52101315-52101337 TCTCTCGGGCCTCTTTTACAAGG - Intergenic
1024904750 7:54363932-54363954 GCCCTTGGGCCTCATTTATAAGG + Intergenic
1026108641 7:67440651-67440673 TCTCTTGGGCCTCTTTTATAAGG - Intergenic
1026244432 7:68606189-68606211 TCCCTCAGGCCTCTTTTATAAGG - Intergenic
1026248007 7:68640055-68640077 TCTCTAGGGCCTCTTTTATAGGG - Intergenic
1026555561 7:71405728-71405750 TCCCTGGGGCCTCTTTTGTAAGG + Intronic
1026956038 7:74376982-74377004 CTCCTTGGCCCTCTGTTAGAGGG + Intronic
1028635458 7:92984389-92984411 TCCCTCAGGCTTCTTTTATAAGG + Intergenic
1028636402 7:92994279-92994301 TCCCTGGGGCCTCCTTTATAAGG - Intergenic
1028666664 7:93351619-93351641 CTCTCTGGGGCTCTTTTATAAGG + Intronic
1029859024 7:103549341-103549363 CCACTGGGGTCTCTTTTATAAGG + Intronic
1030421055 7:109306741-109306763 TCCCTCAGGCCTCTTTTATGGGG + Intergenic
1030604476 7:111625092-111625114 TCTCTGGGGCCTCTTTTATAAGG + Intergenic
1030605988 7:111639596-111639618 TTCTCCTGGCCTCTTTTATAGGG - Intergenic
1030618954 7:111768985-111769007 TCTCTGGGGCCTCTTTTATAAGG - Intronic
1031020244 7:116620146-116620168 TCCCTGGGGCCTCTTTTATACGG + Intergenic
1031408546 7:121414586-121414608 TCCCTAGGGCCTCTTTTATAAGG + Intergenic
1031461959 7:122062462-122062484 TCGCTCAGGCCTCTTTTATAAGG - Intergenic
1031656789 7:124365609-124365631 TTTCTGGGGCCTCTTCTATATGG + Intergenic
1031915085 7:127555556-127555578 CTCCTTGGGCCTCTCTTAGCTGG + Intergenic
1032761893 7:134951105-134951127 TTCCTTAGGCCTCTTTTATAAGG + Intronic
1032790779 7:135241015-135241037 TCCCTCAGGACTCTTTTATAAGG + Intronic
1033594324 7:142845223-142845245 TTTCTTGGGCCTCTTTTATAAGG - Intergenic
1033770147 7:144541553-144541575 TCTCTCAGGCCTCTTTTATAAGG + Intronic
1033944807 7:146703690-146703712 TCCCTCAGGTCTCTTTTATAAGG + Intronic
1034056868 7:148044555-148044577 TTCCTTGGGCCTCTTTTGTCTGG - Intronic
1034071643 7:148191673-148191695 CTCTCTGGGTCTCTTTTATAAGG + Intronic
1034383106 7:150716279-150716301 CTCTCTGGGCCTATTTTATATGG + Intergenic
1036161493 8:6393012-6393034 TCCCTGGGGCCTCCTTTATAAGG - Intergenic
1036279068 8:7383709-7383731 TCCTTCAGGCCTCTTTTATAAGG - Intronic
1036342449 8:7928165-7928187 TCCTTCAGGCCTCTTTTATAAGG + Intronic
1036439207 8:8765505-8765527 TCCCTCAGGCCTCTTTTATAAGG + Intergenic
1036589748 8:10158103-10158125 CTGGAAGGGCCTCTTTTATAAGG + Intronic
1036915844 8:12803040-12803062 TCCCTCAGGCTTCTTTTATAAGG + Intergenic
1037272212 8:17142455-17142477 TTGCTGGGGCCTCTTTTATAAGG - Intergenic
1037649693 8:20825167-20825189 TCCCTGGGGCCTCTTTTATCAGG + Intergenic
1037735358 8:21561547-21561569 TCCCTGGGGCCTCTTTTACAAGG + Intergenic
1038143983 8:24876817-24876839 TCCCTGGGGCCTATTTTATAAGG + Intergenic
1038174372 8:25166719-25166741 TTCCTTGAGCCTCTTTCATAAGG - Intergenic
1038282765 8:26180940-26180962 TCTCTGGGGCCTCTTTTATAAGG - Intergenic
1038316664 8:26490206-26490228 CTCCCTTGGCCTCTTTTATAAGG + Intronic
1038532252 8:28327965-28327987 TCTCTGGGGCCTCTTTTATAAGG + Intronic
1038684739 8:29706127-29706149 TTACTTGAGCCTCTTTTATAAGG + Intergenic
1038738247 8:30192243-30192265 TTCCTTGGGCCTCTTTTATAAGG + Intergenic
1039083682 8:33758981-33759003 CTCCTTAGGGCTCTTTTATAAGG + Intergenic
1039299363 8:36192870-36192892 TTCCTCAGGCTTCTTCTATAAGG + Intergenic
1039745890 8:40426293-40426315 TCCCTCAGGCCTCTTTTATAAGG - Intergenic
1039824339 8:41160375-41160397 TTCCTTGGGCTTCTTTTGTAAGG - Intergenic
1040462560 8:47662817-47662839 TCTCTTGGGCCTCTTTTATAAGG - Intronic
1041264218 8:56047984-56048006 GGCCTGGAGCCTCTTTTATAAGG + Intergenic
1041640863 8:60200096-60200118 TTTCTGGGGTCTCTTTTATAAGG - Intronic
1041658105 8:60374627-60374649 ATCCTTGGGCCTGTTTTATAAGG - Intergenic
1041756615 8:61320711-61320733 TCTCTAGGGCCTCTTTTATAAGG + Intronic
1041883683 8:62783271-62783293 CTTCTGGGGGCTCTTTTATAAGG - Intronic
1041925463 8:63231350-63231372 CTTCTCTGGCATCTTTTATAAGG + Intergenic
1042046479 8:64658055-64658077 TTCCTGGGGTCTCTTTTATGAGG + Intronic
1042077039 8:65007550-65007572 GGCCTGGGGCCTCTTTTATAAGG + Intergenic
1042426444 8:68654129-68654151 TTCCTTAGGCCTCTTTTATAAGG - Intronic
1042426704 8:68657365-68657387 TTCCTTAGGCCTCTTTTATAAGG - Intronic
1042578639 8:70251305-70251327 CTCCTCAGCCCTCTTTTGTGTGG - Intronic
1042691867 8:71508604-71508626 AACCTTGGGCCCCTTTTATAAGG - Intronic
1043463069 8:80480137-80480159 TTCCACAAGCCTCTTTTATAAGG + Intergenic
1043756659 8:84012041-84012063 TTTCTCAGGCTTCTTTTATAAGG - Intergenic
1043940213 8:86188572-86188594 TCTCTTGGGCCTCTTTTATAAGG + Intergenic
1044064434 8:87682270-87682292 TTCCTGGGGTCTCTTATATAAGG - Intergenic
1044097063 8:88079775-88079797 TCTCTAGGGCCTCTTTTATAAGG - Intronic
1044213429 8:89579074-89579096 TCCCTAGGGCCTCTTTTACAAGG - Intergenic
1044351680 8:91173792-91173814 TTCCTTGGGAATCTTTTATAAGG + Intronic
1044537491 8:93374234-93374256 TCTCTAGGGCCTCTTTTATAAGG + Intergenic
1044631873 8:94288076-94288098 TCCCTGGGGCCTCTTTTATAAGG + Intergenic
1044662411 8:94604557-94604579 TCTCTTGGGCCTCTTTTATAAGG + Intergenic
1044897377 8:96906722-96906744 TCTCTGGGGCCTCTTTTATAAGG + Intronic
1045100004 8:98834674-98834696 TTCCTCAGACCTCTTTTGTAAGG + Intronic
1045100211 8:98836368-98836390 TTCCTCAGACCTCTTTTGTAAGG + Intronic
1045186630 8:99844666-99844688 GGCCTCAGGCTTCTTTTATAAGG + Intronic
1045395274 8:101754542-101754564 TCTCTGGGGCCTCTTTTATAAGG + Intronic
1045731474 8:105246824-105246846 TTCCTCTGGCCTCTTTTATAAGG - Intronic
1045778793 8:105839060-105839082 CTCTCTGGGGCTCTTTTATAAGG - Intergenic
1046060054 8:109128355-109128377 TCCCTTGGGCCTATTTTATAAGG + Intergenic
1046381876 8:113461368-113461390 TTTCTGGGGCTTCTTTTATAAGG - Intergenic
1046902354 8:119536854-119536876 TTCCTCGGGCCTCTTTTATAAGG - Intergenic
1047197593 8:122735563-122735585 TTCCCCAGGCCTCTTTTATAAGG + Intergenic
1047390560 8:124447255-124447277 CTTCTAGGGCCTCTGTTATTTGG + Intergenic
1047539262 8:125748420-125748442 TTTCTGGGGCCTGTTTTATAAGG + Intergenic
1047694035 8:127385200-127385222 CTCATGGGGCCTCTTCTTTAAGG - Intergenic
1047922565 8:129650703-129650725 CCCCTCAGGCCCCTTTTATAAGG - Intergenic
1047999877 8:130370000-130370022 GGCCTGGGGTCTCTTTTATAAGG - Intronic
1048040334 8:130721501-130721523 CCCCTCAGGCCTCTTTCATAAGG - Intergenic
1048218501 8:132518982-132519004 TGTCTGGGGCCTCTTTTATAAGG - Intergenic
1048256741 8:132910581-132910603 CTCTCTGGGTCTCTTTTATAAGG - Intronic
1048258258 8:132922776-132922798 CCCCTTGGGCCTCTTTTAAAGGG + Intronic
1048347062 8:133584013-133584035 TTCCTTGGGCCTCATTTATAAGG - Intergenic
1048593944 8:135846715-135846737 TCTCTCAGGCCTCTTTTATAAGG + Intergenic
1048661697 8:136610982-136611004 ACCCTCAGGCCTCTTTTATGAGG + Intergenic
1048841800 8:138573074-138573096 TCCCTTGGGCTTCTTTTATAAGG + Intergenic
1049519429 8:143080555-143080577 CTCCTCGGGGCTCTTGTACTGGG - Exonic
1049890795 9:68887-68909 TCTCTGGGGCCTCTTTTATAAGG - Intergenic
1050095168 9:2057296-2057318 CTCTCCGGGCTTCCTTTATAAGG + Intronic
1051114926 9:13683745-13683767 TTTTTGGGGCCTCTTTTATAAGG + Intergenic
1052100304 9:24438013-24438035 CTCTTTGGGCCTCTTCTATAAGG + Intergenic
1052143306 9:25016386-25016408 CTCATTGCACCTCTTTTATAAGG - Intergenic
1052234314 9:26191645-26191667 TCCCTAGGGCCTCTTTTATAAGG + Intergenic
1052338903 9:27346100-27346122 CCCATCAGGTCTCTTTTATAAGG - Intronic
1052431411 9:28371474-28371496 TCCCTTGGGCCTCTTTTATAAGG + Intronic
1053048846 9:34941762-34941784 TCCCTTGGGCCCCTTTTATAAGG + Intergenic
1053181774 9:35978221-35978243 CCTCTAGGGCCTCGTTTATAAGG - Intergenic
1053446266 9:38155494-38155516 TCTCTGGGGCCTCTTTTATAAGG + Intergenic
1053558642 9:39165140-39165162 TCTCTTGGGCCTCTTTTATAAGG + Intronic
1053581031 9:39404252-39404274 CTCCTAGGGCCTCTTAGATAAGG + Intergenic
1053732260 9:41070073-41070095 TCTCTGGGGCCTCTTTTATAAGG - Intergenic
1053822768 9:41985372-41985394 TCTCTTGGGCCTCTTTTATAAGG + Intronic
1053845523 9:42232309-42232331 CTCCTAGGGCCTCTTAGATAAGG + Intergenic
1054102618 9:60963056-60963078 CTCCTAGGGCCTCTTAGATAAGG + Intergenic
1054138469 9:61453801-61453823 TCTCTTGGGCCTCTTTTATAAGG - Intergenic
1054583742 9:66943810-66943832 CTCCTAGGGCCTCTTAGATAAGG - Intergenic
1054607807 9:67201993-67202015 TCTCTTGGGCCTCTTTTATAAGG - Intergenic
1054696192 9:68361644-68361666 TCTCTGGGGCCTCTTTTATAAGG + Intronic
1054869427 9:70035775-70035797 TCTCTTGGGCCTCTTTTATAAGG - Intergenic
1054919495 9:70527821-70527843 TTCCTTGAGCCTCTTTTAAAAGG - Intergenic
1055390365 9:75815305-75815327 TCTCTTGGGCCTCTTTTATAAGG + Intergenic
1055411391 9:76033803-76033825 CCCCTCAGGCCTCTTTAAAAGGG + Intronic
1055650278 9:78400194-78400216 TCCCTCAAGCCTCTTTTATAAGG + Intergenic
1055702963 9:78966226-78966248 TTTGTGGGGCCTCTTTTATAAGG - Intergenic
1055731465 9:79282993-79283015 AGCCTGGGGTCTCTTTTATACGG - Intergenic
1055836931 9:80454890-80454912 TCTCTGGGGCCTCTTTTATAGGG + Intergenic
1056105609 9:83343527-83343549 CTTCTCGTGCCTCTTTGAAAAGG - Intronic
1056222952 9:84468007-84468029 GGCCTCGTGCCTCTTTCATAAGG - Intergenic
1056461166 9:86810907-86810929 CTCTCTGGGTCTCTTTTATAAGG - Intergenic
1056782154 9:89558797-89558819 TCTCTGGGGCCTCTTTTATAAGG + Intergenic
1057268204 9:93632601-93632623 TTTCTGGGGTCTCTTTTATAAGG + Intronic
1057718707 9:97515829-97515851 CTCCTCGGCTCTCTTCTATCTGG + Intronic
1057895053 9:98902577-98902599 TTTCTCTGGCCTATTTTATAAGG - Intergenic
1058188420 9:101883870-101883892 CTTCTGGGGACTCTTTTGTAAGG - Intergenic
1058335859 9:103828209-103828231 TTTCTAGGGCCTCTTTTATAAGG - Intergenic
1058608394 9:106748449-106748471 TTCCTCAGTCCTCTTTCATAAGG + Intergenic
1058765353 9:108177393-108177415 CCTCTGGGGCATCTTTTATAAGG + Intergenic
1059038156 9:110781784-110781806 TTTCTTGGACCTCTTTTATAAGG + Intronic
1059207366 9:112479460-112479482 TTTCCTGGGCCTCTTTTATAAGG - Intronic
1059465153 9:114464485-114464507 TTCTTGGAGCCTCTTTTATAAGG + Intronic
1059474925 9:114538797-114538819 CATCTGGGGCCTTTTTTATAAGG - Intergenic
1059908056 9:119010396-119010418 TCTCTGGGGCCTCTTTTATAAGG + Intergenic
1061089391 9:128418495-128418517 GCCCCCAGGCCTCTTTTATAAGG + Intronic
1061266686 9:129509863-129509885 TCTCTGGGGCCTCTTTTATAAGG + Intergenic
1061277007 9:129574775-129574797 CCCCTGGAGCCTCTTTAATAAGG - Intergenic
1061283047 9:129608429-129608451 GGCCTCGGGCCTCTTTTATAAGG + Intergenic
1185815981 X:3156426-3156448 CCTCTGGGGTCTCTTTTATAAGG - Intergenic
1185845330 X:3432529-3432551 CTCTCTGGGTCTCTTTTATAAGG + Intergenic
1186451788 X:9680095-9680117 TTGCTTGAGCCTCTTTTATAGGG + Intronic
1186804091 X:13122327-13122349 TTCCTGGGGTTTCTTTTATAAGG - Intergenic
1187057902 X:15758356-15758378 TTTCTCAAGCCTCTTTTATAAGG + Intronic
1187609372 X:20924561-20924583 TTCTTCAAGCCTCTTTTATAAGG - Intergenic
1187948371 X:24448259-24448281 TCTCTGGGGCCTCTTTTATAAGG + Intergenic
1188556522 X:31418288-31418310 CTCTCTGGGTCTCTTTTATAAGG + Intronic
1188691651 X:33136622-33136644 TTCCCTTGGCCTCTTTTATAAGG - Intronic
1188703770 X:33300638-33300660 CCTCTTGGGCCTCTCTTATAAGG - Intronic
1188746449 X:33850666-33850688 TTCTTTGGGGCTCTTTTATAAGG + Intergenic
1188748022 X:33871443-33871465 TTCCTCAGGCATCTTTTATAAGG + Intergenic
1189025567 X:37390170-37390192 TCCCTCAAGCCTCTTTTATAAGG + Intronic
1189106109 X:38237290-38237312 CTTTCAGGGCCTCTTTTATAAGG - Intronic
1189170219 X:38901786-38901808 AATCTGGGGCCTCTTTTATAAGG - Intergenic
1189351155 X:40276792-40276814 TCCCTTGGGCCTCTTTTATAAGG - Intergenic
1189394931 X:40612932-40612954 CTCCTTCCGGCTCTTTTATAAGG + Intergenic
1189740152 X:44109480-44109502 TTCCTGGGGCCTCATTTATAAGG + Intergenic
1189768816 X:44401296-44401318 TTCCTCAGGTCTCTTTTACAAGG - Intergenic
1190073140 X:47295215-47295237 TTCCTTGGGCCTGTTTCATAAGG - Intergenic
1190421618 X:50290393-50290415 TTCCTCGGGCCTCTTTTATAAGG + Intronic
1190537168 X:51440814-51440836 TCTCTGGGGCCTCTTTTATAAGG - Intergenic
1191699230 X:64021584-64021606 TCTCTGGGGCCTCTTTTATAAGG - Intergenic
1191713791 X:64179874-64179896 TTCCTTGGGCCTTTTTTATAAGG - Intergenic
1192272169 X:69591298-69591320 TTCCTCAAGCCTCTTTTATAAGG - Intergenic
1192275272 X:69623400-69623422 TTCCTTGGACCTATTTTATAAGG + Intronic
1194334723 X:92630964-92630986 TTCCTCAGGCCTCTTTTATAAGG + Intergenic
1194353597 X:92854137-92854159 TTTCTCAGGCCTCTTTTATAAGG + Intergenic
1194731211 X:97457781-97457803 TCCCTTGAGCCTCTTTTATAAGG - Intronic
1194796920 X:98223308-98223330 TCTCTCAGGCCTCTTTTATAAGG - Intergenic
1194865080 X:99055207-99055229 TTTCTGGGGTCTCTTTTATAAGG - Intergenic
1194957588 X:100198719-100198741 TCTCTTGGGCCTCTTTTATAAGG - Intergenic
1195069820 X:101267950-101267972 TCCCTCGGGCCTCTTTTAAAAGG - Intergenic
1195454760 X:105055247-105055269 GTCTTTGGGCCTCTTTTATAAGG + Intronic
1195461686 X:105133775-105133797 TCCCTCAGGCCTCTTGTATATGG + Intronic
1195545020 X:106104501-106104523 CTCCTTGGGCTTCTTTTATAAGG + Intergenic
1195774962 X:108392738-108392760 TTTCTTGGGCCCCTTTTATAAGG - Intronic
1195939553 X:110156780-110156802 TTCCTTGGGCATCTTTTATAAGG + Intronic
1196224696 X:113152063-113152085 TTCTTCAGGCCTCTTTTATAAGG - Intergenic
1196327589 X:114425752-114425774 CTCCACGGGCCCCATTTATTGGG + Intergenic
1196404068 X:115346196-115346218 TCCCTCTGCCCTCTTTTATAAGG - Intergenic
1196580737 X:117376107-117376129 TCTCTGGGGCCTCTTTTATAAGG - Intergenic
1197168684 X:123407554-123407576 CCTCTTGGGCCTCTTTTATAAGG + Intronic
1197296478 X:124724910-124724932 CTCCTGAAGCCTCTTTTATAAGG - Intronic
1197332529 X:125171575-125171597 TCTCTAGGGCCTCTTTTATAAGG - Intergenic
1197596035 X:128465126-128465148 GCCCTCAAGCCTCTTTTATAAGG - Intergenic
1197712647 X:129682858-129682880 TCTCTTGGGCCTCTTTTATAAGG + Intergenic
1198098490 X:133403412-133403434 TCTCTGGGGCCTCTTTTATAAGG + Intronic
1198528884 X:137529619-137529641 TCCCTCTGGTCTCTTTTATAAGG - Intergenic
1198546435 X:137697415-137697437 TCTCTGGGGCCTCTTTTATAAGG - Intergenic
1198589127 X:138156664-138156686 TTCCTGGGGTCCCTTTTATAAGG + Intergenic
1198792818 X:140364258-140364280 TCTCTCAGGCCTCTTTTATAAGG - Intergenic
1198885776 X:141334494-141334516 TCTCTGGGGCCTCTTTTATAAGG - Intergenic
1199116779 X:144001540-144001562 TCCCTCTTGCCTCTTTTATAAGG + Intergenic
1199225307 X:145366077-145366099 CCCCTGGGGTCTTTTTTATAAGG + Intergenic
1199287481 X:146069809-146069831 TCTCTTGGGCCTCTTTTATAAGG - Intergenic
1199301298 X:146217409-146217431 TCCTTTGGGCCTCTTTTATAAGG - Intergenic
1199407068 X:147474707-147474729 CTTCTTGGGCCTCTTTTATAAGG + Intergenic
1199971675 X:152866250-152866272 TCCCTTGGGCCTCTTTTATGAGG + Intronic
1200180866 X:154149996-154150018 CTTCTAGGACCTCTTTTATAAGG + Intronic
1200186509 X:154187110-154187132 CTTCTAGGACCTCTTTTATAAGG + Intergenic
1200192161 X:154224248-154224270 CTTCTAGGACCTCTTTTATAAGG + Intronic
1200197916 X:154262052-154262074 CTTCTAGGACCTCTTTTATAAGG + Intronic
1200643201 Y:5748017-5748039 TTCCTCAGGCCTCTTTTATAAGG + Intergenic
1200661958 Y:5971210-5971232 TTTCTCAGGCCTCTTTTATAAGG + Intergenic