ID: 998068291

View in Genome Browser
Species Human (GRCh38)
Location 5:139176687-139176709
Sequence TCCTCGGGCCTCTTTTATAA GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 1967
Summary {0: 3, 1: 16, 2: 144, 3: 568, 4: 1236}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
998068286_998068291 4 Left 998068286 5:139176660-139176682 CCTCACATGCAGAAGAGGCAAGG 0: 1
1: 0
2: 1
3: 32
4: 264
Right 998068291 5:139176687-139176709 TCCTCGGGCCTCTTTTATAAGGG 0: 3
1: 16
2: 144
3: 568
4: 1236
998068284_998068291 18 Left 998068284 5:139176646-139176668 CCTTCTTACTGGGTCCTCACATG 0: 1
1: 58
2: 666
3: 1875
4: 3104
Right 998068291 5:139176687-139176709 TCCTCGGGCCTCTTTTATAAGGG 0: 3
1: 16
2: 144
3: 568
4: 1236

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
998068291 Original CRISPR TCCTCGGGCCTCTTTTATAA GGG Intronic
900765925 1:4505335-4505357 TCCTTGGACCTTTTTTATAAGGG - Intergenic
900855103 1:5175089-5175111 TTCTGGGTTCTCTTTTATAAGGG - Intergenic
900866059 1:5269503-5269525 TCCTGGGGCCTCCCTTATGAGGG + Intergenic
900949138 1:5847784-5847806 GCCTGGGGCCTCTTTTATGAGGG - Intergenic
901409623 1:9073189-9073211 GCCACGGGCCTCTTTTGTACAGG + Intronic
902611257 1:17598548-17598570 CTCTAGGGCCTCTTTTATATGGG + Intronic
902652894 1:17848207-17848229 TCCTGGGGTCTCTTTTATAAGGG + Intergenic
902734031 1:18388226-18388248 CTCTGGGACCTCTTTTATAAGGG - Intergenic
903558869 1:24212812-24212834 CTCTGGGGCCTCTTTTATAAGGG - Intergenic
904868163 1:33598983-33599005 TCTGTGGGTCTCTTTTATAAAGG + Intronic
904869871 1:33609970-33609992 CTCTCAGGCCTCTTTTATAAGGG - Intronic
905336893 1:37250882-37250904 CCCTTGGGGCTCTTTTATAAGGG - Intergenic
905530654 1:38676104-38676126 CCCTTAGGCCTCTTTTATAAGGG + Intergenic
905756995 1:40518766-40518788 CCCTTGGAACTCTTTTATAAGGG - Intergenic
905916999 1:41691525-41691547 TTCTTTGGCCTCTTTTATAAGGG - Intronic
906370144 1:45247112-45247134 CTCTGGGGCTTCTTTTATAAAGG - Intronic
906463208 1:46053534-46053556 CTATCAGGCCTCTTTTATAAGGG - Intronic
906606066 1:47173146-47173168 TGCTGGGGTCCCTTTTATAAGGG + Intergenic
906651853 1:47518346-47518368 CCCTGGACCCTCTTTTATAAGGG - Intergenic
906716347 1:47972495-47972517 CTCTGGGGTCTCTTTTATAAGGG - Intronic
906718622 1:47989028-47989050 TCCTCTAGCTTCTTTTGTAAGGG - Intronic
906896813 1:49782979-49783001 TTCTGGGGCCTCTTATATAAGGG - Intronic
906935572 1:50211381-50211403 CCCTCAGGCCTCTCTTATAAAGG + Intergenic
907082928 1:51641269-51641291 GACTGGGGCCTCTTTTATAAGGG + Intronic
907446638 1:54512346-54512368 GTCTGGGGCCTCTTTTATAAGGG + Intergenic
907485384 1:54774446-54774468 CCCTGAAGCCTCTTTTATAAGGG + Intergenic
907680681 1:56560582-56560604 CCCTCAGTCCTGTTTTATAAGGG + Intronic
907761207 1:57362597-57362619 CTCTGAGGCCTCTTTTATAAGGG - Intronic
907773569 1:57489999-57490021 TTCTTGGGCCCCTTTTAGAAGGG - Intronic
907822665 1:57986331-57986353 CTCTCGGGTCTTTTTTATAAGGG - Intronic
908064787 1:60391024-60391046 CTCTAAGGCCTCTTTTATAAGGG - Intergenic
908076166 1:60521239-60521261 CTCTGGGGCCTCTTTTATAATGG + Intergenic
908208430 1:61874496-61874518 CCCTTGGGCCTATTTTATAAAGG + Intronic
908392485 1:63696303-63696325 GCCTCAGGCTTCTTTTATGAGGG - Intergenic
908429330 1:64040711-64040733 CCCTGGGGTCTATTTTATAAGGG + Intronic
908540878 1:65120877-65120899 TCCTCAGGCATCTTTTATAAGGG - Intergenic
908564709 1:65342378-65342400 TCTGGGGCCCTCTTTTATAAAGG - Intronic
908810248 1:67974941-67974963 TTCTGGGGCCTCTTTTATAAGGG + Intergenic
909020447 1:70425477-70425499 ATCTGGGGCCTCTTTTATCAGGG + Intronic
909103441 1:71379410-71379432 TTCCAGGGCCTCTTTTATAAGGG - Intergenic
909134597 1:71782185-71782207 TCGTGGGGTCTATTTTATAAGGG - Intronic
909395187 1:75163866-75163888 CCCTTAGGTCTCTTTTATAAGGG - Intergenic
909870203 1:80729375-80729397 GCCTGAGGCCTCTTTTACAAGGG + Intergenic
909945367 1:81657259-81657281 CCCTCAGACCTCTTTTATAAGGG - Intronic
910253489 1:85222552-85222574 CTCTTGGGCCTCCTTTATAAGGG + Intergenic
910334218 1:86109879-86109901 CTCTGGGGTCTCTTTTATAAGGG - Intronic
910445870 1:87298595-87298617 CTCTAGAGCCTCTTTTATAAGGG - Intergenic
910713237 1:90203386-90203408 CTCTGGGGTCTCTTTTATAAAGG - Intergenic
910965756 1:92806536-92806558 TCTGGGGGCCTCTTTGATAAGGG - Intergenic
911255475 1:95628278-95628300 CTCTGGGGCCTCTTTAATAAGGG - Intergenic
911314463 1:96339381-96339403 CACTCAGGCCTCTTTTATAAGGG + Intergenic
911377539 1:97069557-97069579 CCCTAGGCCCTCTTTTATAAGGG + Intergenic
911754580 1:101538165-101538187 TCCTGGGGTCTCTTTTATAAGGG + Intergenic
912219054 1:107651063-107651085 CTCTAGGGCCTCTTTTACAAGGG - Intronic
912666437 1:111584485-111584507 CCCTCAAGCCTCTTTTATAAGGG + Intronic
913067443 1:115269503-115269525 CCCTCAGGCCTCTTTTTCAAGGG - Intergenic
913348243 1:117829318-117829340 CTCTGGAGCCTCTTTTATAAGGG + Intergenic
913446507 1:118956013-118956035 TTCTGGGGCCTCTTTTATAAGGG - Intronic
913460672 1:119082927-119082949 GCCTGAAGCCTCTTTTATAAGGG - Intronic
913530299 1:119729278-119729300 TCCTCCATCCTCTTTTGTAAGGG + Intronic
913575535 1:120169981-120170003 CTCTGGGGTCTCTTTTATAAAGG - Intronic
914557845 1:148785623-148785645 CTCTGGGGTCTCTTTTATAAAGG - Intergenic
914614989 1:149344607-149344629 CTCTGGGGTCTCTTTTATAAAGG + Intergenic
915841921 1:159220229-159220251 CTCTGGGGTCTCTTTTATAATGG + Intergenic
916086080 1:161270545-161270567 GCCTGGGGTCTCTTTTATAAGGG - Intronic
916118608 1:161509088-161509110 CCCTCGGCCCTCTTTTATAAGGG - Intronic
916490004 1:165293782-165293804 CCCTCAGGCCCCTTTTATAAGGG + Intronic
916523238 1:165584735-165584757 AGATCAGGCCTCTTTTATAAGGG - Intergenic
916526775 1:165617803-165617825 CCCTCAAGCCTCTTTTATAAGGG - Intergenic
916821580 1:168403982-168404004 TTCTGGGGCCTCTTTTATAGGGG + Intergenic
917005029 1:170405592-170405614 TTCTTGAGCCTCTTTTATATGGG - Intergenic
917354798 1:174115837-174115859 TCTTGGGGCCTCTTTTATAAGGG - Intergenic
917605346 1:176622979-176623001 CCTTTGAGCCTCTTTTATAAGGG + Intronic
917652955 1:177096873-177096895 CACTGGGGCCTCTTTTATAAGGG - Intronic
917744262 1:177992490-177992512 CCCTCAGGCCTCTTTTGTAAGGG + Intergenic
917851215 1:179065955-179065977 CCCTCTGGCCTCATTTATAAGGG + Intronic
918095150 1:181328266-181328288 CTCTGGGGCCTCTTTTGTAAGGG + Intergenic
918402064 1:184173491-184173513 TCCTCAGGCCTTCTTTATAAGGG - Intergenic
918491609 1:185087346-185087368 CCATCAAGCCTCTTTTATAAAGG + Intronic
918920969 1:190709141-190709163 CTCTTGGGCCTCTTTTATAAGGG + Intergenic
919001549 1:191838246-191838268 CTCTAGGGTCTCTTTTATAAGGG - Intergenic
919187288 1:194168768-194168790 CTCTCGGGCCACTTTTATAAGGG - Intergenic
919252068 1:195068377-195068399 TGTTTGAGCCTCTTTTATAAGGG - Intergenic
919412727 1:197266364-197266386 CCCTCAGGCCTCTTTTATAAGGG + Intergenic
919418163 1:197337148-197337170 CTCTTGGACCTCTTTTATAAGGG - Intronic
919484929 1:198134250-198134272 CTCTGGGGCCTCTTTTATAAGGG - Intergenic
919583516 1:199407242-199407264 CCCTTGGGCCCCTTTGATAAGGG - Intergenic
920169693 1:204063941-204063963 TCCTCAAGCCTCTTTCATAAAGG + Intergenic
920188226 1:204175611-204175633 CCCTTGGGCCCCCTTTATAAGGG - Intergenic
920243412 1:204570356-204570378 TCCTCTAGCCTCTTTTATAAAGG + Intergenic
920429520 1:205908149-205908171 TCTCTGGGTCTCTTTTATAAGGG + Intergenic
920717347 1:208352848-208352870 CTCTCTGGCCTCTTTCATAAGGG + Intergenic
920814425 1:209318099-209318121 TCCTTAGGCCTCTTTTATAAGGG + Intergenic
920844408 1:209581865-209581887 CTCTAGGGTCTCTTTTATAAGGG + Intergenic
920909188 1:210198333-210198355 CTCTGGGGTCTCTTTTATAAGGG + Intergenic
920969723 1:210732778-210732800 CTCTGGGGCCTCTTTTATAAGGG + Intronic
921057781 1:211557109-211557131 CCCTGAAGCCTCTTTTATAAAGG - Intergenic
921287833 1:213624780-213624802 CTCTGGGGTCTCTTTTATAAGGG + Intergenic
921701280 1:218271614-218271636 CTCTGGGGGCTCTTTTATAAGGG - Intergenic
921718989 1:218449813-218449835 ATCTCAGGCCACTTTTATAAGGG + Intergenic
921726933 1:218534298-218534320 TCTGGGGGCCTCTTTTATAAAGG - Intergenic
921753481 1:218824903-218824925 TCCTCAGGCCCCTTTTATAAGGG - Intergenic
921918534 1:220641346-220641368 CCCTTGGGCCTCTTTTGTAAGGG - Intronic
922084932 1:222337619-222337641 TCCACAGGCCTCTTTTAAATTGG - Intergenic
922131957 1:222788695-222788717 TCCTTGGGCCTCTGTTGTAAGGG - Intergenic
922171844 1:223162079-223162101 CCCTCAAGCCTCTTTTATAAGGG - Intergenic
922173465 1:223176869-223176891 TTCTGGGGCCTCTTTTATAAAGG - Intergenic
922219625 1:223548542-223548564 TCCTGGGGTTCCTTTTATAAGGG - Intronic
922224654 1:223634717-223634739 CTCTAGGGCGTCTTTTATAAAGG + Intronic
922254285 1:223879071-223879093 CCCTTGGGCCTCTTTTATAAGGG + Intergenic
922277623 1:224093634-224093656 TCCTTGGACCTCTTTTATAAGGG - Intergenic
922360116 1:224813439-224813461 CCCTCAGTCCTCTTTTACAAGGG - Intergenic
922514232 1:226195016-226195038 GCCTGGGGTCTCTTTTATAAGGG + Intergenic
922860351 1:228811012-228811034 CTCTAGGGCCTCTTTTATAAGGG + Intergenic
922929379 1:229376936-229376958 CCCTCGGGCCTTCTTCATAAGGG - Intergenic
922975479 1:229780146-229780168 TTCTTGGGTCTCTTTTATGAAGG - Intergenic
923096077 1:230776243-230776265 CTCTGGGGCCTCTTTTATAATGG + Intronic
923127340 1:231043458-231043480 CCCTCAAGCCTCTTTTACAAGGG + Intergenic
923144665 1:231189695-231189717 CTCTGGGGCCTGTTTTATAAGGG + Intronic
923217229 1:231859468-231859490 CTCTGGGGCCTCTTTTGTAAGGG + Intronic
923231238 1:231988528-231988550 CCCTGGGCCCTCTTTTATACAGG - Intronic
923390871 1:233513803-233513825 CTCTCAGGCCTCTTTTATAAGGG + Intergenic
923393593 1:233537942-233537964 TCTTTGGGTCTCTTTTATGAAGG - Intergenic
923625820 1:235612984-235613006 TCCTCAGGCTTCTTTTATAAGGG + Intronic
923757373 1:236804286-236804308 CCCTTGAGCCTCTTTTATAAGGG - Intronic
923771524 1:236941997-236942019 CCCTCCAGCCTTTTTTATAAGGG + Intergenic
923824771 1:237488423-237488445 CCTTGGGGCCTCCTTTATAAAGG + Intronic
924152606 1:241143858-241143880 CCCTCAGGCCTCCTTTATAAGGG - Intronic
924415636 1:243853407-243853429 ATCTTGAGCCTCTTTTATAAGGG + Intergenic
924484680 1:244469613-244469635 TCCTTGGGCTTCCTATATAAAGG - Intronic
924696718 1:246408046-246408068 CCCTTGGGCCTCTTTTATGAGGG + Intronic
924721648 1:246628648-246628670 CCCTTGGGCCTCTTTTGTAAGGG + Intronic
924803785 1:247346974-247346996 CTCTGGGGTCTCTTTTATAAGGG + Intergenic
924863510 1:247952442-247952464 CCCTCGAGCCTCCTTTAGAAAGG - Intronic
1062792184 10:314764-314786 CCTTTAGGCCTCTTTTATAAGGG + Intronic
1062853928 10:769828-769850 CTCTGGGGCCTCTTTCATAAGGG - Intergenic
1063159738 10:3410430-3410452 GCCTGAGGCCTCTTTTCTAAGGG - Intergenic
1063345031 10:5303717-5303739 CCCGCAGGCCTCTTTTCTAAGGG - Intergenic
1063559139 10:7110250-7110272 CTCTGGGGTCTCTTTTATAAGGG + Intergenic
1063787685 10:9403601-9403623 TTCTAGGGTTTCTTTTATAAAGG - Intergenic
1064218092 10:13417277-13417299 CCCTTGGGCCTCTTTTATAAGGG - Intergenic
1064277675 10:13921558-13921580 GGCTGGTGCCTCTTTTATAAGGG + Intronic
1064286512 10:13996136-13996158 TTTGAGGGCCTCTTTTATAAGGG + Intronic
1064401007 10:15021063-15021085 CCCCTGGGCATCTTTTATAAAGG - Intergenic
1064829870 10:19450883-19450905 CCCTTGGGCCTATTTTATAAGGG + Intronic
1064847146 10:19668007-19668029 CTCTGGGGCCTCTTTTACAAGGG + Intronic
1065338463 10:24679349-24679371 TCCTGGGGCTTCTTTTTTATAGG + Intronic
1065362171 10:24898912-24898934 TTCTGGGGACTCTTTTATAAGGG - Intronic
1065494236 10:26312451-26312473 CTCTGGGGCCTCTTTCATAAGGG - Intergenic
1065758776 10:28962021-28962043 CCCTGAAGCCTCTTTTATAAGGG - Intergenic
1065801202 10:29354347-29354369 CCCTCAGGCTTCTTTTATAAGGG - Intergenic
1065871369 10:29959104-29959126 CTCTGGGGCCACTTTTATAAGGG - Intergenic
1065924742 10:30425608-30425630 CCCTGAAGCCTCTTTTATAAGGG - Intergenic
1066136293 10:32449825-32449847 TTTTCAGACCTCTTTTATAAGGG - Intronic
1066174580 10:32890685-32890707 CCCTCAGTCCTCTTTAATAAGGG + Intergenic
1066444347 10:35468221-35468243 CTCTGGGGCCTCTTTCATAAGGG + Intronic
1066751111 10:38658401-38658423 CCCTTAAGCCTCTTTTATAAAGG - Intergenic
1066965934 10:42264691-42264713 CCCTTAAGCCTCTTTTATAAAGG + Intergenic
1067050196 10:43011554-43011576 CCCTCAGGCCTCTTTTATAGGGG - Intergenic
1067221236 10:44345826-44345848 CCCTCAGGCCTCTTTTATAAGGG + Intergenic
1067287657 10:44918803-44918825 CTCTCAGGTCTCTTTTATAAGGG - Intronic
1067424429 10:46194361-46194383 CCCTCAGGCATCCTTTATAAAGG + Intergenic
1067482198 10:46609472-46609494 CCCTCGGGCCACTTTCGTAAGGG + Intergenic
1067537306 10:47122827-47122849 CTGTGGGGCCTCTTTTATAAGGG - Intergenic
1067583195 10:47458449-47458471 CTCTGGGACCTCTTTTATAAAGG + Intergenic
1067612551 10:47732196-47732218 CCCTCGGGCCACTTTCGTAAGGG - Intergenic
1067718738 10:48710293-48710315 CTCTCAGGCTTCTTTTATAAGGG + Intronic
1068068799 10:52169414-52169436 CTCTGGGGTCTCTTTTATAAGGG + Intronic
1068345824 10:55776559-55776581 CCCTCAGGCATCTTTTATGAAGG - Intergenic
1068450091 10:57175132-57175154 CCTTTGGGCCTCTTTTATAATGG - Intergenic
1068594476 10:58888051-58888073 CCCTTGAGCCTCTTTTATAAAGG + Intergenic
1068909342 10:62361551-62361573 TCTCTGGGCCTCTTTTATAAGGG - Intergenic
1069013581 10:63401834-63401856 TGCTGGGTCCTCTTTTATTAGGG - Intronic
1069243860 10:66176656-66176678 CTCTGGGGCCTCTTTTATAAGGG - Intronic
1069258719 10:66366522-66366544 TCCTCAAGCCTCTTTTAAAAAGG - Intronic
1069587701 10:69619540-69619562 CCCTTGTGCCTCTCTTATAAGGG + Intergenic
1069656357 10:70092128-70092150 CCCTCAGGCCTCTTTTATAAGGG - Intronic
1069732648 10:70628459-70628481 CCTTGGGGCTTCTTTTATAAGGG + Intergenic
1069887992 10:71635941-71635963 TTCTGGGGTCCCTTTTATAAGGG + Intronic
1069938436 10:71936372-71936394 TTCTGAAGCCTCTTTTATAAGGG + Intergenic
1070578911 10:77704040-77704062 TTCTGGGGTCTCTTTTATAAGGG - Intergenic
1070583567 10:77743449-77743471 TCTCTCGGCCTCTTTTATAAGGG - Intergenic
1070860850 10:79659770-79659792 CCCTCAGGCATCCTTTATAAAGG + Intergenic
1070876414 10:79815807-79815829 CCCTCAGGCATCCTTTATAAAGG - Intergenic
1071200581 10:83217666-83217688 TCCTCTGGTATCTTTTATAAGGG + Intergenic
1071379551 10:85044541-85044563 CTCTGGGGTCTCTTTTATAAGGG + Intergenic
1071398864 10:85249894-85249916 TTCTCAGGAATCTTTTATAAGGG + Intergenic
1071643344 10:87337983-87338005 CCCTCAGGCATCCTTTATAAAGG - Intergenic
1071919967 10:90338499-90338521 CTCTGGGGCCTCTTATATAAGGG + Intergenic
1071954750 10:90745343-90745365 CCCTCAGGCCTCTTTTATAAGGG + Intronic
1072234332 10:93440112-93440134 GCCTGGGGAATCTTTTATAATGG - Intronic
1072422334 10:95299629-95299651 CCCTTGGGCCTCTTTTACAAGGG + Intergenic
1072512240 10:96139425-96139447 CTCTGGGGTCTCTTTTATAAGGG - Intronic
1072548742 10:96460814-96460836 CTCTGGGGTCTCTTTTATAAGGG - Intronic
1072597893 10:96892553-96892575 TCTTGGTGCCTCTTTTATAAGGG + Intronic
1072716384 10:97755532-97755554 CTCTGGGGCCTCTTTTATAAGGG + Intronic
1073386689 10:103131483-103131505 CTCTTAGGCCTCTTTTATAAGGG - Intronic
1073470654 10:103720213-103720235 TGCTGGAGCCTCTTTCATAAGGG + Intronic
1073640729 10:105250150-105250172 CTCTGGGGTCTCTTTTATAAAGG + Intronic
1073821617 10:107270907-107270929 CCCTGGGGTCTCTTTTATGAGGG + Intergenic
1073937253 10:108648208-108648230 CTCTCAAGCCTCTTTTATAAGGG - Intergenic
1073955358 10:108864533-108864555 ATCTGGAGCCTCTTTTATAAGGG - Intergenic
1073983209 10:109178274-109178296 CCCTCAGACCTCTTTTATAATGG - Intergenic
1074079710 10:110157825-110157847 CTCTCTGGCCTCTTTTATAAGGG + Intergenic
1074427729 10:113367108-113367130 CGCTCCAGCCTCTTTTATAAGGG + Intergenic
1074431961 10:113401854-113401876 CCCTCAGGCCTCTTTTATAAGGG + Intergenic
1074489557 10:113926999-113927021 CCCTCAAGCCTCTTTTATAAGGG - Intergenic
1074679262 10:115887479-115887501 TTCTGGGCTCTCTTTTATAAGGG + Intronic
1074836466 10:117300754-117300776 CTCTCAGGCTTCTTTTATAAGGG - Intronic
1075053299 10:119199202-119199224 CCCTCAGGCCTCTTTTATCGAGG - Intergenic
1075098255 10:119487889-119487911 TTCTGGGGCCTCTTTGATAAGGG - Intergenic
1075163195 10:120042325-120042347 CCCTCAAGCCTCTTTTATGAGGG + Intergenic
1075308433 10:121389965-121389987 CTCTGGGGTCTCTTTTATAAGGG - Intergenic
1075312186 10:121423664-121423686 CCCTTAGGCCTCTTTTATAAGGG + Intergenic
1075406632 10:122199888-122199910 TCCTCAGTCCTCTTTCGTAAGGG + Intronic
1075580728 10:123616166-123616188 CTCTGGGGCCTCTTTTATAAGGG - Intergenic
1076449844 10:130549384-130549406 CCCTTGTGCCTATTTTATAAGGG - Intergenic
1076595025 10:131620023-131620045 TCCTCTGGCCTGTTTCATAAGGG + Intergenic
1076596441 10:131625536-131625558 CCCTCGAGCCTCGTTCATAAAGG + Intergenic
1077280334 11:1741871-1741893 CCCTGGGGCCCCTTTTATAAGGG - Intronic
1077993590 11:7433659-7433681 TCCTTGGGCCTCTTTTATAAGGG - Intronic
1078056664 11:8014821-8014843 TTCTCAGGCCTCTTTTATAAAGG + Intergenic
1078499024 11:11850920-11850942 CTCTGGGGCCTCTTTTACAAGGG + Intronic
1078772762 11:14366010-14366032 TCCTCAAGCCTCTTTTATAAGGG - Intergenic
1078879024 11:15429581-15429603 CTCTAGGGCCTTTTTTATAAGGG + Intergenic
1078908965 11:15713239-15713261 ACCCTGGGCCTCTTTTATAAGGG + Intergenic
1079091581 11:17484313-17484335 CTCTGGGGCCTCTTTTATAAGGG - Intergenic
1079147834 11:17869596-17869618 CCCTTGGACCTCTTTTATAAGGG + Intronic
1079300078 11:19270170-19270192 GCCTAGGGCATCTTTTACAAGGG - Intergenic
1079503120 11:21124952-21124974 TCCTGGGGTCTCCTTTATAAGGG + Intronic
1079526628 11:21397835-21397857 CCCTTGGGCCTCTAATATAAGGG - Intronic
1079685585 11:23355167-23355189 CTCTGGGGCCTCTTTTATAAAGG + Intergenic
1079755937 11:24262205-24262227 CCCCCAGTCCTCTTTTATAAGGG + Intergenic
1079794970 11:24789791-24789813 TCCTTGGGCTTCTTGTATAAGGG + Intronic
1079826134 11:25196609-25196631 GGCTTGGGCCTCTTTTAAAAGGG + Intergenic
1079963824 11:26956123-26956145 CTCTGGGGCCTCTTTTATGAAGG + Intergenic
1080178217 11:29392772-29392794 CCCTCAGGTCTCTTTTGTAAGGG + Intergenic
1080231537 11:30021766-30021788 CTCTGAGGCCTCTTTTATAAGGG + Intergenic
1080260531 11:30344964-30344986 TTCGGGAGCCTCTTTTATAAAGG + Intergenic
1080282225 11:30570280-30570302 CTCTGGGGCCTCTTTTATAAGGG + Intronic
1080391932 11:31856026-31856048 CTCTGGAGCCTCTTTTATAAGGG - Intronic
1080587274 11:33693458-33693480 TTGCTGGGCCTCTTTTATAAAGG + Intergenic
1080593026 11:33740015-33740037 TCCTCAGGCCTCTTTTATAAGGG - Intergenic
1080660990 11:34295829-34295851 ACCTGGGGTCCCTTTTATAAGGG + Intronic
1080777272 11:35397711-35397733 CTCTTGGGGCTCTTTTATAAGGG - Intronic
1080848929 11:36050953-36050975 CCCTTGGGCCTTTTTCATAATGG + Intronic
1081042533 11:38229325-38229347 CCCTTGGGCCTATTTTAGAAGGG - Intergenic
1081063821 11:38514080-38514102 ACCTCAGGCTTCTTTTAAAAGGG + Intergenic
1081107389 11:39087469-39087491 CTCTGGGGCTTCTTTTATAAGGG - Intergenic
1081362115 11:42193034-42193056 CCCGCTGGTCTCTTTTATAAGGG - Intergenic
1081418262 11:42841273-42841295 TTCTTGGGCCTCTTTTATACGGG - Intergenic
1081515467 11:43824569-43824591 CCCTCAGGCCTCTTTTATAAGGG + Intronic
1081609843 11:44554791-44554813 TCCTTGGGCCTCTTTTAAAAGGG - Intergenic
1081795956 11:45819780-45819802 GGCTCTGGCCTCTTTTATAAGGG + Intergenic
1082267975 11:50140053-50140075 CCCTGGGGTCTCTTTTATAAGGG + Intergenic
1082288113 11:50338468-50338490 CCCTGGGGTCTCTTTTATGAGGG - Intergenic
1082782539 11:57299017-57299039 CTCTGGGGCCTCTCTTATAAGGG - Intergenic
1082990235 11:59201178-59201200 CTCTGGGGCCTCTTTTATAAGGG + Intronic
1083357464 11:62077609-62077631 CACTCAGTCCTCTTTTATAAGGG + Intergenic
1083541964 11:63517742-63517764 GCCTGGAGTCTCTTTTATAAGGG - Intergenic
1084010991 11:66348196-66348218 TCGTCGGCCCTGTTTTATAGAGG + Intronic
1084035014 11:66504385-66504407 GCCTGAAGCCTCTTTTATAAGGG + Intronic
1084081047 11:66825173-66825195 GCCTGGGGCCTTTTTTATAAAGG - Intronic
1084976401 11:72801605-72801627 CTCTTGAGCCTCTTTTATAAGGG - Intergenic
1085250248 11:75138716-75138738 CTCTCAGGCCTCTTTTATAAGGG + Intronic
1085802078 11:79600005-79600027 TTCAGAGGCCTCTTTTATAAGGG - Intergenic
1085859077 11:80211255-80211277 TCCTCGAGCCTCTTCTCTAATGG + Intergenic
1085997497 11:81937932-81937954 CCCTTAGGCCTGTTTTATAAGGG - Intergenic
1086214009 11:84355424-84355446 CTCTGGGGACTCTTTTATAATGG - Intronic
1086320198 11:85638201-85638223 CTCTGGAGCCTCTTTTATAAGGG + Intergenic
1086532841 11:87806397-87806419 CCCTGAGGTCTCTTTTATAAGGG + Intergenic
1086567029 11:88238944-88238966 TCCAAGGGCCTCTTTAATGAGGG - Intergenic
1086583256 11:88423673-88423695 CAATTGGGCCTCTTTTATAAGGG + Intergenic
1086790421 11:91030698-91030720 CTCTGGGGCCTCTTTTGTAAGGG - Intergenic
1086859975 11:91914706-91914728 CTCTGGGGACTCTTTTATAAGGG + Intergenic
1086942600 11:92813984-92814006 CCCTGAAGCCTCTTTTATAAGGG - Intronic
1087038432 11:93775834-93775856 CCCTCAGGTCTCTTTTATAAGGG - Intronic
1087186536 11:95204601-95204623 TCTTGGGGTCTCTTTTATAAAGG - Intronic
1087215484 11:95488605-95488627 CTCTAGGGTCTCTTTTATAAGGG - Intergenic
1087240077 11:95764817-95764839 CTCTGGGGCCTCTTTTTTAAGGG - Intergenic
1087426620 11:97995808-97995830 ACATGGGGCCTCTTTTATAAGGG + Intergenic
1087477716 11:98657942-98657964 CCCTGGGACCTATTTTATAAGGG - Intergenic
1087545285 11:99576799-99576821 CTCTGGGGCCTCTTTTATAAGGG + Intronic
1087676546 11:101169144-101169166 CTCTGGGGCCTCTTTCATAAAGG - Intergenic
1087702202 11:101447914-101447936 CTCTAGGGCCTCTTTCATAAGGG - Intergenic
1087739220 11:101868737-101868759 CTCTCAGGCCTTTTTTATAAGGG + Intronic
1087795956 11:102454726-102454748 CCCTCAGGCCTCCTTTACAAGGG - Intronic
1087822525 11:102728559-102728581 CTCTGGGGTCTCTTTTATAAGGG - Intergenic
1087970782 11:104479873-104479895 CTCTGGGGCCTCATTTATAAAGG - Intergenic
1087981709 11:104622160-104622182 TCTTAGGGTCTCTTTTGTAAGGG + Intergenic
1088105623 11:106203811-106203833 CCCTTGGGCCTATTTTATAATGG - Intergenic
1088112976 11:106283087-106283109 CTCTGGGGCCTCTTTCATAAAGG - Intergenic
1088427742 11:109723476-109723498 CCCCCAGGCCTCCTTTATAAGGG + Intergenic
1088434318 11:109794318-109794340 TCCTTCAACCTCTTTTATAAAGG + Intergenic
1088464485 11:110119804-110119826 TGCTCAAGCCTCTTTTATGAGGG + Intronic
1088713430 11:112528155-112528177 CTCTGCGGCCTCTTTTATAAGGG - Intergenic
1088823951 11:113478028-113478050 CTCTTGGGCCTCTTTTACAAGGG + Intergenic
1088924741 11:114290012-114290034 CTCTCGGGCCTATTTCATAAGGG + Intronic
1088974526 11:114803878-114803900 CCCTCAGGTCTCTTGTATAAGGG + Intergenic
1089132125 11:116220435-116220457 TTCTTGGGCCACATTTATAAGGG - Intergenic
1089188118 11:116634863-116634885 CTCTAGGGCCTCTTTTCTAAGGG + Intergenic
1089604339 11:119633119-119633141 CCTCTGGGCCTCTTTTATAAGGG - Intronic
1089663242 11:119999397-119999419 CCTTGGGGCCTCTTTTCTAAGGG - Intergenic
1089809799 11:121122268-121122290 CCCTCTGGCCTCCTTTCTAAGGG - Intronic
1089827032 11:121287349-121287371 CTCTGGGGTCTCTTTTATAAGGG + Intergenic
1089897196 11:121942477-121942499 CTCTAAGGCCTCTTTTATAAGGG + Intergenic
1090200926 11:124855631-124855653 CTCTGGGGCCTCTTTTATAAGGG + Intergenic
1090532064 11:127601070-127601092 TCCTCTGGCTCCTTTTTTAAAGG + Intergenic
1090687145 11:129134784-129134806 AGCTCATGCCTCTTTTATAAGGG - Intronic
1090731982 11:129580237-129580259 CTCTCAGGCTTCTTTTATAAAGG - Intergenic
1090738354 11:129632700-129632722 CTCTCAGGCCTGTTTTATAAGGG + Intergenic
1090925833 11:131249794-131249816 TTCTGGGGTCTCTTTTATAAGGG + Intergenic
1091084725 11:132710422-132710444 TCATCGTGTCTCCTTTATAATGG - Intronic
1091195796 11:133729694-133729716 GCCTTGGGCCTCTTTTAGAAAGG + Intergenic
1091848488 12:3676549-3676571 TCCTCTGGCCTCTTTTATAAGGG - Intronic
1091852443 12:3710837-3710859 TACTAGGTCCTCTTTTATTAGGG + Intronic
1092614708 12:10206228-10206250 GTCTCAGGCCTCTTTTATAACGG - Intergenic
1092730087 12:11523112-11523134 CTCTGGGGTCTCTTTTATAAAGG - Intergenic
1092769209 12:11881583-11881605 CTCTCAGGCCTCTTTTAAAAGGG + Intronic
1092933842 12:13341655-13341677 CCCTCAGGCCTCCTTTATAAGGG - Intergenic
1093051809 12:14512803-14512825 CCCTCGGGACTGTTTTGTAAGGG - Intronic
1093135468 12:15444662-15444684 CTCTGGGGCCTCCTTTATAAGGG - Intronic
1093211496 12:16314292-16314314 CTCTGGGGCCTCTATTATAACGG + Intergenic
1093241943 12:16687458-16687480 TCCTTGGGCCTTTTTTATGAGGG + Intergenic
1093280971 12:17195826-17195848 TAGTGGGACCTCTTTTATAAGGG - Intergenic
1093641638 12:21533962-21533984 CTCTGGGGCCTCTTTTATAAGGG + Intronic
1093738580 12:22654094-22654116 TCTTTGGGCCTCTTTTATAAGGG - Intronic
1093763078 12:22932195-22932217 CTCTGGGGCCTCTTGTATAAGGG - Intergenic
1094237621 12:28186734-28186756 CTCTGGAGCCTCTTTTATAAGGG - Intronic
1094444341 12:30513474-30513496 CCCTTGGACCTCTTTTGTAAGGG + Intergenic
1094566665 12:31604860-31604882 TCCTGGGGTCTCTTTTATAAAGG + Intergenic
1094770235 12:33649404-33649426 TCCTTGCACCTCTTTTATGAGGG - Intergenic
1094803128 12:34061367-34061389 TCCTCAGGCCTCTTTTACAAGGG + Intergenic
1095116538 12:38359875-38359897 TCCTCAGGCCTCTTTTACAAGGG + Intergenic
1095174837 12:39079719-39079741 CTGTGGGGCCTCTTTTATAAGGG + Intergenic
1095301192 12:40585918-40585940 GCCTCTGGTGTCTTTTATAAGGG + Intergenic
1095408487 12:41894726-41894748 CCCTCTGGCCTTTTTTATAAGGG + Intergenic
1095751659 12:45719265-45719287 CTCTGGGGTCTCTTTTATAAGGG + Intergenic
1095775140 12:46002354-46002376 GTCTGGGACCTCTTTTATAAAGG - Intergenic
1095823240 12:46503780-46503802 CCCTTAGGCCTCTTTTACAAAGG - Intergenic
1095848916 12:46778920-46778942 TCCTCTAGCCTCTGTTCTAAGGG + Intronic
1095878882 12:47111111-47111133 TCCTTGGGCTTCTATTATTAAGG - Intronic
1095934486 12:47662104-47662126 CTCTGGGGCCTCTTTTACAAGGG + Exonic
1096384540 12:51186346-51186368 TCCCTTGGCCTCTTTTATAAGGG - Intergenic
1096488685 12:52001585-52001607 CCCTCAAGCCTCTTTTATAAGGG + Intergenic
1096917117 12:55045291-55045313 TCCTCAAGTCTCTTTTATGAGGG + Intergenic
1097306319 12:58073030-58073052 ATTTGGGGCCTCTTTTATAAAGG - Intergenic
1097549072 12:61044256-61044278 CCCTCTGGCCCTTTTTATAAGGG - Intergenic
1097623196 12:61966385-61966407 TCAGGGGACCTCTTTTATAAGGG + Intronic
1097630430 12:62055099-62055121 CTCTGGGACCTCTTTTATAAGGG - Intronic
1097649581 12:62280557-62280579 TCTGGGAGCCTCTTTTATAAAGG + Intronic
1097690949 12:62734082-62734104 CCCTGGAGCCTCTTTTATAAGGG - Intronic
1097717758 12:62984219-62984241 CCCTGGGGTCCCTTTTATAATGG + Intergenic
1097783307 12:63731776-63731798 GCCTTGGGCCTATTTTCTAAGGG - Intergenic
1097905918 12:64919604-64919626 CTCTGGGGCGTCTTTTATAAGGG + Intergenic
1097915860 12:65019625-65019647 GCCTACGGTCTCTTTTATAAGGG + Intergenic
1098090932 12:66900329-66900351 CTCTGGGGTCTCTTTTATAAGGG - Intergenic
1098111158 12:67123204-67123226 CCCTTGGGCCTCTTTTATAAGGG + Intergenic
1098136876 12:67412501-67412523 CTTTGGGGCCTCTTTTATAAGGG + Intergenic
1098235515 12:68414512-68414534 CTCTGGGGTCTCTTTTATAAGGG - Intergenic
1098327055 12:69313811-69313833 CTCTGGGGTCTCTTTTATAAGGG - Intergenic
1098471220 12:70846628-70846650 TCTCCTGGCCTCTTTTTTAAGGG - Intronic
1098714966 12:73818780-73818802 CTCTCAGGCCTCTTTTATGAGGG - Intergenic
1098724023 12:73939366-73939388 CCCTCAGGCCTCTTTTATAAGGG - Intergenic
1098854147 12:75633326-75633348 ACCTTGGACCTTTTTTATAAGGG - Intergenic
1098914392 12:76241851-76241873 GCCTCGTGCCCCTTTTAAAAGGG - Intergenic
1099415143 12:82375286-82375308 TCCTTGTACCTCTTTTATACGGG - Intronic
1099438481 12:82671076-82671098 CCCTTGGGCCTCTTTTATAAGGG - Intergenic
1099482313 12:83183281-83183303 CTCTGGAGCCTCTTTTATAAGGG + Intergenic
1099579662 12:84428160-84428182 CCCTTGGGCCTATTTTATATGGG - Intergenic
1099652047 12:85441212-85441234 CCCTGGCGTCTCTTTTATAAGGG - Intergenic
1099668192 12:85658077-85658099 CCCTCAGGCTTCTTTTATACAGG + Intergenic
1099753868 12:86814748-86814770 CTCTGGGGCCTCTTTTATAAGGG - Intronic
1099969246 12:89483510-89483532 CTCTGGGGCTTCTTTTATAAGGG + Intronic
1100097942 12:91066709-91066731 CTCTCAGGCCTCTTTTATGAGGG - Intergenic
1100134044 12:91533127-91533149 CCCTTGAGCCTCTTTTATAAGGG - Intergenic
1100298063 12:93281083-93281105 TTCTGGGGCCTCTTTCATAAGGG + Intergenic
1100343970 12:93708986-93709008 CTCTCGGGCTTCTTTTATATGGG + Intronic
1100364220 12:93904473-93904495 CTCTGGAGCCTCTTTTATAAGGG - Intergenic
1100406566 12:94277224-94277246 CTCTGAGGCCTCTTTTATAAGGG + Intronic
1100598397 12:96091137-96091159 CTCTGAGGCCTCTTTTATAAGGG - Intergenic
1100600074 12:96105312-96105334 CTCTGGGGCCTCTTTTACAAGGG - Intergenic
1100779319 12:98007476-98007498 TCTCTGGGCCTCTTTTGTAAGGG - Intergenic
1100841159 12:98612817-98612839 ATCTGGGGCCTCTTTTATAGGGG - Intergenic
1101042756 12:100773201-100773223 AACTGGGGCCTCTTTGATAAAGG + Intronic
1101140022 12:101785515-101785537 GCCTGGGATCTCTTTTATAAGGG + Intronic
1101208637 12:102513890-102513912 CCCTTGAGCCTATTTTATAAGGG - Intergenic
1101412031 12:104477587-104477609 CTCTGGGGTCTCTTTTATAAGGG - Intronic
1101423426 12:104567833-104567855 CCCTCAGGCCTCTTTTATAAGGG - Intronic
1101512670 12:105407033-105407055 TTCTGGGGTCCCTTTTATAAAGG - Intergenic
1101553294 12:105783641-105783663 CTCTGGGGCCTCTTTTGTAAGGG + Intergenic
1101674551 12:106906071-106906093 CCCTCGAGCCACTTTTATAAGGG + Intergenic
1101710091 12:107256985-107257007 CTGTGGGGCCTCTTTTATAAGGG - Intergenic
1102553447 12:113709988-113710010 CCCTGGGGACTCCTTTATAAGGG - Intergenic
1102713704 12:114951860-114951882 CCCTTGGGCCTCCTTAATAAAGG - Intergenic
1102817681 12:115880937-115880959 CTCTGGGGCCTCTTTTACAAAGG - Intergenic
1103076398 12:117986281-117986303 CTCTGGGGCCTCTTTTATAAGGG - Intergenic
1103178970 12:118891113-118891135 CCCTTGGGCCTATTTTGTAACGG + Intergenic
1103222133 12:119254760-119254782 CTCTTGGGCATCTTTTATAAGGG + Intergenic
1103392951 12:120587437-120587459 GCCTGGGGTCCCTTTTATAAGGG - Intergenic
1103426770 12:120842679-120842701 CTTTTGGGCCTCTTTTATAAGGG + Intronic
1103441059 12:120963481-120963503 CCCTTGGGCCTCTTTGATAAGGG + Intergenic
1104045658 12:125160715-125160737 CCCTTGGGCCTCCTTTATGAGGG - Intergenic
1104078140 12:125408402-125408424 CCCTCAAACCTCTTTTATAAGGG - Intronic
1104562148 12:129855088-129855110 TCCCCCGGACTCTGTTATAAGGG - Intronic
1104562169 12:129855158-129855180 TCCCCCGGACTCTGTTATAAGGG - Intronic
1104562190 12:129855228-129855250 TCCCCCGGACTCTGTTATAAGGG - Intronic
1104562224 12:129855333-129855355 TCCCCCGGACTCTGTTATAAGGG - Intronic
1104562258 12:129855438-129855460 TCCCCCGGACTCTGTTATAAGGG - Intronic
1104562269 12:129855473-129855495 TCCCCCGGACTCTGTTATAAGGG - Intronic
1104562405 12:129855893-129855915 TCCCCCGGACTCTGTTATAAGGG - Intronic
1104562473 12:129856103-129856125 TCCCCCGGACTCTGTTATAAGGG - Intronic
1104562553 12:129856348-129856370 TCCCCCGGACTCTGTTATAAGGG - Intronic
1104562621 12:129856558-129856580 TCCCCCGGACTCTGTTATAAGGG - Intronic
1104562644 12:129856628-129856650 TCCCCCGGACTCTGTTATAAGGG - Intronic
1104562677 12:129856733-129856755 TCCCCCGGACTCTGTTATAAGGG - Intronic
1104562728 12:129856902-129856924 TCCCCCGGACTCTGTTATAAGGG - Intronic
1104562751 12:129856972-129856994 TCCCCCGGACTCTGTTATAAGGG - Intronic
1104562819 12:129857182-129857204 TCCCCCGGACTCTGTTATAAGGG - Intronic
1104562887 12:129857392-129857414 TCCCCCGGACTCTGTTATAAGGG - Intronic
1104562910 12:129857462-129857484 TCCCCCGGACTCTGTTATAAGGG - Intronic
1104562943 12:129857567-129857589 TCCCCCGGACTCTGTTATAAGGG - Intronic
1104562994 12:129857736-129857758 TCCCCCGGACTCTGTTATAAGGG - Intronic
1104563017 12:129857806-129857828 TCCCCCGGACTCTGTTATAAGGG - Intronic
1104563128 12:129858156-129858178 TCCCCCGGACTCTGTTATAAGGG - Intronic
1104563179 12:129858325-129858347 TCCCCCGGACTCTGTTATAAGGG - Intronic
1104563202 12:129858395-129858417 TCCCCCGGACTCTGTTATAAGGG - Intronic
1104563351 12:129858885-129858907 TCCCCCGGACTCTGTTATAAGGG - Intronic
1104596361 12:130122748-130122770 CCCTTGGGCCTCTTTTCTAAGGG + Intergenic
1105456890 13:20549223-20549245 TTCTCGGGCCACTCTCATAAGGG - Intergenic
1106049661 13:26178378-26178400 CTCTGGGGCCTCTTTTATGAGGG + Intronic
1106678951 13:31990153-31990175 CTCTGGGGCCTCTTTTATAAGGG - Intergenic
1106757442 13:32837073-32837095 CTCTGGGGCTTCTTTTATAAGGG + Intergenic
1106990946 13:35419357-35419379 CCCTTGAGCCTATTTTATAAGGG + Intronic
1107121180 13:36797770-36797792 CCCTGGAGTCTCTTTTATAAGGG + Intergenic
1107176514 13:37405793-37405815 CTCTTGGGCCTCTCTTATAAGGG + Intergenic
1107348421 13:39488117-39488139 CCCTGGAGCCTCTTTTATAAGGG - Intronic
1107601922 13:42022564-42022586 CCCTCGGGCCTCTTTTATAAGGG - Intergenic
1107748857 13:43542924-43542946 CTCTAGGGCCTCTTTTATAAAGG + Intronic
1107876520 13:44795725-44795747 CTCTGGGGTCTCTTTTATAAGGG - Intergenic
1108057038 13:46495334-46495356 CTCTGGGGCCTCTTTTGTAAGGG + Intergenic
1108134947 13:47346089-47346111 CTCTGGGGTCTCTTTTATAAGGG - Intergenic
1108161876 13:47649007-47649029 CCCTAAGGCCTCTTTTGTAAGGG + Intergenic
1108276181 13:48812027-48812049 TCCTAGGGTCTCTTTTATAAGGG + Intergenic
1108543128 13:51462965-51462987 CCCCCAGGCCTCTTTTATAAAGG - Intergenic
1108601679 13:52000351-52000373 CCCTCAAGCCTCTTTTATAAGGG + Intronic
1108606068 13:52039962-52039984 TCCTTGGGCTTCTTTTATAAGGG - Intronic
1108679502 13:52767352-52767374 CTCTGGGGTCTCTTTTATAAAGG - Intergenic
1109052387 13:57500291-57500313 TCTTGGGACCTATTTTATAAGGG + Intergenic
1109128768 13:58553168-58553190 CCCTCAAGCCTCTTGTATAAAGG + Intergenic
1109147821 13:58803535-58803557 TTCTGGGGTCTCTTTTATAAGGG + Intergenic
1109200154 13:59421255-59421277 CTCTGGGGCCTCTTTTATAAGGG + Intergenic
1109360031 13:61283247-61283269 TTCTCAGACCACTTTTATAAGGG - Intergenic
1109394268 13:61734650-61734672 CCCTGGAGCCTCTTTTTTAAAGG - Intergenic
1109436725 13:62313219-62313241 TCCTCAGGCCTCTTTTGTAAGGG - Intergenic
1110285051 13:73740208-73740230 CTCTGGAGCCTCTTTTATAAGGG - Intronic
1110413908 13:75231799-75231821 CCCTCAGGCCTCTTTTATAAGGG - Intergenic
1110417066 13:75264700-75264722 CCCTCAGGCCTCTCTGATAAGGG + Intergenic
1110515020 13:76400517-76400539 CTCTGGGGTCTCTTTTATAAGGG - Intergenic
1110522885 13:76501632-76501654 TCCTGGGGACTCTTTAATAAGGG - Intergenic
1110559530 13:76896060-76896082 CCCTCAGGCCTCTTTTATCAGGG + Intergenic
1110685067 13:78362815-78362837 TTCTTAGGCCTCTTTTATATGGG + Intergenic
1110727300 13:78840064-78840086 CCCTGGGGTCCCTTTTATAAGGG + Intergenic
1110767443 13:79297042-79297064 TCCTAGGGCCTCATTTGAAACGG - Intergenic
1110817248 13:79875813-79875835 CTCTGGGGCCTCTTTGATAAGGG + Intergenic
1110844231 13:80175663-80175685 CTCTGGAGCCTCTTTTATAAGGG + Intergenic
1111080654 13:83302385-83302407 TCCTCACACCTCTTTTATATGGG - Intergenic
1111238581 13:85442897-85442919 CCCTTGGACTTCTTTTATAAGGG - Intergenic
1111260558 13:85734344-85734366 TCTCTGGGCCTCTTTTATAAGGG - Intergenic
1111500821 13:89118178-89118200 TCCTTAGACCTCTTTTATAAGGG - Intergenic
1111851401 13:93580225-93580247 TCTTGGGGTCTCTTTTATGAGGG + Intronic
1112122139 13:96424675-96424697 TTCTCCAGCCTCTTTTATAAGGG + Intronic
1112263195 13:97897291-97897313 CTCTGGGGCCTCTTTTATAAAGG + Intergenic
1112340531 13:98549379-98549401 CCCTCGGACCTCTTTTGTGAGGG + Intronic
1112414592 13:99193716-99193738 CCCTCAGGCCTCTTTTATAAGGG + Intergenic
1112657467 13:101467073-101467095 CCCCCAAGCCTCTTTTATAAGGG + Intronic
1112751557 13:102588801-102588823 ATCTGGGGCCTGTTTTATAAGGG - Intergenic
1112884814 13:104156780-104156802 CTCTGGGACCTCTTTTATAAGGG - Intergenic
1113086005 13:106570174-106570196 TCCTTGGGCCCCTTTTATAAGGG - Intergenic
1113223974 13:108139040-108139062 TCCCTAGGCCTCTTTTATCAGGG + Intergenic
1114168456 14:20246401-20246423 TCCTTTCGCCTATTTTATAAGGG - Intergenic
1114838573 14:26234261-26234283 CCTTTGGGCCTCTTTTATAAGGG + Intergenic
1114888272 14:26882573-26882595 TCCTCAGGCTTCTTTTATAAGGG - Intergenic
1115106657 14:29770015-29770037 CCTTCAGGCTTCTTTTATAAGGG - Intronic
1115208535 14:30941010-30941032 CCTTTGGGCCTCTTTTATAAGGG - Intronic
1115300205 14:31876923-31876945 TCCTCAGGCCTCTTTTATAAAGG + Intergenic
1115319219 14:32061013-32061035 CTCTTGGGCCTCTTTTATAAGGG - Intergenic
1115345672 14:32340858-32340880 CTCTTGGGCCTCTTTTATTAGGG + Intronic
1115503236 14:34067858-34067880 CTCTCAGGCCTCTTTTACAAAGG + Intronic
1115649441 14:35392332-35392354 TGCTGGGGCTTCTTCTATAAGGG - Intergenic
1115662833 14:35513782-35513804 CCCTTAGGCCTATTTTATAAGGG + Intergenic
1115708901 14:36028341-36028363 CCCTCAAGCCTCTTTTATTAAGG - Intergenic
1115808570 14:37079940-37079962 CCCTGGGGCCTCTTCTATAAGGG - Intronic
1115952530 14:38737283-38737305 TCCTTTGGCCTCGTTTATATAGG - Intergenic
1116010951 14:39351618-39351640 CCCTTGAGCCTCTTTTATAAGGG - Intronic
1116127721 14:40809435-40809457 CCCTAGAGCCTCTTTTATAAGGG - Intergenic
1116171596 14:41409279-41409301 TGCTTGTGCCTCTCTTATAAGGG + Intergenic
1116429431 14:44828874-44828896 TCTTGGGGTCTCTTTTATAAAGG - Intergenic
1116443294 14:44979408-44979430 CCCACAGGCCTGTTTTATAAGGG + Intronic
1116549059 14:46210951-46210973 TCCTTGGGCCTGTTTTATAAGGG + Intergenic
1116637455 14:47415853-47415875 CTCTGGGGCCTCTTTTATAAGGG + Intronic
1116752086 14:48899339-48899361 CTTTCAGGCCTCTTTTATAAGGG + Intergenic
1116786046 14:49289811-49289833 CTCTAGGGTCTCTTTTATAAGGG - Intergenic
1116800346 14:49437087-49437109 CTCTGGGGCCTGTTTTATAAAGG - Intergenic
1116815395 14:49579169-49579191 TTCTTGGGCTTATTTTATAAGGG - Intronic
1116881638 14:50176112-50176134 CCCTTAGGCCCCTTTTATAAGGG - Intronic
1116948521 14:50857836-50857858 TTCTCCTGCCTCTTTTATAAGGG + Intergenic
1116990326 14:51269235-51269257 TCCTCGAGCCCCTTTATTAAGGG - Intergenic
1117186581 14:53246161-53246183 CTCTCAGGCCTCTTTTATAAGGG - Intergenic
1117218349 14:53575575-53575597 CCCTGGGGCCTCTTTTACAAGGG + Intergenic
1117377294 14:55128504-55128526 CTCTCCGGCCTCTTTTATTAGGG + Intronic
1117674231 14:58139967-58139989 CTCTGGGGTCTCTTTTATAAGGG - Intronic
1117757390 14:58989925-58989947 CTCTGGGGCCTTTTTTATAAGGG + Intergenic
1117816718 14:59606461-59606483 CCCTTGGGCCTCTTTTCTAAGGG - Intronic
1117846312 14:59915097-59915119 TCTTTGGGCCTCTTTTATGAGGG - Intergenic
1118029318 14:61804929-61804951 CTCTGGGGCCTCTTTTATAAGGG - Intergenic
1118049937 14:62015662-62015684 TTCTGGGGCCTCTTTTATAAGGG - Intronic
1118089877 14:62462123-62462145 CCCTGGAGCCTCTTTTATATGGG - Intergenic
1118226657 14:63906950-63906972 CTCTTGGGCCTCTTTTATAAGGG + Intronic
1118348695 14:64958334-64958356 CCCTCAGACCTCTTTTCTAAGGG - Intronic
1118367921 14:65111254-65111276 TCCTTGTGCCTCTTTTATAAGGG - Intergenic
1118467446 14:66043760-66043782 CCCTTGGGCCTCTTTTATAGGGG - Intergenic
1118504122 14:66391990-66392012 CCCTCAGGCCACTTTCATAAGGG - Intergenic
1118515299 14:66521658-66521680 CCCTCAAGCCTCTTTTATGAGGG + Intronic
1118530046 14:66694194-66694216 GTCTCAGGCCTCTTTTATTAGGG - Intronic
1118890879 14:69907896-69907918 CACTCTGGCCTCCTTTATAAAGG + Intronic
1119629402 14:76214610-76214632 CTCTGGGGTCTCTTTTATAAGGG + Intronic
1119876156 14:78061095-78061117 CCCTCAGGCCTATTTTATAGGGG - Intergenic
1119894721 14:78210303-78210325 TCCTCTGGCCTCTGCTGTAAGGG + Intergenic
1120128562 14:80777288-80777310 CTCTGGGGTCTCTTTTATAAGGG - Intronic
1120379399 14:83755154-83755176 CCCTTGGGCCTCTTTTATAAAGG + Intergenic
1120395631 14:83963574-83963596 CCCTCAGGCCTCTTTTATATGGG + Intergenic
1120497368 14:85253716-85253738 CTCTCTGGCCTCTTTTATAATGG + Intergenic
1120498917 14:85269722-85269744 CTCTGGGGCCTCTTTTGTAAGGG + Intergenic
1120540743 14:85747606-85747628 CTCTGGGGCCTCTTTTATCAGGG - Intergenic
1120713669 14:87818133-87818155 CACTAGGGCCTCTTTTATAAGGG - Intergenic
1120855204 14:89205965-89205987 CTCTAGGGCCTCTTTTATGAGGG - Intronic
1120915503 14:89706624-89706646 CTCTGGGGCTTCTTTTATAAGGG + Intergenic
1120916472 14:89714986-89715008 TCCTGGGGCCTCTTTGATAAGGG + Intergenic
1120947955 14:90015709-90015731 TTCTGGGGTCTCCTTTATAAGGG + Intronic
1121164382 14:91777808-91777830 TCTTTGGGTCTTTTTTATAAAGG + Intronic
1121240685 14:92427898-92427920 CTCTGGGGTCTCTTTTATAAGGG - Intronic
1121303541 14:92890485-92890507 CTCTGGGGCCTCTCTTATAAGGG - Intergenic
1121369621 14:93345099-93345121 CTCTAGGGCCTCTTTTATAAGGG - Intronic
1121383062 14:93491135-93491157 CTCTGGGGCCTCTTTTATAAGGG + Intronic
1121393582 14:93597743-93597765 GTCTGGGGCCTCTTTCATAAGGG + Intronic
1121484446 14:94303947-94303969 CTCTGGGGCCTCTTTTATAAGGG - Intergenic
1121499271 14:94420568-94420590 CCCTCAGGCCTCTTTAAAAAGGG - Intergenic
1121577702 14:95001788-95001810 TTCTGGGGTCCCTTTTATAAGGG + Intergenic
1121579553 14:95017530-95017552 CCCTCCTGCCTCTTTTATAAGGG + Intergenic
1121659417 14:95623977-95623999 CTTTTGGGCCTCTTTTATAAAGG + Intergenic
1121778787 14:96608473-96608495 TTCTGGGGCCTCTTTTATAAAGG + Intergenic
1121788408 14:96680294-96680316 CTCTGGGGACTCTTTTATAAGGG - Intergenic
1121818510 14:96946380-96946402 TTCTCTGGGGTCTTTTATAAGGG + Intergenic
1121851970 14:97229485-97229507 CCCTCAGGACTCTTTTATAAGGG + Intergenic
1121881186 14:97501648-97501670 CTCTAGGGGCTCTTTTATAAAGG - Intergenic
1122110219 14:99494903-99494925 CCCTTGGGCCTCTTTTATAAGGG + Intronic
1122281552 14:100625780-100625802 ACCTCGAGACTTTTTTATAAGGG - Intergenic
1122423985 14:101595005-101595027 CTCTCGGGCCTCTTTAACAAGGG - Intergenic
1123416171 15:20097167-20097189 CCCTCAGGCTTCTTTTATAAGGG - Intergenic
1123525511 15:21104272-21104294 CCCTCAGGCTTCTTTTATAAGGG - Intergenic
1123726297 15:23105732-23105754 CACTCAGGCCTCTTTTATAAGGG + Intergenic
1124200450 15:27674588-27674610 TCCTGCGACCTCTTTTATAAGGG - Intergenic
1124362138 15:29045387-29045409 GCCTGGGGTCTCTTTCATAAGGG + Intronic
1124643201 15:31412134-31412156 CCCTTGAGCCTTTTTTATAAGGG - Intronic
1124706764 15:31973039-31973061 CCCTGGGGCCCCTTATATAAGGG + Intergenic
1124783233 15:32655705-32655727 TCCTCTGGCCTCTTTCATAAGGG - Intronic
1125370048 15:38965631-38965653 CTCTCAGGCCTCTTTTGTAAGGG + Intergenic
1125502663 15:40249156-40249178 TCTGGGGGCCTCTTTCATAAAGG + Intronic
1126358732 15:47823556-47823578 TTCTGGGGTCTGTTTTATAAGGG - Intergenic
1126396784 15:48226744-48226766 TACTCTGGTCTCTTTTCTAATGG + Intronic
1126748144 15:51847995-51848017 CTCTAGGGCCTCTTTTATAATGG - Intronic
1126991199 15:54377739-54377761 CCCTCAGGCCTCTTTTGTAAGGG + Intronic
1127266427 15:57365997-57366019 TCCACGTGTCTCTTTTATATAGG - Intergenic
1127321954 15:57855592-57855614 TCCTCAAGCTACTTTTATAAGGG - Intergenic
1127535904 15:59889700-59889722 CTCTAGGGTCTCTTTTATAAAGG - Intergenic
1127815215 15:62602706-62602728 CTCTGGGGCCTCTTTTATAATGG + Intronic
1127972449 15:63972035-63972057 CTCTGGGGTCTCTTTTATAAGGG - Intronic
1127984659 15:64060564-64060586 GTCCCCGGCCTCTTTTATAAGGG + Intronic
1128529427 15:68433622-68433644 TTCTAGGGGCTCTTTTAGAAAGG - Intergenic
1128642182 15:69347792-69347814 CTCTGGGGCCTCTTTTATCAGGG + Intronic
1129133167 15:73519254-73519276 CTCTGGGGTCTCTTTTATAAGGG - Intronic
1129552230 15:76465316-76465338 CTCTGGGGCATCTTTTATAAGGG + Intronic
1129901426 15:79153993-79154015 CCCTCAGGACTCTTTTTTAAGGG + Intergenic
1129902174 15:79159471-79159493 GCGTGGGGCCTTTTTTATAAGGG - Intergenic
1129957637 15:79654141-79654163 TTCTCGGGACTCTCTTATCATGG - Intergenic
1130121231 15:81049308-81049330 CCCTTGGGCCTCTTTTATAAGGG - Intronic
1130162491 15:81415154-81415176 CTCTGGGGTCTCTTTTATAAGGG - Intergenic
1130215900 15:81969258-81969280 TTGTGGGACCTCTTTTATAAGGG + Intergenic
1130230540 15:82093506-82093528 TTCTTGGGCCTTTTTGATAAGGG + Intergenic
1130815687 15:87430023-87430045 CCCTCAGGCTTCTTTCATAAGGG + Intergenic
1131345178 15:91640188-91640210 TCCTGGAGTCTCTTTTATGAGGG + Intergenic
1131382046 15:91972391-91972413 CTCTGGGGCCTCTTTTATAAGGG - Intronic
1131393438 15:92067958-92067980 CCCTGGAGCCTCTTTTTTAAGGG + Intronic
1131533197 15:93212228-93212250 CCCTTGAGTCTCTTTTATAAGGG - Intergenic
1131597386 15:93812431-93812453 CCCTCACACCTCTTTTATAAGGG - Intergenic
1131788141 15:95935001-95935023 CCCTCAGGCCTCTTTTCTAAGGG - Intergenic
1131977080 15:97957715-97957737 CTCTCGGGACTCTTTTGTAAGGG + Intergenic
1132418245 15:101640291-101640313 CTCTGGGGCCTCTTCTATAAGGG - Intronic
1133173161 16:3994155-3994177 CTCTGGGGCCTCTTTTATGAGGG - Intronic
1134214084 16:12302567-12302589 CTCTGGGGCCTTTTTTATAAGGG + Intronic
1134606937 16:15578742-15578764 CCCTTGGGTCTCTTTTATAAGGG + Intronic
1134654511 16:15938012-15938034 GCCTGGGGTCCCTTTTATAAGGG - Intergenic
1134891212 16:17843278-17843300 CTCTGGGTCCTCTTTTATAAGGG + Intergenic
1135596231 16:23745418-23745440 CCCTCGGGTCTTTTTTATAAGGG - Intergenic
1136132300 16:28230960-28230982 CTCTGGGACCTCTTTTATAAGGG - Intergenic
1136183492 16:28571149-28571171 CCCTCAGGCCTCTTTCATAAGGG - Intronic
1136731615 16:32418711-32418733 CCCTTAAGCCTCTTTTATAAAGG + Intergenic
1136930036 16:34410379-34410401 CCCTTGGGCCTCTTTTATAAGGG + Intergenic
1136974538 16:35001426-35001448 CCCTTGGGCCTCTTTTATAAGGG - Intergenic
1137390047 16:48073824-48073846 CCCTTTGGCCTCTTTTATAAGGG + Intergenic
1137763378 16:50958745-50958767 CCCTCAGGCCTCTTTCATGAGGG - Intergenic
1138120107 16:54393899-54393921 CTCTGGGGCCTCTTTTAGAAGGG - Intergenic
1138244321 16:55455357-55455379 CTCTCTGGCCTCTTTTATGAGGG - Intronic
1138388115 16:56650358-56650380 CCCTCAGGCCTCTCTTATTAAGG - Intronic
1138435736 16:56999120-56999142 CTCTTGGGTCTCTTTTATAAGGG + Intronic
1138693222 16:58788209-58788231 CCCTCGAGCCTCTTTTACAAGGG + Intergenic
1138753103 16:59447892-59447914 TTCTAGGGCCTCCTTTATAGGGG + Intergenic
1138827167 16:60334177-60334199 GCCTGGAGTCTCTTTTATAAGGG + Intergenic
1138941228 16:61793077-61793099 CCCTGGGGTCTTTTTTATAAGGG - Intronic
1139054175 16:63161513-63161535 CCCTTATGCCTCTTTTATAAGGG + Intergenic
1139137879 16:64226477-64226499 TGATAGAGCCTCTTTTATAAGGG - Intergenic
1139173320 16:64657689-64657711 CTCTCTGGGCTCTTTTATAATGG - Intergenic
1139336385 16:66234682-66234704 GCCTGGGGCTTCTTTTATATGGG - Intergenic
1139939676 16:70596191-70596213 CTCTGGGGTCTCTTTTATAAGGG + Intronic
1140231086 16:73117796-73117818 CTCTCAGGCCTTTTTTATAAGGG - Intergenic
1140231850 16:73123808-73123830 CCCCCAGGCCTCTTCTATAAGGG - Intergenic
1140334829 16:74095491-74095513 CTCTGGGGCCTCTTTTATAAGGG + Intergenic
1140681923 16:77393565-77393587 CTCTGGGACCTCTTTTATAAGGG - Intronic
1140694036 16:77514111-77514133 CTCTGGAGCCTCTTTTATAAGGG + Intergenic
1140716724 16:77733391-77733413 GTCTCTGGTCTCTTTTATAAGGG + Intronic
1140721395 16:77775536-77775558 CCTTCAGGCCTCTTTTATAAGGG - Intergenic
1140835980 16:78794145-78794167 TTCTGGGGTCACTTTTATAAGGG - Intronic
1141000949 16:80307425-80307447 CCCTTGGGCCTTTTTAATAAGGG + Intergenic
1141030034 16:80579600-80579622 CTCTCAGGCCTATTTTATAAGGG - Intergenic
1141201580 16:81902529-81902551 ATCTTTGGCCTCTTTTATAAGGG + Intronic
1141535858 16:84679199-84679221 CCCTCAGGCCTTTCTTATAAGGG - Intergenic
1141777460 16:86133879-86133901 TTCTCAGGCCTCTTTTACAAGGG - Intergenic
1141906601 16:87030816-87030838 CCCTCAGGCCGCTTTTATAAGGG + Intergenic
1202994775 16_KI270728v1_random:98563-98585 CCCTTAAGCCTCTTTTATAAAGG - Intergenic
1203021462 16_KI270728v1_random:410905-410927 CCCTTAAGCCTCTTTTATAAAGG - Intergenic
1143213163 17:5204337-5204359 GCCTGGGTCCTCTTTCATAAGGG - Intergenic
1143454333 17:7056381-7056403 GCCTCAGGCCTCTTTCATAAGGG - Intergenic
1144001976 17:11063738-11063760 CTCTGGGGCCTCTTTGATAAGGG + Intergenic
1144009845 17:11136533-11136555 CCCTCAGGCCTCTTTTATAAGGG + Intergenic
1144220201 17:13092808-13092830 TCCATGGGCCTCTTTCATAAGGG - Intergenic
1144287296 17:13789280-13789302 CTCTTGAGCCTCTTTTATAAGGG - Intergenic
1144357228 17:14457944-14457966 TCCTCTGTCCTCTTTTCTGATGG + Intergenic
1144457004 17:15426975-15426997 TCCTGGGGCATATTTTATAAGGG - Intergenic
1144720768 17:17468384-17468406 CCCTTGGGCCTCTTTGATAAGGG + Intergenic
1145060513 17:19730298-19730320 CCCTCAGGCCTTTTTTGTAAGGG - Intergenic
1145408930 17:22638355-22638377 CCCTCAGGCATCTTTTATAAAGG - Intergenic
1145837534 17:27965891-27965913 CTCTCAGGCCTCTTTTATAAGGG + Intergenic
1146026589 17:29326835-29326857 CCCTCAGGCCTCCTTTATAAGGG - Intergenic
1146366760 17:32234892-32234914 CCCTTGGGCCTATTTTATAAGGG + Intronic
1146550443 17:33776286-33776308 CCCTGAGGTCTCTTTTATAAGGG - Intronic
1146737702 17:35253167-35253189 CCCTTGGACCTCTTTCATAAGGG + Intronic
1146839997 17:36144909-36144931 CCCTAGGGTTTCTTTTATAAAGG + Intergenic
1146993452 17:37296602-37296624 GCCTGGAGCCTATTTTATAAGGG + Intronic
1147117360 17:38311384-38311406 TCCCCGGGTCTCCTTTATAAGGG - Intronic
1148197332 17:45723549-45723571 CCCTTGGGCCTCTTTTATAAGGG + Intergenic
1148412323 17:47478202-47478224 TCCCCAGGTCTCTTTTATAAGGG + Intergenic
1148427352 17:47610681-47610703 CCCCCGGCTCTCTTTTATAAGGG + Intronic
1148534178 17:48424525-48424547 CTCTGGGACCTCTTTTATAAGGG + Intronic
1148537658 17:48454233-48454255 CCCTTGGGCCTCTTTTACAAAGG + Intergenic
1148971885 17:51490910-51490932 ATCTGGGCCCTCTTTTATAAGGG - Intergenic
1148981694 17:51581933-51581955 CCCTCAAACCTCTTTTATAAGGG - Intergenic
1149060277 17:52413449-52413471 CTCTGGGGCCTCTTTTATAAGGG + Intergenic
1149157525 17:53649424-53649446 TACTCTGGAGTCTTTTATAATGG - Intergenic
1149200612 17:54181884-54181906 TTCTGCGGCCTCTTTTATAAGGG - Intergenic
1149239217 17:54629450-54629472 CACTGGAGCCTCTTTTATAAGGG + Intergenic
1149357395 17:55855552-55855574 CTCTGGGGCTTCTTTTATAAGGG + Intergenic
1149373621 17:56021643-56021665 CCCTTGAGTCTCTTTTATAAAGG - Intergenic
1149565652 17:57639061-57639083 CTCTGGGGTCTCTTTTATAAGGG + Intronic
1149584913 17:57779950-57779972 CTCTGGGGCCTCTTTTCTAAGGG - Intergenic
1149619649 17:58033845-58033867 CCCTCAGGCCTCTTTTAGAAGGG - Intergenic
1149632433 17:58137578-58137600 CTCTGGGGCCTCTTTTATAAGGG + Intergenic
1149881850 17:60299921-60299943 CTCTGGGGCCTCTTTTATTAGGG + Intronic
1149888429 17:60364183-60364205 CTCTCAGGCCTCTTTTAGAAGGG + Intronic
1150151414 17:62811831-62811853 CCCTCAAGCCTCTTTTATAAGGG + Intergenic
1150188672 17:63214644-63214666 TCCTCAGGCCTGTTTTATACAGG + Intronic
1150415363 17:64983847-64983869 CCCTTGGGTCTCTTTTATAAAGG - Intergenic
1150476619 17:65480499-65480521 CGCTTGGGCCTCTTTCATAAGGG - Intergenic
1150603909 17:66675255-66675277 CCCTTGGGCTTCTCTTATAAGGG + Intronic
1150609062 17:66718622-66718644 TTCCAAGGCCTCTTTTATAAGGG + Intronic
1150796309 17:68240189-68240211 CCCTTGGGTCTCTTTCATAAAGG + Intergenic
1151184764 17:72355670-72355692 TCCTGAGGCTTCTTTTATAAGGG + Intergenic
1151239210 17:72744716-72744738 CTCTCGGGCTTCTTTTATATAGG + Intronic
1152061721 17:78081156-78081178 TCCTCAGGCCTCTGTCATTAGGG + Intronic
1152100202 17:78296979-78297001 CCCTCAAGCCTCTTTTATAAGGG - Intergenic
1152156584 17:78637679-78637701 CCCTCGCACCTCTTTTACAAGGG - Intergenic
1153273027 18:3341965-3341987 CCCTGAGGCCTCTTTTATAAGGG + Intergenic
1153646370 18:7199604-7199626 CCCTTGGGCCTCTTTTATAAGGG + Intergenic
1153782077 18:8503872-8503894 TTCTGGGGCCTCTTTTATAAGGG - Intergenic
1153912775 18:9718799-9718821 CCCTGGGGCCTCTTCCATAAGGG + Intronic
1154000534 18:10478587-10478609 CTCTCAGGCCTCTTTTATAAGGG + Intronic
1154013325 18:10594253-10594275 CTCTGGGGCCTCTTTCATAAGGG - Intergenic
1154063710 18:11087081-11087103 CCCTGGAGTCTCTTTTATAAGGG - Intronic
1154152498 18:11917516-11917538 CTCTGGGGCCTCTTTCATAAGGG - Intergenic
1154213416 18:12398396-12398418 CCCTGGGGTCCCTTTTATAAGGG - Intergenic
1154287476 18:13073732-13073754 GCCTCCAGTCTCTTTTATAAGGG + Intronic
1154305826 18:13230107-13230129 TCCTCCGGCCTCTGTTATAAAGG - Intronic
1154392004 18:13945643-13945665 TCCTTGGATCTCATTTATAAGGG - Intergenic
1155079775 18:22397440-22397462 CTCTGGGGCTTCTTTTATAAGGG + Intergenic
1155229728 18:23760907-23760929 TTTCTGGGCCTCTTTTATAAGGG + Intronic
1155666691 18:28317711-28317733 CCCTTGGGCCACTTTTATAAGGG - Intergenic
1155714667 18:28926688-28926710 CTCTGGGGCCTCTTTTGTAAGGG - Intergenic
1156071983 18:33222556-33222578 TCTTGGGGCCTCTCTTATAGGGG + Intronic
1156154882 18:34289500-34289522 CCCTAGGGCCTCTTTCATAAAGG + Intergenic
1156155018 18:34291358-34291380 CCCTAGGGCCTCATTTATAAGGG + Intergenic
1156195515 18:34770018-34770040 GCCTGGGGCCTCTTTTATAAGGG + Intronic
1156226346 18:35112983-35113005 CCCTTAGGCCTGTTTTATAAGGG + Intronic
1156524772 18:37756513-37756535 TTCTTGGGCCTCTTTTATAAGGG - Intergenic
1156594130 18:38526348-38526370 CTCTTGGGCTTCTTTTATAATGG - Intergenic
1156685291 18:39637658-39637680 CCCTCATGCCTCCTTTATAAGGG - Intergenic
1156702822 18:39844708-39844730 ACTTTAGGCCTCTTTTATAAAGG + Intergenic
1156720592 18:40064875-40064897 TCCTCTGACCTCTTTTCTTAGGG + Intergenic
1156786729 18:40923969-40923991 CTCTCAGGCCTTTTTTATAAAGG - Intergenic
1156867453 18:41904674-41904696 CTCTGGGGCCTCTTTTATAAAGG - Intergenic
1156945078 18:42819926-42819948 TGCTCTGGCCTTTTATATAAGGG - Intronic
1157035105 18:43962232-43962254 CTCTGGGGTCTCTTTTATAAGGG - Intergenic
1157090045 18:44626313-44626335 CTCTCAGGCCTCTTTTATAAGGG - Intergenic
1157281531 18:46349367-46349389 CTCTGGGGCCTCTTTTATAACGG + Intronic
1157293511 18:46425993-46426015 CTTTGGGGCCTCTTTTATAAGGG + Intronic
1157331560 18:46707770-46707792 CTCTTGGGCCTCTTTTGTAAGGG - Intronic
1157382989 18:47236580-47236602 CCCTGGGGTTTCTTTTATAAGGG - Intronic
1157517895 18:48323981-48324003 CTCTGGGGCCTCTTTTAAAAAGG - Intronic
1157783724 18:50463571-50463593 CTCTCAGGCCCCTTTTATAAGGG + Intergenic
1157797327 18:50587250-50587272 ACCTTGGGCCTTTCTTATAAGGG - Intronic
1157911395 18:51620342-51620364 TGCTCAAGCCTCTTTTATAAGGG - Intergenic
1157924638 18:51749878-51749900 CCCTTCAGCCTCTTTTATAAGGG + Intergenic
1158172309 18:54613690-54613712 CTCTGGGGTCTCTTTTATAAGGG - Intergenic
1158218244 18:55122703-55122725 TCATCGGGCCAATTTCATAAAGG + Intergenic
1158218521 18:55126135-55126157 TTCTAGGGCCTCTTTTATAAGGG + Intergenic
1158299530 18:56035714-56035736 TCCTGGAATCTCTTTTATAAGGG + Intergenic
1158313049 18:56179378-56179400 TGTCTGGGCCTCTTTTATAAGGG - Intergenic
1158379035 18:56907797-56907819 CCCTCAGGCTTCTTTTGTAAAGG + Intronic
1158390659 18:57042281-57042303 CTCTGGGGCCTCTTTTATGAGGG + Intergenic
1158396217 18:57080112-57080134 TCCTCAGGCCTATATTTTAAAGG - Intergenic
1158555431 18:58471074-58471096 CTCTGGGGCCTTTTTTATAAGGG + Intergenic
1158630193 18:59106815-59106837 TCTGGGGGTCTCTTTTATAAGGG + Intergenic
1158980449 18:62755537-62755559 CTCTCAGGCGTCTTTTATAAGGG - Intronic
1159003946 18:62996464-62996486 CCCTTGGGCCTCTTTTATAAGGG - Intergenic
1159145648 18:64451097-64451119 CCCTTGGGCCTTCTTTATAAGGG + Intergenic
1159147127 18:64468691-64468713 CCCTCAGGCTTCTTTTATAAGGG - Intergenic
1159190838 18:65039980-65040002 TTCTTGGGCCTCTTTTATAAGGG + Intergenic
1159221805 18:65474369-65474391 CCCTTGGACCTCTTTTATAAAGG + Intergenic
1159477724 18:68944534-68944556 CCCTGGGCCCTCTTTGATAAGGG + Intronic
1159680915 18:71350981-71351003 CCCATGGGCCTCTTTTATAGAGG - Intergenic
1159790732 18:72776641-72776663 CTCTTGGGCCTCTTTCATAAGGG + Intronic
1160144948 18:76356170-76356192 CTCTCGGGCCTCTTTGATGAGGG - Intergenic
1160382479 18:78471175-78471197 TCCCCAGGCCTCTTTTCTAAGGG - Intergenic
1160446113 18:78928034-78928056 TGCTCCAGCCTGTTTTATAAGGG - Intergenic
1160449023 18:78949363-78949385 CTCTGGGGCCTCTTTTCTAAGGG - Intergenic
1160687871 19:445294-445316 GTCTGGGGTCTCTTTTATAAGGG - Intronic
1161584815 19:5099731-5099753 CTCTGGGGGCTCTTTTATAAGGG - Intronic
1161813485 19:6484542-6484564 GCCTCAAGCCTCTTTTATAAAGG - Intergenic
1162868167 19:13564770-13564792 CCCTTGAGCCTCTTTTATAAAGG - Intronic
1163184938 19:15631118-15631140 CCCTCAGGTCTCTGTTATAAGGG - Intronic
1163296982 19:16418753-16418775 TTCTGGGGCCTCTTTTATAAGGG - Intronic
1163322933 19:16585249-16585271 TCCTCACGCCTCTCTTCTAAAGG + Intronic
1163531604 19:17853130-17853152 CCTAGGGGCCTCTTTTATAAGGG - Intergenic
1164962246 19:32443451-32443473 CCCTTGTGCCTGTTTTATAATGG - Intronic
1165253988 19:34561975-34561997 GTCTGGGGCCTCTTTTATAAGGG + Intergenic
1165728353 19:38128210-38128232 ACGTCAGGCCTCTTTTATATGGG + Intronic
1166570834 19:43796084-43796106 CTCCAGGGCCTCTTTTATAAGGG + Exonic
1166582903 19:43918462-43918484 CTCTCAGGCCTCTTTTATAAGGG - Intronic
1166595738 19:44048375-44048397 TCCTCAGGTCTCTTTTACAAAGG - Intergenic
1167154826 19:47731717-47731739 TCCCAGGGCCTCTTTTCTAGAGG + Intronic
1168474763 19:56667792-56667814 TTCTGGGTCCTCTTTTATAAGGG - Intronic
1202672143 1_KI270709v1_random:65393-65415 CCATTGAGCCTCTTTTATAAAGG + Intergenic
924979701 2:208206-208228 CTCTGGGGCCTCTTTTATAAGGG - Intergenic
925213619 2:2073045-2073067 CTCTGGGGCCTCTTTCATAAGGG + Intronic
925356388 2:3244583-3244605 CCCTCAGGCCTCTTTGATAAAGG - Intronic
925400737 2:3570459-3570481 TCCAGGGGCCTCCTTCATAAGGG - Intergenic
925468998 2:4138773-4138795 CCCCAGGGCCTCTTATATAAGGG - Intergenic
925533387 2:4889418-4889440 CCTTGGGGCCTCTTTTATAAGGG + Intergenic
925660951 2:6202041-6202063 CCCTGGGACCTCTTTTCTAAGGG + Intergenic
925711141 2:6741461-6741483 TTCTGGGGCCTCTATAATAAGGG - Intergenic
925847028 2:8043684-8043706 CCCTTGGGCCTATTTTATAAGGG - Intergenic
926041895 2:9680118-9680140 CTCTGGGGCCTCTTTTATAAGGG + Intergenic
926060951 2:9804426-9804448 CCCTTGGCCCTCTTTGATAAGGG - Intergenic
926259228 2:11241964-11241986 CCCTTGGGCCTATTTTACAAGGG - Intronic
926472259 2:13275610-13275632 CCCTTGGGCCTCTCTTAGAAAGG + Intergenic
926582853 2:14649894-14649916 TCCTTGGACCTATTTTATAAGGG - Intronic
926788106 2:16539053-16539075 CCCTTGGTCCTTTTTTATAAGGG - Intergenic
927030759 2:19118402-19118424 CCCTTGGGCTTCTCTTATAAGGG - Intergenic
927203880 2:20594868-20594890 TCCTCAGGTCTCTTTTATAAGGG + Intronic
927257840 2:21055904-21055926 CTCTCTGGCATCTTTTATAAGGG + Intergenic
927290829 2:21403316-21403338 CCCTGGGGTCTGTTTTATAAGGG - Intergenic
927292965 2:21422553-21422575 CTCTGGGGCCCCTTTTATAAGGG - Intergenic
927321930 2:21757188-21757210 ACCTCAGGTTTCTTTTATAAGGG + Intergenic
927359780 2:22219471-22219493 TCCTTGGGACTCTTTTATAAGGG - Intergenic
927409457 2:22807602-22807624 TCCTGGGGCCTCTTTTATAAGGG + Intergenic
928136893 2:28694571-28694593 CCCTTGGGCCTCTTTCATAAGGG + Intergenic
928411723 2:31059536-31059558 CTCTTGGGCCTCTCTTATAAGGG - Intronic
928731260 2:34236009-34236031 CCCTTGGGTCTCTTGTATAAGGG + Intergenic
928940793 2:36725464-36725486 CTCTGGGGCCCCTTTTATAAGGG + Intronic
929018921 2:37530930-37530952 TCCTCAATCCTCTTTTATAAGGG - Intergenic
929058671 2:37901118-37901140 TCTCCAGGTCTCTTTTATAAGGG + Intergenic
929224875 2:39502334-39502356 CTCTAGGGTCTCTTTTATAAGGG - Intergenic
929296077 2:40248389-40248411 GTCCAGGGCCTCTTTTATAAGGG - Intronic
929633193 2:43487696-43487718 CACTGGGGCCTCTTTTATAAGGG - Intronic
929698375 2:44140011-44140033 TTCTCAAGCCTCTTTTATAAGGG + Intergenic
929831129 2:45347379-45347401 CCCTCAAGCCTCTTTTATAAGGG + Intergenic
930100441 2:47599076-47599098 CTCTGGGGCCTCTTTTATAAGGG - Intergenic
930163230 2:48178931-48178953 CCCTCAGGCCTCTTTTGTAAGGG + Intergenic
930174480 2:48287880-48287902 GCGTGAGGCCTCTTTTATAAGGG + Intergenic
930237053 2:48898498-48898520 ACGTTGGGCCTCTTTCATAAAGG - Intergenic
930337130 2:50062296-50062318 TTCTGGAGCCTCTTTTATAAGGG - Intronic
930476401 2:51888031-51888053 TGCTGGAACCTCTTTTATAAGGG + Intergenic
930547114 2:52782368-52782390 TCCTCAGGTCTCTTTTCTAAGGG - Intergenic
930618881 2:53624112-53624134 CCCCAGGGCTTCTTTTATAAGGG - Intronic
930620644 2:53639810-53639832 TTCTCAGGCCTCTTTTGTAAGGG - Intronic
930683679 2:54285137-54285159 CCTTGGGCCCTCTTTTATAAGGG + Intronic
931117308 2:59178898-59178920 CCCTGGGGTCTCTTTCATAAGGG + Intergenic
931139560 2:59442338-59442360 TTCTTAGTCCTCTTTTATAAGGG - Intergenic
931146623 2:59526641-59526663 CTCTGGGGCCTCTTTTACAAGGG - Intergenic
931260624 2:60615281-60615303 CCCTGGGGCCTCTTTTATAAGGG + Intergenic
931685504 2:64788911-64788933 CTCTCTGGCCTCTTTTATAAGGG + Intergenic
931852386 2:66264869-66264891 CCCCCAGGCCTATTTTATAAAGG - Intergenic
931987203 2:67753731-67753753 CCCTAGTGCCTCTTTTATAAGGG - Intergenic
931995744 2:67837681-67837703 CTCTGGGGTCTCTTTTATAAGGG + Intergenic
932001147 2:67886254-67886276 CTCTCAGGCCTCTTTTATAAGGG + Intergenic
932078178 2:68686172-68686194 TCCTCAAGCCTCTTTTATAAGGG + Intronic
932837670 2:75052222-75052244 TTCTCAGGCCTATTTTATAAGGG - Intronic
932926936 2:75987441-75987463 CTCTGGAGCCTCTTTTATAAAGG + Intergenic
932978704 2:76636082-76636104 CTCTCAGGCCTCTTTTATACAGG + Intergenic
933180659 2:79222846-79222868 GTCTGGGGCCTCTTTCATAAGGG - Intronic
933238372 2:79890918-79890940 CCCTCAAGCCTCTTTTATAAGGG + Intronic
933270548 2:80228371-80228393 CCCTCAGGCCTCTTTTACATGGG + Intronic
933285997 2:80385326-80385348 CTCTGGGGTCTCTTTTATAAGGG - Intronic
933863535 2:86495082-86495104 TGCTTGAGCCTCTTTGATAAGGG - Intergenic
933869736 2:86554061-86554083 ACCTTGGGCCTATTTTATAAGGG - Intronic
933993764 2:87652495-87652517 CTCTGGGGCCTCTTTTATAAGGG + Intergenic
934314107 2:91900569-91900591 CCCTTAAGCCTCTTTTATAAAGG - Intergenic
934694296 2:96387905-96387927 CCCTCAGGCCTCTTTTATAAGGG - Intergenic
934992921 2:98933999-98934021 TCCTTGCGCTTCTTTTATAAGGG + Intronic
935099426 2:99978739-99978761 CTCTGGGGTCTCTTTTATAAGGG - Intronic
935179593 2:100677600-100677622 CACTGCGGCCTCTTTTATAAGGG + Intergenic
935194312 2:100803000-100803022 CTCTCAGGCCTCTTTTATAAGGG + Intergenic
935623206 2:105146427-105146449 CCCTTGGGCCTCTTTTATAAGGG + Intergenic
935626471 2:105175930-105175952 TCCAGGGGCCTCTTTTATGAAGG - Intergenic
935643207 2:105309887-105309909 CTCTGGGGCCTCTTTAATAAGGG - Intronic
935813444 2:106823866-106823888 GTCTGGGGTCTCTTTTATAAGGG + Intronic
935851441 2:107224407-107224429 CTCTACGGCCTCTTTTATAAGGG + Intergenic
935978883 2:108607113-108607135 CCCTTGGGCCTATTTTATAAGGG - Intronic
936119733 2:109731086-109731108 CCAAGGGGCCTCTTTTATAAGGG + Intergenic
936300099 2:111298388-111298410 CTCTGGGGCCTCTTTTATAAGGG - Intergenic
936346022 2:111675840-111675862 CTCTGGGGCCTCTTTTATAAAGG - Intergenic
936395640 2:112126458-112126480 CTCTTGGGCCTCTTTGATAAGGG - Intergenic
936406812 2:112212197-112212219 CCCCAGGGCCTCTTTTATAAGGG + Exonic
936561886 2:113546444-113546466 CTCTGGGGCCTCTTTTATAAGGG + Intergenic
936656689 2:114496544-114496566 CTCTCGGGCCTCTTTTATGAGGG + Intronic
936687807 2:114848990-114849012 ATCTGGGGCCTCTTTTATAAGGG + Intronic
936707127 2:115088118-115088140 TTCTCCAGCCTCTTTTATAAGGG + Intronic
937358605 2:121213576-121213598 CCCTAGGGCCTCTTTTACAAGGG - Intergenic
937490815 2:122365494-122365516 CTCTGGGGCCTCTCTTATAAGGG + Intergenic
937589883 2:123600138-123600160 TCTTGGGGTCTCTTTTGTAAGGG - Intergenic
937687356 2:124712910-124712932 CCTTCAGGCCTCTTTTATAAAGG + Intronic
937688966 2:124732466-124732488 CCCTTGGGCCTGTTTTCTAAGGG - Intronic
937847886 2:126601529-126601551 CTCTGGGGCCTCTTTTATAAGGG + Intergenic
937933929 2:127227321-127227343 TTCTGGGGCCTTTTTAATAAAGG + Intergenic
937933963 2:127227501-127227523 TTCTGGGGCCTTTTTAATAAGGG + Intergenic
938081079 2:128370488-128370510 GCCTCGAGCCTCCTGTATAAAGG - Intergenic
938109823 2:128556439-128556461 CTCTGTGGCCTCTTTTATAAGGG - Intergenic
938241314 2:129744448-129744470 TTCTGGGGCCTCTTTTAAAAGGG + Intergenic
938568575 2:132542008-132542030 CACTGGGGCCTCTTCTATAAGGG + Intronic
938598488 2:132812906-132812928 TTCTGAGGACTCTTTTATAAGGG + Intronic
938683838 2:133717851-133717873 CTCTCAGGCCTCGTTTATAAGGG + Intergenic
938809554 2:134840545-134840567 TCCTTGGGCTTACTTTATAAGGG - Intronic
938928674 2:136066990-136067012 CTCTCAGGCCTCTTTTATAAGGG - Intergenic
938933807 2:136111283-136111305 TTCTGGGATCTCTTTTATAAAGG + Intergenic
938945881 2:136211667-136211689 CTCTGGGGCCTCTTTTAAAAGGG + Intergenic
938989761 2:136615831-136615853 TGCTTTGGTCTCTTTTATAAGGG - Intergenic
939077181 2:137617856-137617878 CCCTTAGGCCTCCTTTATAAAGG + Intronic
939092495 2:137795525-137795547 CTCTAGGGTCTCTTTTATAAGGG + Intergenic
939450228 2:142364298-142364320 CACTGGGGCCTCTTTTACAAGGG + Intergenic
939555632 2:143669644-143669666 CTCTGGGGCCTCTTTCATAAAGG + Intronic
939607296 2:144268446-144268468 TTCTTTGGCATCTTTTATAAGGG - Intronic
939614779 2:144350124-144350146 GCCTTGTGCTTCTTTTATAAAGG + Intergenic
939770487 2:146309638-146309660 CCCTCATGCCTCTTTTGTAAGGG + Intergenic
939929051 2:148209361-148209383 TCCTTGGGCCACTTTTATAGTGG - Intronic
940115370 2:150202816-150202838 CCCTTGGGCTTCTTTGATAAGGG - Intergenic
940116301 2:150212393-150212415 CCCTTGGGCTTCTTTTACAAGGG - Intergenic
940170496 2:150824939-150824961 CCCTCTGGCCTCTTTTATAAGGG + Intergenic
940368408 2:152874541-152874563 CTCTGGGGCCTCTTTTATGAGGG + Intergenic
940413432 2:153392892-153392914 CCCTTGGACCTCTTTTATAAGGG - Intergenic
940521625 2:154757833-154757855 CCCTGGAACCTCTTTTATAAGGG + Intronic
941135065 2:161705662-161705684 CTCTGGGGCCTCTTTTATAAGGG - Intronic
941529593 2:166650389-166650411 CCCTTGAGCCTCTTTTATAAGGG - Intergenic
941666752 2:168249993-168250015 CCTTCCGGCCTCATTTATAAGGG - Intergenic
941722931 2:168831261-168831283 TCTTGGGGTCTCTTTTATAAGGG + Intronic
941723509 2:168837072-168837094 CCCTGGGGCCTCTTCTATAAGGG + Intronic
941907617 2:170732128-170732150 CCTTGGGGTCTCTTTTATAAGGG - Intergenic
942225074 2:173807847-173807869 CTCTTGGGTCTCTTTTATAATGG + Intergenic
942466005 2:176208281-176208303 TTCTCAGACCTCTTTTAAAAGGG + Intergenic
942513077 2:176723247-176723269 CCCTCAAGCCTCTTTTATAAGGG - Intergenic
942620859 2:177844318-177844340 CTCTGGGGCCTCTTTTATAAAGG + Intronic
942712062 2:178847849-178847871 CTCTCAGGCCTCTTTTCTAAGGG - Intronic
942882611 2:180880228-180880250 CCCTGGGGCCTCATTTATAAGGG + Intergenic
943101947 2:183497627-183497649 CTCTGGGGCCTCTTTTATAAGGG - Intergenic
943115943 2:183670486-183670508 CTCTGGGGCTTCTTTTATAAGGG - Intergenic
943195619 2:184744451-184744473 CTCTAGGGCCTCTTTTATAAGGG - Intronic
943580947 2:189683037-189683059 CTCTGGGGCCTCTTTTATAAGGG - Intronic
943660095 2:190550340-190550362 ACCTGGTGCATCTTTTATAAGGG + Intergenic
943667566 2:190626128-190626150 TCTCTGGGTCTCTTTTATAAGGG + Intergenic
943678799 2:190745978-190746000 CCCTCGTACTTCTTTTATAAGGG - Intergenic
943753536 2:191535081-191535103 TCCCAGCACCTCTTTTATAAAGG - Intergenic
943781509 2:191829263-191829285 CTCTAGGGCATCTTTTATAAAGG - Intergenic
943812913 2:192211942-192211964 CTGTAGGGCCTCTTTTATAAAGG + Intergenic
943818905 2:192293193-192293215 TTCTGGGGTCTTTTTTATAAGGG + Intergenic
943990247 2:194680521-194680543 CTCTGGGTCCTCTTTTATAAGGG + Intergenic
944087924 2:195870671-195870693 CTCTCTGGCCTCTTTTATAAAGG - Intronic
944127058 2:196306087-196306109 CTCTCAGGCTTCTTTTATAAGGG - Intronic
944171343 2:196782160-196782182 TCTTCAGACCTCTTTTACAAGGG - Intronic
944214757 2:197243746-197243768 CCCTTGGGCCTCTTTCATAAGGG + Intronic
944217574 2:197271298-197271320 CCCTCAGGCCTGTTTTATAAGGG - Intronic
944636487 2:201680427-201680449 CCCTCAGGCCTCTTTTATAAGGG + Intronic
944637927 2:201692626-201692648 TCTTGGGGTCTCTTGTATAAGGG - Intronic
944667705 2:201970914-201970936 CCCTCAGGCCTCTTTTGTAAGGG - Intergenic
944670845 2:201993202-201993224 CTCTTGGGCCTCTTTTATGAAGG - Intergenic
944693075 2:202175535-202175557 CTCTGGGGCCTCTTTTGTAAAGG - Intronic
944814275 2:203359724-203359746 CCCTTGGACCTCTTTTATAAGGG + Intronic
944900925 2:204215266-204215288 CTCTCAGGACTCTTTTATAAGGG + Intergenic
944901250 2:204218873-204218895 TTCTTGGGTCTCCTTTATAAAGG + Intergenic
945319499 2:208405811-208405833 TTCTGAGGTCTCTTTTATAAGGG - Intronic
945524769 2:210874498-210874520 CTCTGGGGTCTCTTTTATAAAGG + Intergenic
945645411 2:212485853-212485875 CTCTGGGGCCTCTTTTATAAAGG + Intronic
945696075 2:213106297-213106319 TCCTTGCGCCTGTTTTTTAAAGG + Intronic
946045893 2:216820698-216820720 CTCTGTGGCCTCTTTTATAAAGG - Intergenic
946096286 2:217277257-217277279 CCCTGGGGCCTCTTTTATTAAGG + Intergenic
946120513 2:217508967-217508989 CTCTGGGGTCTCTTTTATAAGGG - Intronic
946331529 2:219011983-219012005 TCCACAGGCCTCTTTTATAAGGG - Intronic
946443142 2:219713942-219713964 TTCTGGGGTCTTTTTTATAAGGG - Intergenic
946481462 2:220060714-220060736 CCCTGGAGCCTCCTTTATAAGGG - Intergenic
946521685 2:220471894-220471916 TTCTGGGGTCTCTTTTATAAAGG - Intergenic
946630962 2:221668605-221668627 CTCTGGGGACTCTTTTATAAGGG + Intergenic
946796793 2:223362852-223362874 TTGTGGGGCCTCTTTTATCATGG - Intergenic
946866732 2:224047623-224047645 CTCTTGGGTCTCTTTTATAAGGG - Intergenic
946939981 2:224760446-224760468 TCCTTGAATCTCTTTTATAAGGG - Intergenic
947041238 2:225923045-225923067 CCCTTGGGCCTCTTTTATAAAGG - Intergenic
947158413 2:227186964-227186986 CCCTTGGGACTCTTTAATAAGGG + Intronic
947407640 2:229796882-229796904 TCCCCTGCCCTCTTTTTTAAGGG - Intronic
947883524 2:233543596-233543618 CCTTCAGGCCTTTTTTATAAAGG - Intronic
947985176 2:234441481-234441503 CTCTCTGGCCTCTTTTCTAAAGG + Intergenic
948146737 2:235713908-235713930 TTCTCAGGCCTCTTCTACAAGGG + Intronic
948398243 2:237663399-237663421 TCCCCGGGTTTGTTTTATAAGGG - Intronic
948512462 2:238477913-238477935 ATCTGGGGCCTCTTTTATAAGGG - Intergenic
948582961 2:239000361-239000383 CTCTGGGGCCTCTTTTTTAAGGG + Intergenic
948606128 2:239136706-239136728 TCCTTGGCCCACTTTTATACTGG - Intronic
1168788410 20:559292-559314 CTCTGGGGCCTCTTTTATAAGGG - Intergenic
1168820076 20:766840-766862 TCCTTGGCCCTCTTCTATATGGG - Intronic
1168844785 20:936568-936590 CTCTGGGGCCTCTTTCATAAGGG + Intergenic
1168865356 20:1081337-1081359 CCCTGGGACCTCTTTCATAAGGG - Intergenic
1168884161 20:1233679-1233701 TCCTGGGGCCTCTTTTATAAAGG + Intronic
1168897023 20:1330839-1330861 TCCTCCTCCCTCTTCTATAAAGG - Intronic
1169331406 20:4719337-4719359 CTCTCAGGCCTCTATTATAAGGG + Intergenic
1169386935 20:5157710-5157732 CTCTGGGACCTCTTTTATAAGGG + Intronic
1169594566 20:7183245-7183267 CTCTGGGGCCTCTTTTATAAGGG - Intergenic
1169701958 20:8456842-8456864 CCCTGGGACCTCTTTTATAAGGG + Intronic
1169936184 20:10885931-10885953 TTCCTGGGCCTCTTTTATACAGG - Intergenic
1170020086 20:11827763-11827785 CTCTGGGGCCTCTTTTTTAAGGG - Intergenic
1170022368 20:11850505-11850527 CTCTTGGGCCTCTTTTATAAGGG - Intergenic
1170075087 20:12410446-12410468 CCCTGGGGCCTCTCTTATAAGGG - Intergenic
1170443915 20:16405525-16405547 ACCTCGGGCATCCCTTATAAAGG + Intronic
1170460073 20:16569040-16569062 CCCTTGGGCCTGTTTTATAAGGG - Intronic
1170542262 20:17401407-17401429 CCCTCAGGCCTCTTTTATAAGGG + Intronic
1170562035 20:17566949-17566971 GCCTAGGACCTCTTTTATAAGGG + Intronic
1170743858 20:19081084-19081106 GCCCAGGGCCTCTTTTATGAGGG + Intergenic
1170828376 20:19817382-19817404 CACTCAGGCCTCTTTTATAAGGG + Intergenic
1171295053 20:24010094-24010116 CTCTGGGGCCTCTTTTATTAGGG - Intergenic
1172168405 20:32913343-32913365 CTCTGGGGCCTCCTTTATAAGGG + Intronic
1172168833 20:32916556-32916578 GCCTAGGACCTCTTTTATAAAGG + Intronic
1172352193 20:34251780-34251802 CCCTTGGGCCTCTTTTGTAAAGG - Intronic
1172784426 20:37457653-37457675 TCCTCAGGCCCCTTTTACAACGG + Intergenic
1173148141 20:40543192-40543214 CCCTCAGGCTTCATTTATAAGGG - Intergenic
1173364521 20:42372749-42372771 CTCTGGGGTCTCTTTTATAAGGG - Intronic
1173395308 20:42673641-42673663 TTTTGGGGCCTCTTTTGTAAGGG + Intronic
1173419449 20:42887923-42887945 GCCTAGGGCATCTTTTATAAGGG - Intronic
1173957571 20:47046184-47046206 TTCTGGGGCTTCTTTTATAAGGG + Intronic
1174184100 20:48693415-48693437 CTCTGGGGCCTCTTTTATAAGGG - Intronic
1174517763 20:51106268-51106290 CTCTCAGGCCTCATTTATAAAGG - Intergenic
1174602264 20:51734282-51734304 CCCTCCTGCCTCTTTTATAAGGG + Intronic
1174958981 20:55133929-55133951 TCCTCCAGCCTCTTTTATAAAGG + Intergenic
1176909943 21:14552460-14552482 CTCTCTAGCCTCTTTTATAAGGG - Intronic
1176937282 21:14882015-14882037 CTCTCAGGGCTCTTTTATAAGGG + Intergenic
1176950661 21:15042601-15042623 TATTGGGACCTCTTTTATAAGGG - Intronic
1176960822 21:15157177-15157199 TCTTCTGGCCTCTTGTATACTGG - Intergenic
1176993200 21:15522553-15522575 CCCTTGGGCCTCTTTTTTTAAGG + Intergenic
1177007135 21:15687328-15687350 TTCTCGAGCCTCTTTTGTATGGG - Intergenic
1177083557 21:16673694-16673716 CCCTTGGGCCTCTTTTATAAGGG + Intergenic
1177197047 21:17914302-17914324 CTCTAGGGCCTCTTTTATAAGGG + Intronic
1177472380 21:21575746-21575768 CTCTGGGGCCTCTTTTATAAGGG + Intergenic
1177491022 21:21826177-21826199 CCCTTGGGCCTATCTTATAAAGG - Intergenic
1177502635 21:21977945-21977967 TCCTGGGGCCTCTTATATAAGGG + Intergenic
1177636278 21:23790678-23790700 TCCTTGGGCATCTTTTACAAGGG - Intergenic
1177802363 21:25840406-25840428 CTCTCAGGCCCCTTTTATAAGGG + Intergenic
1177815728 21:25974457-25974479 CTCTGGGCCCTCTTTTATAAGGG - Intronic
1177898516 21:26884215-26884237 CTCTGGGGTCTCTTTTATAAGGG - Intergenic
1177930669 21:27279037-27279059 CCCTTGGGCCCCATTTATAAGGG + Intergenic
1178033186 21:28551632-28551654 GTCTCAGACCTCTTTTATAAGGG + Intergenic
1178036278 21:28586842-28586864 CCCTTGGGCCTCTTTTATAAGGG + Intergenic
1178136878 21:29637563-29637585 CTCAAGGGCCTCTTTTATAAGGG - Intronic
1178380235 21:32101476-32101498 TCCTGGGGCCTCATTTTAAAGGG - Intergenic
1178482065 21:32988089-32988111 TCCTGGGGTCCCTTTTAAAAGGG + Intergenic
1178694032 21:34777719-34777741 CCCTTGGGCCTCGTTTGTAAGGG - Intergenic
1178745974 21:35250721-35250743 TTCTTGGGCAGCTTTTATAAGGG - Intronic
1178821524 21:35979469-35979491 TCCTCAGTTCTCTTTTATAAGGG - Intronic
1178969761 21:37162929-37162951 CTCTGGGGCCTCTTTTATAAGGG + Intronic
1179149817 21:38800182-38800204 TCCTCAGGCCTGATTCATAAGGG - Intergenic
1179161153 21:38900485-38900507 CTCTCAGGCCTCTTTTATAAGGG - Intergenic
1179219596 21:39394685-39394707 CCTTTAGGCCTCTTTTATAAGGG + Intronic
1179284866 21:39968591-39968613 ACTTTGGGCCTATTTTATAAGGG + Intergenic
1179308405 21:40175572-40175594 GCCTTGGGCCTATTGTATAAGGG + Intronic
1179363299 21:40733061-40733083 ACCTGGGGCCTCTTTTGTATAGG - Intronic
1179368055 21:40777193-40777215 CCCTTGGGCTTCTTTTATAAGGG + Intronic
1179447933 21:41446356-41446378 TCCTCGGACCTCTTTTTTACAGG + Intronic
1179533942 21:42039355-42039377 TTCTAGGGTCCCTTTTATAAGGG + Intergenic
1180540865 22:16446434-16446456 CCCTTAAGCCTCTTTTATAAAGG - Intergenic
1180927291 22:19565031-19565053 TCCTTTGGGCCCTTTTATAAGGG + Intergenic
1181591288 22:23886556-23886578 CTCTGGGGTCTCTTTTATAAGGG + Intronic
1181886329 22:26025001-26025023 CTCTGGGGCCTCTTTTATAAGGG + Intronic
1182543515 22:31058840-31058862 CCCTCAGGCTTCTTTTATAAGGG + Intergenic
1182757213 22:32689873-32689895 CTCTTGGGCCTCTTTTATAAGGG - Intronic
1182843863 22:33414800-33414822 CTCTGGGGTCTCTTTTATAAGGG - Intronic
1182853451 22:33496423-33496445 TCTCTGTGCCTCTTTTATAAGGG - Intronic
1183039152 22:35163342-35163364 CCCTCGTGTTTCTTTTATAAGGG + Intergenic
1183044641 22:35210138-35210160 CACTTGAGCCTCTTTTATAAAGG + Intergenic
1183112496 22:35660756-35660778 CCCCTGGGCCTCTTTTATAAAGG + Exonic
1183752740 22:39731253-39731275 TTCTGGGGTCTCCTTTATAAAGG - Intergenic
1184622588 22:45693503-45693525 TCTCTGGGCCCCTTTTATAAGGG + Intronic
1184930099 22:47674595-47674617 CTCTCAGGCCTCTTTTATGAAGG + Intergenic
1184956377 22:47889494-47889516 CTCTCAGGCCTCTGTTATAAGGG + Intergenic
1185294906 22:50048393-50048415 TTCTGGGGCCTCTTTTATAAGGG - Intronic
949237842 3:1832097-1832119 CCCTTAGGCCTCTTTTATAAGGG + Intergenic
949329431 3:2905447-2905469 CTCTTGGGCCTCTTTTATAAGGG + Intronic
949432323 3:3991165-3991187 CTCTGGGGCCTCTTTTACAAGGG + Intronic
949497822 3:4649841-4649863 TTCTGGGGTCTGTTTTATAAGGG + Intronic
949525216 3:4896632-4896654 TCCCTTGGCCTCTTTCATAAGGG + Intergenic
949591157 3:5495792-5495814 CCCTTGGGCCTATTTTATAAGGG - Intergenic
949833842 3:8246494-8246516 CTCTCAGGTCTCTTTTATAAGGG - Intergenic
949852571 3:8433720-8433742 CTCTCAGGCCTCTTTTAAAAGGG + Intergenic
949957072 3:9277936-9277958 AGCTTGGGCCTCTTTTATAAAGG - Intronic
950030246 3:9847284-9847306 CTCTGGGGCCTCTTGTATAAGGG - Intronic
950157248 3:10730928-10730950 CTCTGGGGCCTCTCTTATAAGGG + Intergenic
950629019 3:14268918-14268940 CTCTGGGGCCTCTTGTATAAGGG - Intergenic
950688881 3:14639831-14639853 CTCTGGGGCCTCTTTCATAAGGG + Intergenic
950726375 3:14919822-14919844 CTCTGGGGCCTCTTGTATAAGGG + Intronic
950912705 3:16611528-16611550 CCCTCAGTCCTCTTTTATAAGGG - Intronic
950948774 3:16977938-16977960 CCTTCATGCCTCTTTTATAAGGG + Intronic
951103935 3:18721035-18721057 GGCTGGGGCCTGTTTTATAAGGG + Intergenic
951108215 3:18770319-18770341 CTCTCAGGCCTCTTTTTTAAGGG + Intergenic
951320263 3:21235950-21235972 CCTTTGGACCTCTTTTATAATGG - Intergenic
951462171 3:22963217-22963239 CTCTGGGGCCTCTTTTGTAAGGG - Intergenic
951690463 3:25390190-25390212 CTTTCAGGCCTCTTTTATAAGGG - Intronic
951752711 3:26055164-26055186 GGGTAGGGCCTCTTTTATAAAGG + Intergenic
951760343 3:26140658-26140680 CTCTCAGGCCTCTTTTATAAGGG - Intergenic
951811552 3:26706157-26706179 CTCTGGGGCCTCTTTTATAAGGG + Intronic
951851473 3:27145902-27145924 CCCTCTGGCCTCTTTTATAATGG - Intronic
951911537 3:27755344-27755366 CCCTCAGGCTTCTTTTAAAAGGG - Intergenic
951913992 3:27780399-27780421 TTCTGAGGTCTCTTTTATAAAGG - Intergenic
952465269 3:33577794-33577816 TTCTGGGGTCTCTTTTGTAAAGG - Intronic
952509814 3:34041800-34041822 CCCTTAGGCTTCTTTTATAAGGG - Intergenic
952510383 3:34047722-34047744 CCCTCAAGCCTCTTTTAAAAGGG - Intergenic
952686804 3:36159422-36159444 CCCTTGGGCCTTTTTTATAAGGG + Intergenic
952748259 3:36802486-36802508 CTCTGGGGCCTCTTTCATAAAGG - Intergenic
952814848 3:37438362-37438384 CCCTTGGGCTTCTTTCATAAGGG + Intergenic
953239566 3:41136663-41136685 CCCTTGGGCCTATTTTATAAGGG - Intergenic
953242332 3:41160628-41160650 TTCTGAGGCCTCTTTTATAAAGG - Intergenic
953299509 3:41758079-41758101 CACTCAGGCCTCTTTTATAAGGG - Intronic
953367910 3:42362606-42362628 CTCTGGGGCCTCTTTTATAAGGG + Intergenic
953549584 3:43891075-43891097 CCCTCAAGCCTCTTTTATAAGGG - Intergenic
953747778 3:45588133-45588155 CCCTCAGGCCTCTTTTTTAATGG - Intronic
954483818 3:50827434-50827456 CTCTGGGGTCTCTTTTATAAGGG + Intronic
954504766 3:51059221-51059243 GCCTTGGGCCTATTTTATAAGGG + Intronic
954895212 3:53969446-53969468 CTCTCAGGCCTCTTTCATAAGGG + Intergenic
955417123 3:58702910-58702932 TTCTTGGGCCTCTTTTGTAAGGG + Intergenic
955505207 3:59625816-59625838 TTCTAGGGCCTCTTTTATACAGG + Intergenic
955633421 3:60999956-60999978 CCCTGGGGCCTCTTTTGTATAGG + Intronic
955940805 3:64145855-64145877 CCCTTGGACCTCTTTTATAAGGG + Intronic
955941216 3:64148702-64148724 CCCTTGGGCCTCTGTTATAAGGG - Intronic
955965310 3:64382981-64383003 CCCTCCAGTCTCTTTTATAAAGG - Intronic
956040942 3:65144164-65144186 CCCTCAAGCCTCTTTTATAAGGG - Intergenic
956057475 3:65315544-65315566 CCATCCGGCCTCTTTTATAAGGG + Intergenic
956417981 3:69052949-69052971 CCCTTGGGCCTCTCTTATAAGGG - Intergenic
956934012 3:74079150-74079172 CTCTGGGGCCTCTTTTACAAGGG - Intergenic
957310310 3:78510372-78510394 CCCTTGGGCCTATTGTATAAAGG + Intergenic
957363422 3:79188932-79188954 CCCTTGGTCCTCTTTTATAAAGG - Intronic
957404678 3:79762271-79762293 TACTCAGACCTCTTTTATAAGGG + Intronic
957450740 3:80378674-80378696 ATCTGGGGCTTCTTTTATAAGGG + Intergenic
957463111 3:80548184-80548206 CTCTGGGGCTTCTTTTATAAGGG + Intergenic
957510271 3:81179261-81179283 CTCTGGGGCCTCTTTCATAAAGG - Intergenic
957511476 3:81194107-81194129 CCCTCAGGCCTCCTTTATAAAGG + Intergenic
957553716 3:81739057-81739079 TCTTCGTGCCTCTCTTATAAAGG + Intronic
957587402 3:82149780-82149802 TGCTTGGGCCTATTTTATAGGGG + Intergenic
957730831 3:84132892-84132914 TTCTGGAGCTTCTTTTATAAGGG - Intergenic
957958696 3:87222794-87222816 TCCTCATACCTCTTTTGTAAGGG - Intergenic
958100099 3:88998460-88998482 CTCCTGGGCCTCTTTTATAAGGG - Intergenic
958124286 3:89335315-89335337 CTCTGGGACCTCTTTTATAAGGG + Intronic
958150361 3:89685325-89685347 CTCTGGGGTCTCTTTTATAAGGG + Intergenic
958156639 3:89763020-89763042 CTCTGGGGCCTCTTCTATAAGGG - Intergenic
958456495 3:94338213-94338235 TTCTTGGATCTCTTTTATAAAGG - Intergenic
958567103 3:95828457-95828479 CTCTGGGGTCTCTTTTATAAGGG - Intergenic
958658578 3:97035978-97036000 TTCTGGAGCCTCTTTTATGAGGG - Intronic
958846511 3:99271303-99271325 TCCTCGAGCCTCTTTTGTGTAGG - Intergenic
959110636 3:102118218-102118240 CTCCTGGGCCTCTTTTATAAGGG + Intronic
959311938 3:104749485-104749507 TCCCTGGGTCTCTTTTATAAGGG - Intergenic
959332328 3:105021968-105021990 TTTTGGGGACTCTTTTATAAGGG - Intergenic
959410761 3:106018169-106018191 CCTTCAGGCCTCTTTCATAAGGG - Intergenic
959528370 3:107403171-107403193 TCTCTGGGCCTGTTTTATAAGGG - Intergenic
959547651 3:107615496-107615518 CTCTGGGGCCTCTTTTATAAGGG + Intronic
959569312 3:107866365-107866387 CCATTGGGCCGCTTTTATAAGGG - Intergenic
959633713 3:108537509-108537531 CCCTCTAGCCTCTTTTATATGGG - Intergenic
959653045 3:108770714-108770736 TCCTCAAGCCTCTTTTATAAGGG + Intergenic
959760885 3:109963454-109963476 CCCTGGGGCCTCTTTTAATAAGG + Intergenic
959942971 3:112098809-112098831 TTTCTGGGCCTCTTTTATAAGGG + Intronic
960084254 3:113573677-113573699 TTCTGGGGACTCTTTCATAAAGG - Intronic
960134481 3:114091563-114091585 CCCTGGAGTCTCTTTTATAAGGG + Intergenic
960523300 3:118680819-118680841 CTCTGGAGCCTCTTTTATAAGGG - Intergenic
960555149 3:119019971-119019993 CCCTGGGGCTTCTTTTATAATGG - Intronic
960653166 3:119974420-119974442 TTCTGGGGCATCTTTTATAAGGG - Intronic
960695655 3:120393813-120393835 CCCTTAGGCCTCTTTTATAAGGG - Exonic
960777648 3:121277243-121277265 CTCTAGGGCCTCTTTTATAAGGG + Intronic
960808065 3:121603111-121603133 CTCTTGGGCTTCTTTTATAAGGG + Intronic
960823193 3:121756307-121756329 CTCTGGGGTCTCTTTTATAAGGG - Intergenic
961360310 3:126363149-126363171 ATCTGGGGCCTCCTTTATAAGGG - Intergenic
961497704 3:127306417-127306439 GTCTGGGGCCTCTTTCATAAGGG - Intergenic
961499200 3:127319253-127319275 CTCCCTGGCCTCTTTTATAAAGG - Intergenic
961506977 3:127376530-127376552 CCTTCAGGCCTCTTTTATAAGGG + Intergenic
961902505 3:130226702-130226724 CCTTCAAGCCTCTTTTATAAGGG + Intergenic
961927165 3:130493243-130493265 CCCTCAGGCCTCTTTTATAAGGG - Intergenic
961960734 3:130852259-130852281 TCTTCAGGCCTCATTTATTATGG + Intronic
962107574 3:132408007-132408029 CTCTCAGGCCTCTTTTACAAAGG - Intergenic
962250930 3:133835755-133835777 CCCTCGGGCCTCATTCATAAGGG - Intronic
962252571 3:133845325-133845347 CCCTTAAGCCTCTTTTATAAGGG - Intronic
962607625 3:137045604-137045626 CCCTTAGGCCTCTTTTATAAGGG + Intergenic
962687918 3:137865322-137865344 CTCTCAGGCCTCTTTTGTAAGGG + Intergenic
962948020 3:140190061-140190083 CTCTAGGGCCTGTTTTATAAGGG + Intronic
962956500 3:140271591-140271613 CCCTCAGGCCTCTTTCATAAGGG + Intronic
963052454 3:141153633-141153655 CCCTAGGGCCTCTTTTATAAGGG + Intergenic
963635642 3:147792097-147792119 TTCTTGGGCCTTTTTTGTAAGGG + Intergenic
963639391 3:147839662-147839684 TCCTCGGGCCTCGTTTATAAAGG + Intergenic
963681975 3:148389420-148389442 CACTTAGGCCTCTTTTATAAGGG + Intergenic
963712995 3:148768798-148768820 CTCTGGGGCCTCTTTGATAAGGG - Intergenic
963896788 3:150695003-150695025 TTCTGGGCCCTCTTTTACAAGGG + Intronic
964307846 3:155360011-155360033 CCCTCTGGCCTCTTTTATAATGG + Intergenic
964359338 3:155878073-155878095 CCCTAGGGCCTCTTTTATAAGGG + Intronic
964492397 3:157250730-157250752 CCTTTTGGCCTCTTTTATAAGGG + Intergenic
964679340 3:159320264-159320286 CTCTGGGGCCTCTTTAATAAGGG - Intronic
964728116 3:159836338-159836360 CTCTTGGGCCTCTTTTAAAAAGG + Intronic
964761813 3:160141642-160141664 TTCTGGGGCCTCTTTAATAAGGG + Intergenic
964838476 3:160967513-160967535 ATCTGGGGCCTCTTTTATAAGGG + Intronic
965175760 3:165330234-165330256 CCCTGGTACCTCTTTTATAAGGG + Intergenic
965350385 3:167604764-167604786 TCCTTGGACCTCCTTTATAAGGG - Intronic
965428195 3:168553670-168553692 CCTTCAGGCCTCTTTTATAGTGG + Intergenic
965431751 3:168597374-168597396 TCCTAGGACCTCTTTTACTAGGG - Intergenic
965523833 3:169696216-169696238 CCCTCAAGCCTCTTTTATAAGGG + Intergenic
965554218 3:170002849-170002871 TCCTTGGGCCTCTGGTATAGAGG + Intergenic
965733887 3:171800849-171800871 CTCTCTGGCCTCTTTTATAAAGG + Intronic
965806381 3:172546637-172546659 CCCTTGGGCCTATTTTAGAAGGG + Intergenic
966131456 3:176645120-176645142 TTCTCAGGCCTCTTTTATAAGGG - Intergenic
966183633 3:177209067-177209089 CCCTCGTGCCTCTTTTATGAAGG + Intergenic
966226692 3:177605480-177605502 CCCTCAGTCCTCTTTTGTAAGGG - Intergenic
966239737 3:177743149-177743171 CCCTGGGGTCTCTTTTATAAGGG + Intergenic
966282880 3:178255186-178255208 CTCTAGGGTCTCTTTTATAATGG - Intergenic
966312104 3:178605201-178605223 TCTTCAGAGCTCTTTTATAAGGG - Intronic
966358159 3:179104273-179104295 CCCTGGGTCCTCTTTTATAATGG + Intergenic
966432894 3:179851365-179851387 CCCTCAGATCTCTTTTATAAGGG + Intronic
966433347 3:179855724-179855746 CCCTCAGGCCTCTTGTGTAAGGG - Intronic
966716644 3:183019431-183019453 TCTTCAGGCCTCTTTCATAAGGG - Intronic
966763354 3:183436573-183436595 CCCTCAGGCCTCTTTTATAAAGG - Intergenic
967013118 3:185457513-185457535 CCCTTGGGCCTATTTGATAAGGG + Intronic
967078643 3:186028111-186028133 CCCTGGGGTCTCTTTAATAAGGG - Intergenic
967444483 3:189549630-189549652 GTCTCAGGCCTCTTTTATAAAGG - Intergenic
968844586 4:3033305-3033327 CCCTGGGGCCCCTTTTCTAATGG + Intronic
969141503 4:5078133-5078155 TTCTCTTGCCTCTTTTATAAGGG + Intronic
969343153 4:6555145-6555167 TGCCTCGGCCTCTTTTATAAGGG + Intronic
969547107 4:7837372-7837394 CTCTGGGGCCTCTTTTATAAGGG - Intronic
969934043 4:10663861-10663883 CTCTGGGACCTCTTTTATAAGGG - Intronic
970012857 4:11479808-11479830 CTCTGGGGCCTCTTTTATAAAGG + Intergenic
970069291 4:12138375-12138397 CTCTAGGGCCTCTTTTATAAGGG + Intergenic
970096837 4:12473206-12473228 CTCTGGGGCCTCTTTTGTAAGGG + Intergenic
970113566 4:12667803-12667825 TTCTGGGACCTCTTTAATAAGGG + Intergenic
970128236 4:12838471-12838493 TTCTAGGGCCTCTTTTATAAGGG + Intergenic
970151435 4:13094695-13094717 CCCTCAGGCCCCCTTTATAATGG + Intergenic
970209884 4:13698115-13698137 TCCTTGGGCTTGTTTTATGAGGG + Intergenic
970340070 4:15096935-15096957 TCTCTGGGTCTCTTTTATAAGGG - Intergenic
970503816 4:16706328-16706350 CTCTCGGGCTTCTTTTATAATGG - Intronic
970599546 4:17630389-17630411 TCCCTGAGCCTCTTTTGTAAGGG - Exonic
970653047 4:18199142-18199164 CCTTCAGGCCTCCTTTATAATGG + Intergenic
970778846 4:19710752-19710774 CTCTGGAGCCTCTTTTATAAAGG - Intergenic
970931705 4:21519200-21519222 CCCTGGGACCTCTTTTATAAGGG - Intronic
970970456 4:21977290-21977312 TCCCTAGGCTTCTTTTATAAGGG + Intergenic
970971378 4:21988129-21988151 TTCCCTGGCCTCTTTTATAAGGG + Intergenic
971032865 4:22660016-22660038 TCCTGGGGCCTCTTGTATAAGGG + Intergenic
971075056 4:23138596-23138618 GTCTGGGACCTCTTTTATAAGGG - Intergenic
971112616 4:23605908-23605930 CTCTGGGGTCTCTTTTATAAAGG + Intergenic
971118747 4:23680182-23680204 CTCTGGGACCTCTTTTATAAGGG - Intergenic
971118763 4:23680251-23680273 TTCTGGGACCTCTTTTATAAGGG - Intergenic
971246678 4:24935554-24935576 TTCTGGGGTCTCTTTTATAAGGG - Intronic
971390456 4:26180574-26180596 CCCTGGGGCCTCTTTTATAAGGG + Intronic
971450789 4:26799629-26799651 CCCTCAAGCCTCTTTTATAAAGG - Intergenic
971459634 4:26881160-26881182 CCGTCTGGCCTCTTTTATAAGGG - Intronic
971502915 4:27335652-27335674 CCCTGGGGCTTCTTTCATAAGGG + Intergenic
971614576 4:28771418-28771440 CTCTTGAGCCTCTTTTATAAGGG + Intergenic
971699820 4:29956539-29956561 GCCTCAGGCATCTTTTAAAAGGG - Intergenic
971753007 4:30675661-30675683 TTCTGGGCCCTCTTTTATGAAGG - Intergenic
971812893 4:31450463-31450485 CCCTCAGGCTTCTTCTATAAGGG - Intergenic
971822768 4:31580205-31580227 CTCTGGGGCCTCTTTCATAAGGG - Intergenic
971899384 4:32639148-32639170 CTCTTGGGCCTCTTTTATAAAGG + Intergenic
971903681 4:32697561-32697583 TTCTGGGGCCTTTTTTATAAAGG - Intergenic
971993282 4:33929646-33929668 CCCTCAGGCCCTTTTTATAAGGG + Intergenic
972088863 4:35255613-35255635 CCCTTAGTCCTCTTTTATAAGGG - Intergenic
972108957 4:35530869-35530891 CCCTTTGGCCTCTTTTATAAGGG + Intergenic
972164002 4:36260510-36260532 CTCTGGGGTCTCTTTTATAAGGG - Intergenic
972236039 4:37135309-37135331 GTCTGGGGTCTCTTTTATAATGG - Intergenic
972382017 4:38527823-38527845 TCCTCAGGCCTCTTTTCTAAGGG - Intergenic
972425319 4:38927425-38927447 CCCTGGGGCCTCTTTTTTTAGGG + Intronic
972568549 4:40290154-40290176 CTCTGGGGCATCTTTTATAAGGG - Intergenic
972684907 4:41342815-41342837 CCCTCGGGCCTCTTTCATAAGGG - Intergenic
972803750 4:42506275-42506297 CTCTGAGGCCTCTTTTATAAGGG - Intronic
972810973 4:42585475-42585497 CTCTCGGACCTCTTTTGTAAGGG - Intronic
972833020 4:42835825-42835847 CTCTGGGGCCTGTTTTATAAAGG - Intergenic
972841378 4:42933662-42933684 CTCTGGGGTCTCTTTTATAAAGG - Intronic
972842380 4:42946689-42946711 CCCTCTGGCCTCTTTTATAAAGG + Intronic
972847708 4:43009685-43009707 CTCTGGGTCCTCTTTTATAAGGG + Intronic
972873551 4:43329897-43329919 CCCTGGGGCCGCTTTTATAAGGG + Intergenic
972969259 4:44552079-44552101 CTCTAGGGCCTCTTTTGTAAAGG + Intergenic
973132798 4:46669515-46669537 TCCTTGGGTCTCTTCTATAAGGG + Intergenic
973157358 4:46973325-46973347 CACTGGGGCCTCTTTTATAAAGG - Intronic
973534177 4:51864662-51864684 CCCTCAGGCCTCTTTTATAAGGG + Intronic
973543438 4:51957196-51957218 TTCTCAAGCCTATTTTATAAGGG + Intergenic
973571198 4:52241456-52241478 CCCTGGGGCCTCTTTAATGAGGG + Intergenic
973627277 4:52785397-52785419 TTCTGGGGCCTCTTTTTAAAGGG - Intergenic
973695226 4:53484007-53484029 TCCTCCAGCCCCTTTCATAAGGG - Intronic
973722871 4:53742912-53742934 CTCTAAGGCCTCTTTTATAAGGG + Intronic
973755352 4:54068341-54068363 CTCTGGGGCCTCTTTTATGAGGG - Intronic
973860167 4:55056052-55056074 CTCTTGGGCCTCTTTTATAAGGG - Intergenic
974040812 4:56855881-56855903 CTCTGGGGCCACTTTTATAAGGG + Intergenic
974362562 4:60901155-60901177 CTCTGGGGCCTCTTTTATAATGG + Intergenic
974383684 4:61176863-61176885 TTCCCAGACCTCTTTTATAAGGG - Intergenic
974439680 4:61899846-61899868 CTCTGGGGCCTCATTTATAAGGG + Intronic
974441862 4:61929203-61929225 ATCTCGGGCCTCCTTTGTAAGGG - Intronic
974474067 4:62356904-62356926 TTGTCCGGGCTCTTTTATAAAGG + Intergenic
974488954 4:62539300-62539322 TCTTTAGGCCTGTTTTATAAGGG + Intergenic
974584956 4:63861734-63861756 TCCTGGGACCTCTTTTATATGGG - Intergenic
974589493 4:63925510-63925532 TTCTCAGACCTATTTTATAAGGG + Intergenic
974601326 4:64084559-64084581 CCCTTAGGCCTCTTTTATAAGGG - Intergenic
974623880 4:64397503-64397525 TTCTCAGGCCTCTTTTGTAAGGG - Intronic
974844002 4:67329449-67329471 CTCTAGGGCCTCTTTTACAAGGG - Intergenic
974868529 4:67609562-67609584 ATCTCCAGCCTCTTTTATAAGGG + Intergenic
974904977 4:68044458-68044480 TTCTAAGGCCTCTTTTATGAAGG - Intergenic
975364221 4:73509826-73509848 CCCTTGGGCTTCTTTTATAAGGG + Intergenic
975373453 4:73614414-73614436 TTCTGGGGTCTCTTTTATAAGGG - Intronic
975745310 4:77469424-77469446 TCCTCGGGCTTCTTTCATAAGGG - Intergenic
975850124 4:78563494-78563516 CCCTCAGACCTCTTTTAAAAGGG - Intronic
975867097 4:78735190-78735212 CCCAAGGGCCTCTTTTATAAGGG + Intergenic
975871698 4:78786226-78786248 CTCTGGGGCCTCTTTTATAAGGG - Intronic
976021354 4:80631988-80632010 CTCTGGGGCCTCTTTTATAAGGG - Intronic
976493865 4:85703557-85703579 CTCTGGGGCCTCTTTTATAAGGG - Intronic
976755805 4:88496928-88496950 CCCTTGGGCCTCTTTCATAGGGG - Intronic
976839801 4:89418812-89418834 TCCCTTGGGCTCTTTTATAAGGG + Intergenic
977085460 4:92591177-92591199 CCCTTGGGCCTGTTTTATAAGGG - Intronic
977127366 4:93187042-93187064 TCCTCACACCTCTTTTATAAGGG + Intronic
977210862 4:94216139-94216161 CTCTTGGGCCTCTTTTATAAGGG + Intronic
977553290 4:98464749-98464771 CCCACAAGCCTCTTTTATAAGGG + Intergenic
977697711 4:99985123-99985145 CTCTCTGGCCTCTTTTATAAGGG - Intergenic
977750072 4:100599045-100599067 TCCTCGGGCCTCTTTTATGAGGG - Intronic
977756550 4:100678409-100678431 CTCTGGAGCCTCTTTTATAAAGG + Intronic
977933657 4:102776395-102776417 TTCTCAGGCTTCCTTTATAAGGG + Intergenic
977946319 4:102918647-102918669 CCCTTAAGCCTCTTTTATAAAGG - Intronic
978110066 4:104952783-104952805 CCCTGGTACCTCTTTTATAAAGG + Intergenic
978448417 4:108802989-108803011 TTCTCAGGCCTCATTTCTAATGG - Intergenic
978669277 4:111226893-111226915 CCCTCAAGCCTCTTTTATAAGGG + Intergenic
978828936 4:113059054-113059076 TTCTGGGGCGTCTTTTATATGGG + Intronic
979006378 4:115303110-115303132 TTCTTTGGCCTCTTTTATAAGGG - Intergenic
979071213 4:116209105-116209127 CCCTTGGGCTTCTTTTATAAGGG - Intergenic
979797214 4:124861270-124861292 TTCTGGGGTCTCTTTCATAAGGG + Intergenic
980011131 4:127595859-127595881 TTCTGGGGTCTCTTTTACAAGGG + Intergenic
980145574 4:128979386-128979408 CCCTTGGGCCTCTCTTATGAGGG - Intronic
980169048 4:129264738-129264760 TCTTCGAGCCCATTTTATAAGGG + Intergenic
980193640 4:129559237-129559259 CTCTGAGGCCTCTTTTATAAGGG + Intergenic
980196842 4:129600355-129600377 TCTTTGGGTCTCTTTTATAAGGG - Intergenic
980267122 4:130531229-130531251 CACTTGGGCCTCTTTTATAAGGG + Intergenic
980524783 4:133975672-133975694 TCATCATGCCTCTGTTATAATGG - Intergenic
980603927 4:135064471-135064493 CTCTGGGGCCTCTTTTATAAGGG - Intergenic
980802230 4:137766667-137766689 CTTTTGGGCCTCTTTTATAAGGG + Intergenic
980844357 4:138306115-138306137 CTCTGGGGTCTCTTTTATAAAGG + Intergenic
980903506 4:138927532-138927554 CTCTCAGGCCTTTTTTATAAGGG - Intergenic
980972155 4:139576822-139576844 CCCTAGGGCCTCTTTTATAAGGG + Intronic
981134956 4:141200273-141200295 CTCTAGGGCCTCTTTTATAAGGG + Intronic
981251141 4:142602533-142602555 TCCTCTGGCCTGCTTTTTAATGG - Intronic
981251885 4:142612695-142612717 CCCTGGGGCCTTTTTTATGAGGG + Intronic
981330140 4:143498782-143498804 CTCTCTGGCCTCTTTTATAAGGG + Intergenic
981354866 4:143777456-143777478 CTCTCTGTCCTCTTTTATAAAGG - Intergenic
981422499 4:144567292-144567314 CCCTCAGGCCTCTGTTATAAGGG - Intergenic
981451943 4:144908489-144908511 CACTTGGCCCTCTTTTATAAGGG - Intergenic
981498754 4:145423506-145423528 CTCTGGGGCCTCTTTTATAATGG - Intergenic
981572755 4:146170406-146170428 TGCTCAGGCTTCTTATATAAGGG - Intergenic
981642753 4:146964081-146964103 CTCTGAGGCCTCTTTTATAAGGG + Intergenic
981676793 4:147351866-147351888 CTCTTGAGCCTCTTTTATAAGGG + Intergenic
981686531 4:147460694-147460716 CCCTCAGGCCTCTTTTATAAGGG - Intergenic
981917577 4:150051648-150051670 CTCTGGGGCCTCTTTGATAAGGG - Intergenic
981971493 4:150667668-150667690 CTCTGGGGCCTCTTTTCTAAGGG - Intronic
982099603 4:151955064-151955086 CCCTCAGGCCTCTTTTATAAGGG - Intergenic
982177353 4:152718522-152718544 TCCTCAGGCCTCTTTTATCAGGG + Intronic
982203747 4:152981762-152981784 TCCTCGGGCCTTCTTTATAAGGG - Intergenic
982410943 4:155076677-155076699 CTCTCAGGCCTCTTTTAAAAGGG - Intergenic
982502321 4:156172485-156172507 CTCTGGGGTCTCTTTTATAAGGG + Intergenic
982508338 4:156249047-156249069 CTCTTGGGCCTCTTTCATAAGGG + Intergenic
982510301 4:156274615-156274637 TCTCTGGGCCTATTTTATAAGGG + Intergenic
982680468 4:158422219-158422241 TTCTCGGGCCTCTTTTTTAAGGG - Intronic
982727998 4:158925959-158925981 CTCTCAAGCCTCTTTTATAAAGG + Intronic
982834429 4:160106170-160106192 TCCTTGGGTCTCCTTTAGAAGGG + Intergenic
983054784 4:163089153-163089175 CCTTCAGGCCTCTTTTATAAGGG + Intergenic
983112585 4:163771547-163771569 CCCTCGGGCCTTTTCTGTAAGGG + Intronic
983118746 4:163852929-163852951 CCCTCAGGCTTCTTCTATAATGG - Intronic
983124301 4:163931452-163931474 TCCTGAGGCCTCCTTTATGAAGG - Intronic
983180793 4:164646192-164646214 CTCTGGGGTCTCTTTTATAAGGG - Intergenic
983366875 4:166802547-166802569 CCCTTGGGCCTCCTTTATAAGGG + Intronic
983514083 4:168638716-168638738 CCCTTGGGCCTATTTTATAGGGG + Intronic
983557850 4:169074285-169074307 CCCTCAGGCCTCTTTTATGGCGG + Intergenic
983709575 4:170696677-170696699 CTCTGGGGTCTCTTTTATAAGGG + Intergenic
983817933 4:172155304-172155326 TCCCCGGGCCTATTTTAAAAGGG - Intronic
983842627 4:172476288-172476310 TCCTGAGGCCTCTTTTGCAAAGG + Intronic
983956600 4:173705428-173705450 CCCTCAGGCCCCTTTCATAAGGG - Intergenic
983993926 4:174158522-174158544 CTCTCGGGTCTCTTTTATAAAGG + Intergenic
984012574 4:174388316-174388338 CCCTCAAGCCTCTTTTATAAGGG - Intergenic
984045723 4:174796152-174796174 CTCTGGGGCCTCTTTCATAAAGG - Intronic
984246709 4:177283527-177283549 CCCTCAGACCTCTTTTATAATGG + Intergenic
984260280 4:177436568-177436590 CTCTGGGGCCTCATTTATAAGGG - Intronic
984333204 4:178354012-178354034 CTCTAGGGCCTCTTTGATAAGGG - Intergenic
984431750 4:179659728-179659750 CCTTCAGGCCTCTTTTATAAGGG - Intergenic
984462227 4:180052800-180052822 CCCTCAGGCCCCTTTTATAATGG - Intergenic
984468894 4:180140095-180140117 CTCTGGGGCCTCTTTTATAAGGG + Intergenic
984561516 4:181276381-181276403 CTCTGGGGCCTCTTTTATAAGGG + Intergenic
984808478 4:183772958-183772980 TTCTAGAGTCTCTTTTATAAGGG + Intergenic
984867568 4:184295114-184295136 CTCTGGGGTCTCTTTTATAATGG + Intergenic
984983191 4:185302594-185302616 CTCTGAGGCCTCTTTTATAAGGG - Intronic
985110096 4:186539578-186539600 CCCTGGCACCTCTTTTATAAAGG - Intronic
985139883 4:186828989-186829011 CCCTTCGGCCTCTTTTATAAGGG - Intergenic
985388809 4:189472953-189472975 TCCTCGGGCATCTTGGCTAAGGG - Intergenic
986203560 5:5601364-5601386 CTCTAGGGTCTCTTTTATAAGGG + Intergenic
986247377 5:6022522-6022544 CGCTGGGGTCTCTTTTATAAAGG + Intergenic
986257814 5:6115330-6115352 CTCTGGGGTCTCTTTTATAAGGG - Intergenic
986363474 5:7004981-7005003 CCCTCAAGCCTCTTTTGTAAGGG - Intergenic
986373886 5:7110457-7110479 CCCTCAGGCCTCTTTTATAAAGG - Intergenic
986447583 5:7836047-7836069 CCCTCACGCTTCTTTTATAAGGG + Intronic
986556423 5:9014604-9014626 TCCTGGAGCATCTTCTATAAGGG + Intergenic
986865360 5:11980539-11980561 CCCTCAGGCCTCCTTTAAAAGGG - Intergenic
987070215 5:14329399-14329421 CTCTCAGGCCTCTTTTATAAGGG - Intronic
987081044 5:14425733-14425755 TCCCTGGGCCTCTTTTGTAAGGG - Intronic
987096186 5:14552553-14552575 CTCTGGGGCTTCTTTTATAAAGG - Intergenic
987302029 5:16605814-16605836 ACCTCTGACCCCTTTTATAAGGG + Intronic
987331196 5:16859336-16859358 CCCTTAGGCCTCTTTTATATGGG + Intronic
987333437 5:16876982-16877004 CTCTTGGGCCTCTTTTATAAGGG - Intronic
987437106 5:17907768-17907790 TCCTCAGTCCTCTTTTTAAATGG + Intergenic
987451556 5:18090466-18090488 CCCTCAAGCCTCCTTTATAAGGG + Intergenic
987550170 5:19369227-19369249 CTTTAGGGCCTCTTTTATAAAGG + Intergenic
987700347 5:21390145-21390167 TTTTGGGGTCTCTTTTATAAGGG - Intergenic
987760784 5:22160750-22160772 CCCTTGGGCCTATATTATAAGGG + Intronic
987799648 5:22677462-22677484 TCCTCAAGCCTCACTTATAAGGG + Intronic
987839689 5:23207222-23207244 CTCTTGGGCCTCTTTTAGAATGG + Intergenic
987972093 5:24959818-24959840 CTCTGGGGGCTCTTTTATAAGGG + Intergenic
988149171 5:27353770-27353792 CCCTCAGGCCCCTTTTCTAAGGG - Intergenic
988206830 5:28147943-28147965 CCCCTGGGCCTCTTCTATAAGGG + Intergenic
988289370 5:29265899-29265921 TCCTCAGGCATCAATTATAAAGG + Intergenic
988514847 5:31895347-31895369 TTCTCAGGCCTCATTCATAATGG - Intronic
988515387 5:31899782-31899804 CTCTTGGGCCTCTTTTATGAAGG - Intronic
988545758 5:32156069-32156091 CTCTGGGGCCTCTTTTATAAGGG - Intronic
988571855 5:32375754-32375776 GCCTCGGGCCTCTCAAATAATGG + Intronic
988655257 5:33204304-33204326 CTCTGGGGCCCCTTTTATAAGGG - Intergenic
988704925 5:33716159-33716181 CTCTCAGGCCTCTTTTATAAGGG - Intronic
988716667 5:33835608-33835630 CGCTGCGGCCTCTTTTATAAAGG + Intronic
988752061 5:34197920-34197942 TTTTGGGGTCTCTTTTATAAGGG + Intergenic
988833222 5:35007133-35007155 TTCTGGAGCCTCTTTTATGAGGG - Intronic
989098542 5:37803429-37803451 CCCTGGGGTCTCTTTTATAAGGG - Intergenic
989118171 5:37977046-37977068 CTCTGGGGCCTCTTTTATAAGGG - Intergenic
989162434 5:38404332-38404354 CCTTTGGGCCTCTTTAATAAGGG - Intronic
989299744 5:39876669-39876691 CTCTGGGGCCTCTTTTATAAGGG + Intergenic
989399638 5:40994844-40994866 TCCTCAGGCCTCTATTATAAGGG - Intergenic
989446682 5:41537763-41537785 ATCTGTGGCCTCTTTTATAAAGG + Intergenic
989664485 5:43837993-43838015 CTCTGGGGTCTCTTTTATAAGGG - Intergenic
989709050 5:44374254-44374276 TCCTTGTGTCTCTCTTATAAGGG + Intronic
989744923 5:44817678-44817700 CCCTTGGGTCTATTTTATAAGGG - Intronic
990331755 5:54734130-54734152 CTCTCAGGCCTCTTTTATAGAGG - Intergenic
990358472 5:54994942-54994964 CTCTGGGGCCCCTTTTATAAGGG + Intronic
990500888 5:56396303-56396325 TCCTCAAGCCTCTTTTATAAGGG + Intergenic
990532039 5:56683786-56683808 TCCTTGAGTCTCTTTTATAGGGG - Intergenic
990746905 5:58967853-58967875 CCCTTGGGCCTCTTTTATAAGGG + Intergenic
990807561 5:59682617-59682639 CTCTGGGGTCTCTTTTATAAGGG - Intronic
990845213 5:60130008-60130030 CTCTGGGGCCTCTTTTATAAGGG - Intronic
990910821 5:60850455-60850477 ACCTGGGGCCTCTTTTATAAAGG + Intergenic
991036660 5:62134435-62134457 CTCTGGGGCCTCTTTTATAAGGG + Intergenic
991134064 5:63160758-63160780 TCTGTGGGCCTCTTTTATGAGGG + Intergenic
991196021 5:63933376-63933398 TCCTCTAGCCTCCTTTATGATGG + Intergenic
991274510 5:64828606-64828628 GTCTTGGGCCTCTTTTATAAGGG - Intronic
991322090 5:65385014-65385036 CCCTCAGGCTTCTTTTATAAGGG + Intronic
991402869 5:66272441-66272463 TTCGGGGGCCTCTTTTATAAGGG + Intergenic
991403547 5:66278825-66278847 TTCCTGGGCCTCTTTTATAAAGG + Intergenic
991408962 5:66328286-66328308 GCATGAGGCCTCTTTTATAAGGG - Intergenic
991443155 5:66672596-66672618 TTCTCAGGCCCCTTTTATATTGG + Intronic
991514201 5:67415788-67415810 CTCTGGGGTCTCTTTTATAAGGG + Intergenic
991571693 5:68061249-68061271 TCCTCTAGCCTCTTTTATAAGGG - Intergenic
991739826 5:69658736-69658758 TTTTGGGGTCTCTTTTATAAGGG + Intergenic
991791401 5:70238477-70238499 TTTTGGGGTCTCTTTTATAAGGG + Intergenic
991819289 5:70534861-70534883 TTTTGGGGTCTCTTTTATAAGGG + Intergenic
991883850 5:71238819-71238841 TTTTGGGGTCTCTTTTATAAGGG + Intergenic
991895561 5:71394203-71394225 CCCTTGGGCCTATATTATAAGGG + Intergenic
991953718 5:71971760-71971782 CTCTGGGGCCTCTTTTATAGGGG + Intergenic
992095771 5:73361269-73361291 CTCTGGGGTCTCTTTTATAAGGG + Intergenic
992181857 5:74205273-74205295 CCCTGGGACCTCTTTTATAAGGG - Intergenic
992943489 5:81786436-81786458 TTTTGGGGCTTCTTTTATAAGGG + Intergenic
993107248 5:83613161-83613183 CTCTTGGGCCTCTTTTATAAAGG - Intergenic
993419699 5:87685355-87685377 CTCTGGGGCCTCTTTCATAAGGG + Intergenic
993488427 5:88515498-88515520 CTCTTGGGCCTCTTTTATAAGGG + Intergenic
993552327 5:89288846-89288868 TTCTCAGGCCTGTTTTATAAGGG - Intergenic
993754308 5:91708779-91708801 CCCCTGGGCCTCTTTTATGAGGG - Intergenic
993825780 5:92684912-92684934 TTCTCTGGCCTCTTTTTTTAAGG + Intergenic
993878410 5:93336126-93336148 CCTTCAAGCCTCTTTTATAAGGG + Intergenic
993952058 5:94188021-94188043 CTCTGGGGTCTCTTTTATAAGGG - Intronic
994223739 5:97227988-97228010 CCCTCCGGCCTCTTTTGTAAGGG + Intergenic
994252909 5:97557776-97557798 CCCTTGGGCCTCTCTCATAAGGG - Intergenic
994381721 5:99079491-99079513 GTCTGGGGCCTGTTTTATAAGGG - Intergenic
994527546 5:100925668-100925690 TCTACGGGTCTCTTTTATAAGGG - Intergenic
995126499 5:108581912-108581934 CTCTAGGACCTCTTTTATAAGGG + Intergenic
995349721 5:111161057-111161079 TTCTGGGGCCTCTTTTATAAAGG - Intergenic
995367385 5:111378145-111378167 CTCTAGGGCCTCTTTTATAACGG - Intronic
995368348 5:111389211-111389233 TTCTAGGGTGTCTTTTATAAAGG + Intronic
995377751 5:111495423-111495445 CACTTGGGCCTCTTCTATAAAGG + Intergenic
995479247 5:112578647-112578669 CCCCTGGGCATCTTTTATAAGGG - Intergenic
995568096 5:113452442-113452464 CTCTGGGGCCTCCTTTATAAGGG - Intronic
995683804 5:114749040-114749062 CCCTTCGACCTCTTTTATAAAGG - Intergenic
995793451 5:115917896-115917918 CCCTCAGGCCTCTTTTATAAGGG + Intergenic
995921716 5:117322279-117322301 CTCTAGGGCCTCTTTTGTAAGGG - Intergenic
995933492 5:117480787-117480809 CCCTGGGGTCTCTTTGATAAGGG - Intergenic
996049044 5:118910906-118910928 CCCTCAGGCCTCTTTTATAAGGG + Intronic
996178525 5:120389975-120389997 CTCTTGGGCCTCTTTTATAAAGG + Intergenic
996240921 5:121200380-121200402 CCCTTGGGCATGTTTTATAAGGG + Intergenic
996306716 5:122055237-122055259 CCCTTGGACCTCATTTATAAAGG + Intronic
996490750 5:124092898-124092920 CTCTTGAGCCTCTTTTATAAGGG + Intergenic
996516292 5:124373137-124373159 TCCTCAGGCCTCTTTTATAAGGG + Intergenic
996690798 5:126337735-126337757 CCCTGGGGCCTCTTTTATAAGGG - Intergenic
997050464 5:130373981-130374003 TTGTGGGGTCTCTTTTATAAGGG - Intergenic
997087264 5:130816426-130816448 TCCTCTGGCCTCTTTCACAAGGG + Intergenic
997089316 5:130838528-130838550 CTCTGGGGTCTCTTTTATAAAGG + Intergenic
997559950 5:134837608-134837630 CACTGGGGTCTCTTTTATAAGGG - Intronic
998068291 5:139176687-139176709 TCCTCGGGCCTCTTTTATAAGGG + Intronic
998291466 5:140918733-140918755 TCTCTGGGCCTCTTTTATAAGGG - Intronic
998495372 5:142583815-142583837 CCATCAGGCCTCTTTTATAAGGG + Intergenic
998585517 5:143422570-143422592 CCCTGAGGCCTCTTTTATATGGG - Intronic
998766275 5:145491319-145491341 CCCTTGGGCCTCTTATATCAGGG + Intronic
998980959 5:147701697-147701719 TCCTTGGGCCTCTTTCATAATGG - Intronic
999200650 5:149813911-149813933 TACTTGGGTCTGTTTTATAAGGG + Intronic
999364684 5:151014523-151014545 TTCTTGGGCCTTTTTTATAAGGG - Intergenic
999805812 5:155080252-155080274 TGCTTGAGGCTCTTTTATAAGGG + Intergenic
1000134247 5:158330134-158330156 TCCTTGTACCTCTTTTTTAAAGG - Intergenic
1000250718 5:159492111-159492133 TTCTCAGGCTTCTTTTATAGGGG - Intergenic
1000786331 5:165548986-165549008 CCCTCTGACCTCTTTTATATGGG + Intergenic
1000962083 5:167611800-167611822 CTCTGGGGCCTCTTCTATAACGG + Intronic
1001218688 5:169880143-169880165 TCCGGGGCCCTCTTTTTTAAAGG + Intronic
1001566600 5:172703520-172703542 CTCTGGGGACTCTTTTATAAGGG + Intergenic
1001630408 5:173170852-173170874 TCTTTGGGCCTCTTTTATAAGGG - Intergenic
1001688111 5:173610866-173610888 TCCTGGGGTCCCTTTTGTAAGGG - Intronic
1001837021 5:174841213-174841235 CTCTGGGGCCTCTTTGATAAGGG - Intergenic
1002398602 5:178977308-178977330 CCCTGGGGTCTCTTTTATAAGGG - Intergenic
1002424902 5:179169203-179169225 CCCTCAGGCTTCTTTTGTAAGGG - Intronic
1002447520 5:179298374-179298396 TCCCTGGGCCTCTCTGATAAGGG - Intronic
1002462895 5:179384892-179384914 TCTCTGGGCCTCTTGTATAAGGG + Intergenic
1002558409 5:180062359-180062381 CCCCCCAGCCTCTTTTATAAGGG + Intronic
1003310996 6:4969895-4969917 CCCTGGAGCCTCTTTTATAAGGG + Intergenic
1003486737 6:6586699-6586721 CTCTTAGGCCTCTTTTATAAAGG - Intergenic
1003488846 6:6603120-6603142 CCCTCAGGCCTCTTTTATGAAGG + Intronic
1003613021 6:7630304-7630326 CCCTGGGGCCTCTTTTATACGGG - Intergenic
1003648349 6:7935019-7935041 CTCTCTGGCCTCTATTATAAGGG + Intronic
1003687619 6:8320205-8320227 CTCTAGGGCCTCTTTTATAAGGG + Intergenic
1003714870 6:8635189-8635211 CCCTTGGGCCTGTTTGATAAGGG + Intergenic
1003980906 6:11388901-11388923 CCTTCAGGCCTCTTTTATAAGGG - Intergenic
1004063336 6:12219345-12219367 TCGTCTAACCTCTTTTATAAGGG - Intergenic
1004072102 6:12309188-12309210 GTCTTGGGCCTCTTTTCTAAGGG - Intergenic
1004212395 6:13662571-13662593 TTCTCACGCCTCTTTTATTAGGG - Intronic
1004233286 6:13851768-13851790 CTCTGGGACCTCTTTTATAAGGG - Intergenic
1004241989 6:13931917-13931939 CTCTGGGGTCTCTTTTATAAGGG - Intronic
1004258956 6:14090781-14090803 CTCTCTGGCCTCTTTTAGAAGGG + Intergenic
1004271572 6:14200758-14200780 CTCTCAGGCCTCTTTTATAAGGG + Intergenic
1004352125 6:14899022-14899044 CCCTTGGGTCTCTTTTATGAGGG - Intergenic
1004371816 6:15059377-15059399 CCCTTGGGTTTCTTTTATAAGGG + Intergenic
1004904117 6:20220320-20220342 GCCTCTGGCCGCTTTTATAAGGG + Intergenic
1005550222 6:26904634-26904656 TTCTGGGGTCTCTTTTATAAGGG + Intergenic
1005717018 6:28559135-28559157 CCCTCAGGCCTCTTTTATAAGGG - Intergenic
1005827102 6:29639467-29639489 CCCTGGGGCCTCTTTTAGAAGGG + Intergenic
1006551332 6:34825604-34825626 GTCTCCGGCCTCTTTTCTAAAGG + Intronic
1006826255 6:36938492-36938514 CTCTGGGGTCTCTTTTATAAGGG + Intergenic
1006912357 6:37571637-37571659 CTCTGGGGTCTCTTTTATAAGGG + Intergenic
1007008849 6:38395128-38395150 CTCTCTGGCCTCTTTTATAAGGG - Intronic
1007061132 6:38941989-38942011 CCCTCAGGCCTCTTTCATAAAGG - Intronic
1007164527 6:39819823-39819845 CTCTGGGGTCTCTTTTATAAGGG + Intronic
1007193297 6:40038230-40038252 CTCTGGGGTCTCTTTTATAAAGG - Intergenic
1007233807 6:40375785-40375807 CTCTCAGGCCTCTTTTATAAGGG - Intergenic
1007364331 6:41380496-41380518 TCTCTGGGCCTTTTTTATAAGGG + Intergenic
1007638893 6:43320110-43320132 TTCCCTGGCCTCTTTTATAAAGG - Intronic
1007888172 6:45256415-45256437 CCCTCAAGCCTCTTTTATAAGGG + Intronic
1008357300 6:50569778-50569800 CCCTGGGGCCTCTTTCATAAGGG - Intergenic
1008372623 6:50751633-50751655 TCCCCTGGGCTCTTTTATAAGGG + Intronic
1008377899 6:50811910-50811932 CCCTCAGGCTTCTTTTATAAGGG - Intergenic
1008438101 6:51499608-51499630 CTCTAGGGCCTCTTTTAGAAAGG + Intergenic
1008560446 6:52719788-52719810 CCCTTGGGCCTCATTTATAATGG - Intergenic
1008654524 6:53598012-53598034 TCTTCAAGCCTCTTTTATGAAGG + Intronic
1008810153 6:55486968-55486990 CCCTTGGGCCTCTTTTATGAGGG + Intronic
1009026185 6:58003053-58003075 CTCTGGGGTCTCTTTTATAAGGG - Intergenic
1009201732 6:60754526-60754548 CTCTGGGGTCTCTTTTATAAGGG - Intergenic
1009304797 6:62075247-62075269 TCCTCAGGCCTCTTTTATAAGGG - Intronic
1009520162 6:64671311-64671333 CTCTGGGGTCTCTTTTATAAGGG - Intronic
1009532037 6:64830118-64830140 CCCTTGGGCCTATTTTATAAGGG - Intronic
1009580986 6:65533645-65533667 CCTTTGGGACTCTTTTATAAAGG - Intronic
1009623151 6:66101377-66101399 CCCTTGGGCCTCTTTTATAAGGG + Intergenic
1009790428 6:68394540-68394562 TTCTGGGGCCTCTTTTACAAGGG + Intergenic
1009902311 6:69822304-69822326 TCTATGGGCCTCTTGTATAAGGG - Intergenic
1009929815 6:70163946-70163968 CCCTTGGGCCTCCTTTATAAGGG + Intronic
1009974377 6:70657400-70657422 GCCTTGGGCCTCTTTTAGAAGGG + Intergenic
1010010554 6:71043193-71043215 CTCTTGGGCCTCTTTTATAAGGG - Intergenic
1010247446 6:73674748-73674770 TCTTGGGGCCTCTTTTATGAGGG - Intergenic
1010278331 6:73994675-73994697 TCCCAGGGTCTCTTTTATAAGGG + Intergenic
1010359429 6:74975206-74975228 GCTTGGGGTCTCTTTTATAAGGG - Intergenic
1010416777 6:75620492-75620514 CCATTGGGCCTCTTTGATAAGGG + Intronic
1010551937 6:77234330-77234352 CCCTCAAGCCTCTTTTATAAGGG - Intergenic
1010610586 6:77950314-77950336 CCCATGGGCCTCTTTTATAGGGG - Intergenic
1010649480 6:78434600-78434622 CCCTCAAACCTCTTTTATAAGGG + Intergenic
1010726307 6:79337612-79337634 TCTCTGAGCCTCTTTTATAAGGG - Intergenic
1010731030 6:79391540-79391562 CTCTGGGGCCTCTTTTATATAGG + Intergenic
1010831338 6:80534264-80534286 CCCTCAAGCCTCTTTTATAAGGG - Intergenic
1010903599 6:81457919-81457941 CCTTCGAGCCTCTTTTATAAGGG - Intergenic
1011221305 6:85057133-85057155 TGCAGGGGTCTCTTTTATAAGGG + Intergenic
1011223834 6:85085527-85085549 CCCTTCGACCTCTTTTATAAGGG - Intergenic
1011384619 6:86781857-86781879 CTCTCAGGCCTCTTTTATACGGG + Intergenic
1011441377 6:87390951-87390973 GCCTGGGGTCTCTTTTATAAGGG + Intronic
1011520049 6:88194958-88194980 GTCTGGGGCCTATTTTATAAAGG - Intergenic
1012166246 6:95956278-95956300 TTCTAGGGACTCTTTTATAAGGG + Intergenic
1012181616 6:96161264-96161286 TCCTTGAGCCTATTTTATAAGGG - Intronic
1012326596 6:97927406-97927428 CCCTCAAACCTCTTTTATAATGG + Intergenic
1012357489 6:98333664-98333686 TCTCTGGGTCTCTTTTATAAGGG + Intergenic
1012448241 6:99328331-99328353 CTCTGGGGTCTCTTTTATAAGGG - Intronic
1012519471 6:100103621-100103643 TTTTGGGGCCTCTTTTACAAAGG + Intergenic
1012541675 6:100368485-100368507 TCTCCGGGCCTCTTTTATAATGG - Intergenic
1012969147 6:105707963-105707985 CTCTAGGGCCTCTTTTCTAAGGG - Intergenic
1013250378 6:108327557-108327579 CCCTCAGGCCTCTTTTGTAAGGG + Intronic
1013339780 6:109202287-109202309 CTCTCAGGCTTCTTTTATAAGGG + Intergenic
1013340100 6:109205590-109205612 CCCTCAGGCCTCTTTTGTAAGGG + Intergenic
1013374989 6:109506001-109506023 CCCTCAAGCCTCTTCTATAAGGG + Intronic
1013632060 6:111995556-111995578 CCCTCTGGCTTCTTTTATATGGG + Intergenic
1014056666 6:117024031-117024053 CTCTGGGGCCTCTTTTACAATGG - Intergenic
1014056764 6:117025059-117025081 CCCTTGGGCCTCTTTTATAGAGG + Intergenic
1014244617 6:119054469-119054491 CCCTTGGACCTCTTTTATAAGGG + Intronic
1014302660 6:119701798-119701820 CTCTCGGGCCTCTATTATAAAGG - Intergenic
1014303478 6:119712271-119712293 CCCTCAAGCCTCTTTTATAAGGG - Intergenic
1014381084 6:120743264-120743286 CTCTGGGGCCTCTTTCATAAAGG - Intergenic
1014580771 6:123134825-123134847 TCCTCAACCCTCTTTGATAAGGG - Intergenic
1014612599 6:123562432-123562454 CTCTTAGGCCTCTTTTATAAGGG - Intronic
1014661405 6:124177735-124177757 CCGTTGCGCCTCTTTTATAAAGG - Intronic
1014774895 6:125497383-125497405 CTCTTGGGCCTCTTTTATACAGG - Intergenic
1014808946 6:125863822-125863844 GTCTTTGGCCTCTTTTATAAGGG + Intronic
1014847683 6:126298700-126298722 CTCTCATGCCTCTTTTATAAGGG + Intergenic
1014912311 6:127109675-127109697 TCCTGGAGCCACTTTTATAAGGG + Intergenic
1014947150 6:127512826-127512848 TCCTTGGGATTCTTTTTTAAAGG + Intronic
1015345000 6:132145966-132145988 CCCCCAGGCCTCTTTTATAATGG - Intergenic
1015429336 6:133112432-133112454 CTCTGGGGCCTTTTTTATAAGGG - Intergenic
1015560181 6:134506079-134506101 CTCTGGGGGCTCTTTTATAAGGG + Intergenic
1015634609 6:135263350-135263372 CTCTTGAGCCTCTTTTATAAGGG + Intergenic
1015776374 6:136818894-136818916 CTCTCCAGCCTCTTTTATAAAGG + Intergenic
1015797242 6:137025288-137025310 CTCTGGGGCCTCTTTTATAAGGG - Intronic
1015803997 6:137090271-137090293 TTCTGGGGTCCCTTTTATAAGGG - Intergenic
1016256332 6:142109823-142109845 CCCTTGGGCCTCTTTTATGAGGG - Intergenic
1016304072 6:142665195-142665217 CTCTGGGGCCTGTTTTATAAGGG + Intergenic
1016443184 6:144105976-144105998 CTCTTGGGCCTCTTTTATGAAGG + Intergenic
1016507252 6:144796246-144796268 ATCTTGGGCCTCTTTTATAAGGG + Intronic
1016526495 6:145007199-145007221 CCCTTGGACTTCTTTTATAAAGG - Intergenic
1016646511 6:146415236-146415258 CCCTGGGGTCTCTTTCATAAAGG + Intronic
1016980360 6:149848149-149848171 ACATGGGACCTCTTTTATAAGGG - Intronic
1017087286 6:150725212-150725234 CCCTCTGTCCTCTTTTATAAGGG + Intronic
1017187493 6:151616838-151616860 CTCCGGGGCCTCTTTTATAAGGG + Intronic
1017346762 6:153391826-153391848 CTCTAGCGCCTCTTTTATAAAGG - Intergenic
1017399889 6:154047980-154048002 CTCTAGGGCCTCTTTCATAAGGG + Intronic
1017583906 6:155898833-155898855 TTGTCGGGCCTCTTGTATGAAGG - Intergenic
1017807638 6:157959903-157959925 CCCTTGGGCCTCTTTTATAAGGG - Intergenic
1017852354 6:158315826-158315848 TCCTTGGGCCTATCTTACAAGGG + Intronic
1017904280 6:158746118-158746140 TCTTCGGGCCTCTTTTATGAGGG + Intronic
1018072681 6:160179404-160179426 TCCCCAGGCCTCTTTTATAAGGG + Intronic
1018230302 6:161669073-161669095 CTCTCAGGCCTCTTCTATAAGGG - Intronic
1018275724 6:162128766-162128788 CTCTGGGGCCTCTTTTATAAGGG - Intronic
1018459156 6:163981050-163981072 CCCTCATGCCTCTTTTATCAGGG + Intergenic
1018564145 6:165133761-165133783 TCCTTGGACCTCTTTTATTAGGG - Intergenic
1018753255 6:166825719-166825741 TTCTGGGGTCTCCTTTATAAGGG + Intronic
1018759680 6:166881797-166881819 CTCTCATGCCTCTTTTATAAGGG + Intronic
1018805451 6:167255865-167255887 CCCTCCAGTCTCTTTTATAAGGG + Intergenic
1019068749 6:169324523-169324545 CTCTGGGGTCTCTTTTATAAGGG + Intergenic
1019124761 6:169830794-169830816 CCCTGGGGCCTCTTTTGTAGGGG + Intergenic
1019271796 7:153536-153558 AGCTCAGGCCTCGTTTATAAGGG + Intergenic
1020366579 7:7387003-7387025 CCCTGGGGCCTCCTTTATAAGGG + Intronic
1020496842 7:8864773-8864795 TCATTGGGCCTCTTTCCTAACGG + Intergenic
1021042538 7:15880912-15880934 TTCTGGGGTCTCCTTTATAAGGG + Intergenic
1021342496 7:19481287-19481309 CTCTGGGGCCTCTTTTATAAGGG - Intergenic
1021525391 7:21580684-21580706 CTCTCAGGCCTCTTTTATATGGG + Intronic
1021767311 7:23962927-23962949 CCCCTGGGCCTCTTGTATAAGGG - Intergenic
1021950871 7:25773563-25773585 CTCTGGGGCCTCTTTTAAAAAGG - Intergenic
1021966103 7:25920664-25920686 GCCTTGGGCCTATTTTATAAGGG - Intergenic
1022002367 7:26238059-26238081 ATCTGGGGCCTCTTGTATAAGGG - Intergenic
1022059855 7:26782766-26782788 CTCTAGGGCCTCTTTTATGAGGG - Intronic
1022224203 7:28346386-28346408 CTCTGGGGCCTCTTTTACAATGG + Intronic
1022386807 7:29907611-29907633 CCCTCATGCCTATTTTATAAGGG - Intronic
1022829482 7:34051139-34051161 CTCTGGAGCCTCTTTTATAAGGG + Intronic
1022863996 7:34398431-34398453 TTCTTGGGTCTCTTTTATAAGGG + Intergenic
1023062440 7:36341597-36341619 CCCTGGGGCCTCTTTTATAAAGG - Intronic
1023508403 7:40924005-40924027 CCCTCAGACCTCTTTTATAAGGG - Intergenic
1023559083 7:41453458-41453480 CTCTAGGGCCTCTTTAATAAAGG - Intergenic
1023563277 7:41497721-41497743 CTCTGGGGCCTCTTTTGTAAGGG - Intergenic
1023594273 7:41812477-41812499 TCCTCGGGCTTCTATTCTTAAGG + Intergenic
1023602502 7:41893602-41893624 CTCTGGGGCCTCTTTTATAAAGG - Intergenic
1023603416 7:41903883-41903905 TCCTGTGGCCTCTTTTATAAAGG + Intergenic
1023641059 7:42258734-42258756 CCCTTGGGCTTGTTTTATAAGGG + Intergenic
1023724180 7:43125130-43125152 TTCTGGGGCCTCTTTTATAAGGG + Intronic
1023988869 7:45115955-45115977 CCCTCGGGCCTCTTTTATAAGGG - Intergenic
1024009102 7:45252636-45252658 CTCTCGGGCCTTTTTTATGAAGG + Intergenic
1024133906 7:46387252-46387274 CCCTTGGGCCTATTTTATAAGGG - Intergenic
1024196991 7:47068992-47069014 TTCTGGGGCCCCTTTTATAAAGG - Intergenic
1024218786 7:47270795-47270817 CCCTTGGGCCTCTATAATAAGGG + Intergenic
1024338999 7:48238177-48238199 TCCCTGGGTCTCTTTTATCAGGG + Intronic
1024436688 7:49364851-49364873 CTCTGAGGCCTCTTTTATAAAGG - Intergenic
1024482009 7:49873370-49873392 CTCTTGGGCCTCTTTCATAATGG + Intronic
1024700306 7:51899363-51899385 TCCCTGGGTCTCTTTTATAAGGG + Intergenic
1024716340 7:52083476-52083498 TGCTTGAGCCTCTTTTACAAGGG + Intergenic
1024717883 7:52101314-52101336 CTCTCGGGCCTCTTTTACAAGGG - Intergenic
1024760846 7:52594653-52594675 CCCTCAGGCCTATGTTATAAAGG - Intergenic
1024904752 7:54363933-54363955 CCCTTGGGCCTCATTTATAAGGG + Intergenic
1025009983 7:55388819-55388841 TCCTCAGGCCTCATTTACAGTGG + Intronic
1026105174 7:67415157-67415179 CTCTCAGGTCTCTTTTATAAAGG + Intergenic
1026182446 7:68053917-68053939 CCTTTGGGCTTCTTTTATAAGGG - Intergenic
1026244430 7:68606188-68606210 CCCTCAGGCCTCTTTTATAAGGG - Intergenic
1026248006 7:68640054-68640076 CTCTAGGGCCTCTTTTATAGGGG - Intergenic
1026425042 7:70282523-70282545 TCCTAGGGCCTTTTTTCTAAAGG + Intronic
1027468974 7:78550015-78550037 GACTTGGGCCTCTTTTGTAAAGG - Intronic
1027617657 7:80443685-80443707 CTCTGGGGCCTCTTTTATAATGG + Intronic
1027736256 7:81936373-81936395 TCCTCCTGTGTCTTTTATAAGGG - Intergenic
1027840825 7:83308676-83308698 TTCTATAGCCTCTTTTATAAAGG + Intergenic
1028245917 7:88477149-88477171 TTTTTAGGCCTCTTTTATAAGGG - Intergenic
1028416788 7:90589185-90589207 TCCTGGGGCCTCTTTCATAAAGG - Intronic
1028564419 7:92212522-92212544 TCTTGGGGTCCCTTTTATAAAGG - Intronic
1028635460 7:92984390-92984412 CCCTCAGGCTTCTTTTATAAGGG + Intergenic
1028636400 7:92994278-92994300 CCCTGGGGCCTCCTTTATAAGGG - Intergenic
1028666665 7:93351620-93351642 TCTCTGGGGCTCTTTTATAAGGG + Intronic
1028766761 7:94568767-94568789 CTCTGGGGCTTCTTTTATAAGGG - Intergenic
1029439840 7:100581510-100581532 CTCTGGGGCCTCTTTGATAAAGG - Intronic
1029859025 7:103549342-103549364 CACTGGGGTCTCTTTTATAAGGG + Intronic
1030203453 7:106929091-106929113 CTCTTGGGCCTCTTTTATGAGGG + Intergenic
1030247917 7:107405831-107405853 CCCTCAAGCTTCTTTTATAAGGG - Intronic
1030422170 7:109321193-109321215 CCCTCTTGCCTCTTTTGTAAGGG + Intergenic
1030604477 7:111625093-111625115 CTCTGGGGCCTCTTTTATAAGGG + Intergenic
1030618953 7:111768984-111769006 CTCTGGGGCCTCTTTTATAAGGG - Intronic
1030771943 7:113485846-113485868 TTCTGGGCCATCTTTTATAAAGG - Intergenic
1030865996 7:114702413-114702435 CTCTGGGGCCTCTTTTGTAAGGG - Intergenic
1031308940 7:120169198-120169220 CTCTGGGGCCTCTTCTATAAAGG + Intergenic
1031408548 7:121414587-121414609 CCCTAGGGCCTCTTTTATAAGGG + Intergenic
1031523244 7:122792336-122792358 GCCTAGAGCCTCCTTTATAAGGG - Intronic
1031628579 7:124019276-124019298 CTCTCAGGCTTCTTTTATAAGGG - Intergenic
1031642140 7:124178371-124178393 CTCTGGGGCCTCATTTATAAGGG + Intergenic
1032609269 7:133393623-133393645 CTCTGGGGCCTCTTTTACAAGGG - Intronic
1032696191 7:134338572-134338594 CCCTGGGGCCTGATTTATAAGGG + Intergenic
1032761894 7:134951106-134951128 TCCTTAGGCCTCTTTTATAAGGG + Intronic
1032790781 7:135241016-135241038 CCCTCAGGACTCTTTTATAAGGG + Intronic
1032792554 7:135253232-135253254 CTCTGGGGCCTGTTTTATAAGGG + Intronic
1033283739 7:140023494-140023516 TGGAAGGGCCTCTTTTATAAAGG - Intergenic
1033625028 7:143101909-143101931 TTCTGAAGCCTCTTTTATAAGGG + Intergenic
1033770148 7:144541554-144541576 CTCTCAGGCCTCTTTTATAAGGG + Intronic
1033773552 7:144581116-144581138 CTCTAGGGCCTCTTTTTTAAAGG - Intronic
1033944809 7:146703691-146703713 CCCTCAGGTCTCTTTTATAAGGG + Intronic
1034032499 7:147783737-147783759 CTCTGGGGTCTCTTTTATAAGGG - Intronic
1034056867 7:148044554-148044576 TCCTTGGGCCTCTTTTGTCTGGG - Intronic
1034071644 7:148191674-148191696 TCTCTGGGTCTCTTTTATAAGGG + Intronic
1034232052 7:149538077-149538099 CTCTCAGGCCTCTTCTATAAGGG - Intergenic
1034481882 7:151328046-151328068 CTCTGTGGCCTCTTTTATAAGGG - Intergenic
1034716441 7:153247018-153247040 CCCTTAGGCCTCATTTATAAGGG - Intergenic
1034786254 7:153928612-153928634 TCCTTTGGGCTCTTTTATCAGGG + Intronic
1035000687 7:155610189-155610211 TTCTGGGGTCTCTTTTAGAAAGG + Intergenic
1035794743 8:2344418-2344440 CTCTGGGGCCTCTTTTAAAAGGG - Intergenic
1036161491 8:6393011-6393033 CCCTGGGGCCTCCTTTATAAGGG - Intergenic
1036279066 8:7383708-7383730 CCTTCAGGCCTCTTTTATAAGGG - Intronic
1036342451 8:7928166-7928188 CCTTCAGGCCTCTTTTATAAGGG + Intronic
1036436063 8:8734576-8734598 CTCTGGGACCTCTTTTATAAGGG - Intergenic
1036439209 8:8765506-8765528 CCCTCAGGCCTCTTTTATAAGGG + Intergenic
1036589749 8:10158104-10158126 TGGAAGGGCCTCTTTTATAAGGG + Intronic
1036915846 8:12803041-12803063 CCCTCAGGCTTCTTTTATAAGGG + Intergenic
1037002029 8:13731711-13731733 CCCTGCTGCCTCTTTTATAAGGG - Intergenic
1037272211 8:17142454-17142476 TGCTGGGGCCTCTTTTATAAGGG - Intergenic
1037555591 8:20018997-20019019 CTCTGGGGCCTCTTTCATAAGGG - Intergenic
1037649695 8:20825168-20825190 CCCTGGGGCCTCTTTTATCAGGG + Intergenic
1037692555 8:21194498-21194520 CCCTGGGGCCACTTTTATAAAGG + Intergenic
1038141192 8:24847269-24847291 CTCTCGGGTCTCTCTTATAAGGG - Intergenic
1038143985 8:24876818-24876840 CCCTGGGGCCTATTTTATAAGGG + Intergenic
1038161769 8:25046408-25046430 CCCTCAAGCCTCTTTTTTAAGGG - Intergenic
1038286830 8:26212773-26212795 CTCTGGGGTCTCTTTTATAAGGG - Intergenic
1038291317 8:26252261-26252283 CCCTTGGGTCTCTTTTATTAGGG + Intergenic
1038340535 8:26681652-26681674 TCCTCAAGCCTCTTGTGTAAGGG - Intergenic
1038532253 8:28327966-28327988 CTCTGGGGCCTCTTTTATAAGGG + Intronic
1038684740 8:29706128-29706150 TACTTGAGCCTCTTTTATAAGGG + Intergenic
1039029687 8:33295908-33295930 CTCTCAGACCTCTTTTATAAGGG + Intergenic
1039083683 8:33758982-33759004 TCCTTAGGGCTCTTTTATAAGGG + Intergenic
1039099750 8:33928516-33928538 CTCTGGGGTCTCTTTTATAAGGG + Intergenic
1039594102 8:38775577-38775599 GTCTGGGGTCTCTTTTATAAGGG + Intronic
1039824338 8:41160374-41160396 TCCTTGGGCTTCTTTTGTAAGGG - Intergenic
1040021407 8:42744580-42744602 CTCTGGGGTCTCTTTTATAACGG + Intergenic
1040638106 8:49299454-49299476 CTCTGGGGCCTCTTTTATGAGGG + Intergenic
1040717237 8:50271936-50271958 CCCTGGGGTCTCTTTTATGAGGG - Intronic
1040852824 8:51919502-51919524 CTCTGGGGTCTCTTTTATAAGGG + Intergenic
1041114222 8:54518834-54518856 CCCTGGGACCTCTTTCATAAGGG - Intergenic
1041264219 8:56047985-56048007 GCCTGGAGCCTCTTTTATAAGGG + Intergenic
1041517272 8:58714318-58714340 TTCTGGGGCCTCTTTTATAAAGG - Intergenic
1041640862 8:60200095-60200117 TTCTGGGGTCTCTTTTATAAGGG - Intronic
1041658104 8:60374626-60374648 TCCTTGGGCCTGTTTTATAAGGG - Intergenic
1041714253 8:60919856-60919878 CTTTCAGGCCTCTTTTATAAGGG + Intergenic
1041737738 8:61129691-61129713 CCCTGAGGCCTCTTTTATGAGGG + Intronic
1041742803 8:61175278-61175300 CTCTGGGGCTTCTTTTATAAGGG - Intronic
1041756616 8:61320712-61320734 CTCTAGGGCCTCTTTTATAAGGG + Intronic
1041883682 8:62783270-62783292 TTCTGGGGGCTCTTTTATAAGGG - Intronic
1041931387 8:63291294-63291316 CTCTGGGGCCTCCTTTATAAGGG + Intergenic
1042077040 8:65007551-65007573 GCCTGGGGCCTCTTTTATAAGGG + Intergenic
1042114312 8:65414553-65414575 TTTTGGGGTCTCTTTTATAAGGG + Intergenic
1042365963 8:67936671-67936693 CCCTCATGCCTCTTTCATAAGGG + Intergenic
1042425531 8:68643640-68643662 TTCTGGGGTCTTTTTTATAAGGG + Intronic
1042426443 8:68654128-68654150 TCCTTAGGCCTCTTTTATAAGGG - Intronic
1042473013 8:69212911-69212933 CTCTGGGGGCTCTTTTATAAGGG - Intergenic
1042520490 8:69706538-69706560 CTTTCAGGCCTCTTTTATAAGGG - Intronic
1042819417 8:72914160-72914182 CTCCTGGGCCTCTTTTATAAGGG + Intronic
1043011652 8:74888534-74888556 CTCTCAGGCTTCTTTTATAAGGG + Intergenic
1043056222 8:75443087-75443109 TTCTAGGGCCTCTGTTATAAAGG - Intronic
1043463070 8:80480138-80480160 TCCACAAGCCTCTTTTATAAGGG + Intergenic
1043530377 8:81143406-81143428 TCATAAAGCCTCTTTTATAAGGG - Intergenic
1043604010 8:81977321-81977343 CTCTGGGGTCTCTTTTATAAGGG - Intergenic
1043756658 8:84012040-84012062 TTCTCAGGCTTCTTTTATAAGGG - Intergenic
1043940214 8:86188573-86188595 CTCTTGGGCCTCTTTTATAAGGG + Intergenic
1044064433 8:87682269-87682291 TCCTGGGGTCTCTTATATAAGGG - Intergenic
1044097062 8:88079774-88079796 CTCTAGGGCCTCTTTTATAAGGG - Intronic
1044213427 8:89579073-89579095 CCCTAGGGCCTCTTTTACAAGGG - Intergenic
1044220702 8:89665605-89665627 CCCCTAGGCCTCTTTTATAAAGG - Intergenic
1044223299 8:89695535-89695557 CTCTGGGGTCTCTTTTATAAGGG - Intergenic
1044351681 8:91173793-91173815 TCCTTGGGAATCTTTTATAAGGG + Intronic
1044415564 8:91935371-91935393 CTCTGGGACCTCTTTTATAAGGG + Intergenic
1044537492 8:93374235-93374257 CTCTAGGGCCTCTTTTATAAGGG + Intergenic
1044548139 8:93482302-93482324 CTCTCAGGCTTCTTTTATAAGGG - Intergenic
1044631875 8:94288077-94288099 CCCTGGGGCCTCTTTTATAAGGG + Intergenic
1044639602 8:94364953-94364975 CTCTTGGGCCTCTTTTATAAAGG - Intergenic
1044662412 8:94604558-94604580 CTCTTGGGCCTCTTTTATAAGGG + Intergenic
1044791635 8:95853436-95853458 CCCTCAGACCTCTTTTCTAAGGG + Intergenic
1045100005 8:98834675-98834697 TCCTCAGACCTCTTTTGTAAGGG + Intronic
1045100212 8:98836369-98836391 TCCTCAGACCTCTTTTGTAAGGG + Intronic
1045395275 8:101754543-101754565 CTCTGGGGCCTCTTTTATAAGGG + Intronic
1045731473 8:105246823-105246845 TCCTCTGGCCTCTTTTATAAGGG - Intronic
1045778792 8:105839059-105839081 TCTCTGGGGCTCTTTTATAAGGG - Intergenic
1046169008 8:110480522-110480544 CTCTCAAGCCTCTTTTATAAGGG - Intergenic
1046308619 8:112403623-112403645 TCCTCAGACTTCTTTTATAAAGG + Intronic
1046616300 8:116481215-116481237 TACTGAGGTCTCTTTTATAAGGG + Intergenic
1046849498 8:118956141-118956163 CTCTGGGGTCTCTTTTATAAGGG + Intergenic
1046902353 8:119536853-119536875 TCCTCGGGCCTCTTTTATAAGGG - Intergenic
1047118337 8:121870594-121870616 CTCTGGGGTCTCTTTTATAAAGG + Intergenic
1047197594 8:122735564-122735586 TCCCCAGGCCTCTTTTATAAGGG + Intergenic
1047373322 8:124274080-124274102 CCCCCAGGCCTCTTTAATAAGGG - Intergenic
1047470663 8:125168616-125168638 CTCTGGGGCCTCTTTTATGATGG + Intronic
1047539263 8:125748421-125748443 TTCTGGGGCCTGTTTTATAAGGG + Intergenic
1047632590 8:126724551-126724573 CTCTTGGGCCTCTTTTATAAAGG - Intergenic
1047694034 8:127385199-127385221 TCATGGGGCCTCTTCTTTAAGGG - Intergenic
1048040332 8:130721500-130721522 CCCTCAGGCCTCTTTCATAAGGG - Intergenic
1048218500 8:132518981-132519003 GTCTGGGGCCTCTTTTATAAGGG - Intergenic
1048347061 8:133584012-133584034 TCCTTGGGCCTCATTTATAAGGG - Intergenic
1048431363 8:134374580-134374602 ATCTGGGGTCTCTTTTATAAGGG - Intergenic
1048593945 8:135846716-135846738 CTCTCAGGCCTCTTTTATAAGGG + Intergenic
1048661699 8:136610983-136611005 CCCTCAGGCCTCTTTTATGAGGG + Intergenic
1048835020 8:138510693-138510715 CCCTTGAGCCTCTTTTGTAAGGG + Intergenic
1048841802 8:138573075-138573097 CCCTTGGGCTTCTTTTATAAGGG + Intergenic
1049804913 8:144534369-144534391 TCCTTGGGCCTCTGCTCTAAAGG - Intronic
1049890794 9:68886-68908 CTCTGGGGCCTCTTTTATAAGGG - Intergenic
1050005796 9:1128954-1128976 CTCAGGGGCCTCTTTTATAAGGG - Intergenic
1050095169 9:2057297-2057319 TCTCCGGGCTTCCTTTATAAGGG + Intronic
1050613080 9:7373323-7373345 CTCTGGGGCCTCTTTTACAAGGG - Intergenic
1050971619 9:11883840-11883862 CTCTTGGACCTCTTTTATAAGGG - Intergenic
1051236161 9:15001503-15001525 TTTTAAGGCCTCTTTTATAAGGG - Intergenic
1051244085 9:15091596-15091618 CTCTGGAGCCTCTTTTATAAGGG - Intergenic
1051331637 9:16030061-16030083 CTCTGGGGCCTCTTTTTTAAGGG + Intronic
1051829601 9:21260853-21260875 CTCTGGGGTCTCTTTTATAAGGG - Intergenic
1051877247 9:21805660-21805682 CTCTGGGGCCTCTTTTGTAAGGG - Intronic
1051910698 9:22152162-22152184 TTGTGGGGTCTCTTTTATAAGGG - Intergenic
1052071527 9:24087670-24087692 CCTTTGGGCCTCTTTTGTAAGGG + Intergenic
1052352771 9:27473948-27473970 TTCTGGGGTCCCTTTTATAATGG - Intronic
1052399120 9:27978480-27978502 TTCTGGGGTCCCTTTTATAAGGG - Intronic
1052431413 9:28371475-28371497 CCCTTGGGCCTCTTTTATAAGGG + Intronic
1053034887 9:34816619-34816641 CTCTGGGGACTCTTTTATAAGGG + Intergenic
1053096924 9:35336661-35336683 CCTGTGGGCCTCTTTTATAAAGG + Intronic
1053181773 9:35978220-35978242 CTCTAGGGCCTCGTTTATAAGGG - Intergenic
1053446267 9:38155495-38155517 CTCTGGGGCCTCTTTTATAAGGG + Intergenic
1053558643 9:39165141-39165163 CTCTTGGGCCTCTTTTATAAGGG + Intronic
1053581032 9:39404253-39404275 TCCTAGGGCCTCTTAGATAAGGG + Intergenic
1053732259 9:41070072-41070094 CTCTGGGGCCTCTTTTATAAGGG - Intergenic
1053822769 9:41985373-41985395 CTCTTGGGCCTCTTTTATAAGGG + Intronic
1053845524 9:42232310-42232332 TCCTAGGGCCTCTTAGATAAGGG + Intergenic
1054102619 9:60963057-60963079 TCCTAGGGCCTCTTAGATAAGGG + Intergenic
1054138468 9:61453800-61453822 CTCTTGGGCCTCTTTTATAAGGG - Intergenic
1054583741 9:66943809-66943831 TCCTAGGGCCTCTTAGATAAGGG - Intergenic
1054607806 9:67201992-67202014 CTCTTGGGCCTCTTTTATAAGGG - Intergenic
1054696193 9:68361645-68361667 CTCTGGGGCCTCTTTTATAAGGG + Intronic
1054739929 9:68794916-68794938 CCCTCAGTCCTCTTTTGTAAAGG - Intronic
1054866888 9:70012020-70012042 TCCTTGGGCTTTCTTTATAATGG + Intergenic
1054869426 9:70035774-70035796 CTCTTGGGCCTCTTTTATAAGGG - Intergenic
1054929584 9:70622103-70622125 GCATTGAGCCTCTTTTATAAGGG - Intronic
1054941577 9:70748608-70748630 TCCTCAGGCCTTTTTCGTAAGGG - Intronic
1054972046 9:71099250-71099272 TTCTGGAGCCTCTTTTGTAAGGG + Intronic
1055057594 9:72038117-72038139 CTCTGGGGTCTCTTTTATAAAGG - Intergenic
1055235615 9:74119259-74119281 CTCTGAGGCCTCTTTTATAAGGG + Intergenic
1055370554 9:75593742-75593764 CTCTGGGGTCTCTTTTATAAGGG - Intergenic
1055390366 9:75815306-75815328 CTCTTGGGCCTCTTTTATAAGGG + Intergenic
1055466420 9:76571009-76571031 CCCTTGGACCTATTTTATAAGGG + Intergenic
1055702962 9:78966225-78966247 TTGTGGGGCCTCTTTTATAAGGG - Intergenic
1055731464 9:79282992-79283014 GCCTGGGGTCTCTTTTATACGGG - Intergenic
1055874211 9:80923119-80923141 GCCTGGGGGCTCTTTTATAAAGG - Intergenic
1056222951 9:84468006-84468028 GCCTCGTGCCTCTTTCATAAGGG - Intergenic
1056244735 9:84682999-84683021 CTCTCTGGCCTCTCTTATAAAGG + Intronic
1056335317 9:85562941-85562963 TTATGGGGTCTCTTTTATAAGGG - Intronic
1056461165 9:86810906-86810928 TCTCTGGGTCTCTTTTATAAGGG - Intergenic
1056495347 9:87149812-87149834 CTCTGGGGCCTTTTTTATAAGGG - Intronic
1056730703 9:89163939-89163961 CTCTGGGACCTCTTTTATAAGGG + Intronic
1056782155 9:89558798-89558820 CTCTGGGGCCTCTTTTATAAGGG + Intergenic
1056893188 9:90515221-90515243 CCCTCAGGCCTCTTTTATAAAGG + Intergenic
1056905586 9:90644925-90644947 CTCTGGGCCCTCTTTTATAAGGG - Intergenic
1056941839 9:90962616-90962638 CTCTTGGGCCTCTTGTATAAGGG + Intergenic
1057565989 9:96166737-96166759 CTCCAGGGCCTCTTTTATAAAGG - Intergenic
1058188419 9:101883869-101883891 TTCTGGGGACTCTTTTGTAAGGG - Intergenic
1058227546 9:102383879-102383901 TTCTTTGGCCTCTTTCATAAGGG + Intergenic
1058335858 9:103828208-103828230 TTCTAGGGCCTCTTTTATAAGGG - Intergenic
1058608395 9:106748450-106748472 TCCTCAGTCCTCTTTCATAAGGG + Intergenic
1058785120 9:108379341-108379363 CCCTTGGACCTATTTTATAAGGG - Intergenic
1058794802 9:108487863-108487885 CTCTGGGGTCTCTTTTATAAGGG + Intergenic
1058827607 9:108788776-108788798 CTCTAGAGCCTCTTTTATAAGGG + Intergenic
1058886386 9:109324518-109324540 GCTTGGGGTCTCTTTTATAAGGG - Intergenic
1059038157 9:110781785-110781807 TTCTTGGACCTCTTTTATAAGGG + Intronic
1059142946 9:111871125-111871147 CCCTTGAGCCTGTTTTATAAGGG - Intergenic
1059207365 9:112479459-112479481 TTCCTGGGCCTCTTTTATAAGGG - Intronic
1059352629 9:113676539-113676561 TCCTCTGGCTTCTCTTATAGAGG - Intergenic
1059465154 9:114464486-114464508 TCTTGGAGCCTCTTTTATAAGGG + Intronic
1059908057 9:119010397-119010419 CTCTGGGGCCTCTTTTATAAGGG + Intergenic
1059965333 9:119608286-119608308 TTCTGGAGCCTCTTTTGTAAGGG - Intergenic
1060243805 9:121926986-121927008 CTCTCGGGCCCCTTTTATAAAGG + Intronic
1060706991 9:125811992-125812014 CCCTTGGGCCTATTTTACAAGGG - Intronic
1060768108 9:126309978-126310000 CCTTGGTGCCTCTTTTATAAGGG - Intergenic
1061089393 9:128418496-128418518 CCCCCAGGCCTCTTTTATAAGGG + Intronic
1061223745 9:129267863-129267885 CTCTGGGGCCTCTTCTATAAGGG - Intergenic
1061266687 9:129509864-129509886 CTCTGGGGCCTCTTTTATAAGGG + Intergenic
1061277005 9:129574774-129574796 CCCTGGAGCCTCTTTAATAAGGG - Intergenic
1061283048 9:129608430-129608452 GCCTCGGGCCTCTTTTATAAGGG + Intergenic
1061316406 9:129798922-129798944 TCCTCAAGCCCTTTTTATAAGGG + Intergenic
1062333768 9:136056070-136056092 CCCTAGGGCCTCTTTTCTGAAGG - Intronic
1185636199 X:1553946-1553968 GCCTGGGGTCCCTTTTATAAGGG - Intergenic
1185758072 X:2667985-2668007 CTCTGGGGCCCCTTTTATAAGGG - Intergenic
1185815980 X:3156425-3156447 CTCTGGGGTCTCTTTTATAAGGG - Intergenic
1185845331 X:3432530-3432552 TCTCTGGGTCTCTTTTATAAGGG + Intergenic
1186170557 X:6872044-6872066 TTCTGGGGTCTCTTTCATAAGGG + Intergenic
1186258661 X:7751374-7751396 CTCTGCGGCCTCTTTTATAAGGG - Intergenic
1186313908 X:8348559-8348581 CTCTGGGGTCTCTTTTATAAGGG + Intergenic
1186732969 X:12429847-12429869 CCCTGAAGCCTCTTTTATAAGGG - Intronic
1186804090 X:13122326-13122348 TCCTGGGGTTTCTTTTATAAGGG - Intergenic
1186836205 X:13441044-13441066 CCCTCTAGCCTCTCTTATAAGGG + Intergenic
1186987562 X:15033240-15033262 CTCTGGGACCTCTTTTATAAGGG - Intergenic
1187057903 X:15758357-15758379 TTCTCAAGCCTCTTTTATAAGGG + Intronic
1187105505 X:16237489-16237511 CCCCAGAGCCTCTTTTATAAGGG + Intergenic
1187523582 X:20034596-20034618 CTCTGGGGTCTCTTTTATAAGGG - Intronic
1187609371 X:20924560-20924582 TCTTCAAGCCTCTTTTATAAGGG - Intergenic
1187768801 X:22672258-22672280 CTCTCAGGCCTGTTTTATAAGGG - Intergenic
1187948372 X:24448260-24448282 CTCTGGGGCCTCTTTTATAAGGG + Intergenic
1188134064 X:26472399-26472421 TACCAGGGTCTCTTTTATAAAGG - Intergenic
1188431954 X:30113610-30113632 TTCTCAGGCCTGTTATATAATGG + Intergenic
1188556523 X:31418289-31418311 TCTCTGGGTCTCTTTTATAAGGG + Intronic
1188584567 X:31757636-31757658 TTCTGGAGCCGCTTTTATAAGGG + Intronic
1188622235 X:32240363-32240385 GTCTTGGGCCTCTTTTGTAAGGG - Intronic
1188691650 X:33136621-33136643 TCCCTTGGCCTCTTTTATAAGGG - Intronic
1188703769 X:33300637-33300659 CTCTTGGGCCTCTCTTATAAGGG - Intronic
1188705154 X:33319032-33319054 CTCTAGGGTCTCTTTTATAAGGG - Intronic
1188746450 X:33850667-33850689 TCTTTGGGGCTCTTTTATAAGGG + Intergenic
1189178461 X:38981187-38981209 CCCCAGGGTCTCTTTTATAAGGG - Intergenic
1189256855 X:39646607-39646629 CTCTGAGGCCTCTTTTATAAGGG - Intergenic
1189351153 X:40276791-40276813 CCCTTGGGCCTCTTTTATAAGGG - Intergenic
1189374769 X:40458429-40458451 CTCTGGGGCCTCTTTGATAAGGG + Intergenic
1189394932 X:40612933-40612955 TCCTTCCGGCTCTTTTATAAGGG + Intergenic
1189420877 X:40856652-40856674 CTCTGGGGTCTCTTTTATAAGGG - Intergenic
1189554208 X:42125545-42125567 TTCTGGGGTCTCCTTTATAACGG + Intergenic
1189768815 X:44401295-44401317 TCCTCAGGTCTCTTTTACAAGGG - Intergenic
1189880647 X:45487916-45487938 ACCTCAAGCTTCTTTTATAAGGG - Intergenic
1189885469 X:45540085-45540107 TCCTTGGTCCTCTTTTTTTATGG + Intergenic
1190073139 X:47295214-47295236 TCCTTGGGCCTGTTTCATAAGGG - Intergenic
1190412582 X:50151575-50151597 TTCTGGGGTTTCTTTTATAAGGG - Intergenic
1190421619 X:50290394-50290416 TCCTCGGGCCTCTTTTATAAGGG + Intronic
1190434482 X:50409856-50409878 CTCTGGGGTCTCTTTTATAAGGG - Intronic
1190537167 X:51440813-51440835 CTCTGGGGCCTCTTTTATAAGGG - Intergenic
1190895903 X:54617700-54617722 CCTTCAGGCCTCTTTCATAAAGG - Intergenic
1191044139 X:56117999-56118021 CTCTAAGGCCTCTTTTATAAGGG + Intergenic
1191699229 X:64021583-64021605 CTCTGGGGCCTCTTTTATAAGGG - Intergenic
1191885627 X:65884996-65885018 CCCAAGGGCCTATTTTATAAGGG - Intergenic
1192272168 X:69591297-69591319 TCCTCAAGCCTCTTTTATAAGGG - Intergenic
1192374167 X:70542216-70542238 CTCTAGGGTCTCTTTTATAAGGG - Intronic
1192533004 X:71905433-71905455 CTCTGGGGCCTCTTTTATAAAGG - Intergenic
1193136959 X:77983043-77983065 CTCTGGGACCTCTTTTATAAGGG + Intronic
1193987318 X:88259807-88259829 CCTTCAAGCCTCTTTTATAAAGG + Intergenic
1193997428 X:88383828-88383850 ATCTCAGGCCTCTTTTACAAGGG - Intergenic
1194334724 X:92630965-92630987 TCCTCAGGCCTCTTTTATAAGGG + Intergenic
1194395540 X:93379948-93379970 TGCTTGAGCCTCTTTTATAAAGG - Intergenic
1194731209 X:97457780-97457802 CCCTTGAGCCTCTTTTATAAGGG - Intronic
1194736705 X:97521092-97521114 CCCTCAGGCCTCTTCTGTAAGGG - Intronic
1194833183 X:98650468-98650490 CCTTCTGCCCTCTTTTATAAGGG - Intergenic
1194865079 X:99055206-99055228 TTCTGGGGTCTCTTTTATAAGGG - Intergenic
1194957587 X:100198718-100198740 CTCTTGGGCCTCTTTTATAAGGG - Intergenic
1195069818 X:101267949-101267971 CCCTCGGGCCTCTTTTAAAAGGG - Intergenic
1195269926 X:103219562-103219584 GTCTGGGGTCTCTTTTATAAGGG - Intergenic
1195407736 X:104535191-104535213 CCCTTAGGCTTCTTTTATAAGGG + Intergenic
1195430316 X:104781950-104781972 CCCTTGAACCTCTTTTATAAGGG - Intronic
1195462761 X:105145969-105145991 CCCTGAGGCCTCTTTTATGAGGG - Intronic
1195545021 X:106104502-106104524 TCCTTGGGCTTCTTTTATAAGGG + Intergenic
1195774961 X:108392737-108392759 TTCTTGGGCCCCTTTTATAAGGG - Intronic
1195819342 X:108926444-108926466 CCTTTGGGCCTCTTTTATTAGGG - Intergenic
1195939554 X:110156781-110156803 TCCTTGGGCATCTTTTATAAGGG + Intronic
1196021722 X:110997841-110997863 CTCTCAGGTCTCTTTTATAAGGG - Intronic
1196076733 X:111586046-111586068 CCATGGAGCCTCTTTTATAAGGG - Intergenic
1196129604 X:112140613-112140635 TCCTCAAGCCTTTTTTAAAAAGG + Intergenic
1196224695 X:113152062-113152084 TCTTCAGGCCTCTTTTATAAGGG - Intergenic
1196255374 X:113511954-113511976 CCGTGGGGCCCCTTTTATAAGGG - Intergenic
1196315116 X:114213289-114213311 TTCTTGGGCCTCTTTTCTGAGGG + Intergenic
1196372108 X:114990864-114990886 CCCATGGGCCTCTTTTATAAAGG - Intergenic
1196404066 X:115346195-115346217 CCCTCTGCCCTCTTTTATAAGGG - Intergenic
1196541321 X:116911821-116911843 TACTCAAGCCTCTTTTATGAGGG - Intergenic
1196731553 X:118946050-118946072 CCCTGAGGCCTCTTTTATGAGGG - Intergenic
1197332528 X:125171574-125171596 CTCTAGGGCCTCTTTTATAAGGG - Intergenic
1197394595 X:125910997-125911019 CCCTCAGGCCTCATTTATAAAGG + Intergenic
1197406544 X:126060118-126060140 CCCTGGGGTTTCTTTTATAAAGG - Intergenic
1197596033 X:128465125-128465147 CCCTCAAGCCTCTTTTATAAGGG - Intergenic
1197651809 X:129073336-129073358 CCCATGGGCCTCTATTATAAAGG - Intergenic
1197883060 X:131189600-131189622 CCCTCAAGCCTTTTTTATAAGGG - Intergenic
1197966131 X:132064001-132064023 CTCTGGGGCCTCTTTTGTAAGGG - Intergenic
1198098491 X:133403413-133403435 CTCTGGGGCCTCTTTTATAAGGG + Intronic
1198300792 X:135332435-135332457 CCTTTGGGCCTATTTTATAAAGG - Intronic
1198410921 X:136366984-136367006 CTCTGAGGCCTCTTTTATAAGGG - Intronic
1198455358 X:136812243-136812265 CTCTGAGGCCTCTTTTATAATGG + Intergenic
1198541366 X:137643635-137643657 CCTTGGGGCCTCTTTTATTAAGG + Intergenic
1198589128 X:138156665-138156687 TCCTGGGGTCCCTTTTATAAGGG + Intergenic
1198591910 X:138192899-138192921 CCTTCAGGCCTCTTTTATAAAGG - Intergenic
1198792817 X:140364257-140364279 CTCTCAGGCCTCTTTTATAAGGG - Intergenic
1198885775 X:141334493-141334515 CTCTGGGGCCTCTTTTATAAGGG - Intergenic
1199225309 X:145366078-145366100 CCCTGGGGTCTTTTTTATAAGGG + Intergenic
1199226222 X:145377908-145377930 CTCTCTGGCCTCTTCTATAAGGG - Intergenic
1199279833 X:145988386-145988408 CTCTGGGGCTTCTTTTATAAGGG - Intergenic
1199287480 X:146069808-146069830 CTCTTGGGCCTCTTTTATAAGGG - Intergenic
1199407069 X:147474708-147474730 TTCTTGGGCCTCTTTTATAAGGG + Intergenic
1199551246 X:149063966-149063988 CTCTGTGGCCTCTTTTATAAGGG + Intergenic
1199557376 X:149123827-149123849 CCATTGGGCCTCTTTTATGAGGG - Intergenic
1199751730 X:150826072-150826094 GCCTCAAGCCTCTTTTATCAGGG - Intronic
1200180867 X:154149997-154150019 TTCTAGGACCTCTTTTATAAGGG + Intronic
1200186510 X:154187111-154187133 TTCTAGGACCTCTTTTATAAGGG + Intergenic
1200192162 X:154224249-154224271 TTCTAGGACCTCTTTTATAAGGG + Intronic
1200197917 X:154262053-154262075 TTCTAGGACCTCTTTTATAAGGG + Intronic
1200643202 Y:5748018-5748040 TCCTCAGGCCTCTTTTATAAGGG + Intergenic
1200661959 Y:5971211-5971233 TTCTCAGGCCTCTTTTATAAGGG + Intergenic
1201182022 Y:11358018-11358040 CCCTTAAGCCTCTTTTATAAAGG - Intergenic
1201447628 Y:14075501-14075523 CTCTGGGGCCTCTTTGATAAGGG - Intergenic
1201454071 Y:14148935-14148957 TCCTCTGGCCTGTTTAATAGAGG - Intergenic