ID: 998071789

View in Genome Browser
Species Human (GRCh38)
Location 5:139203490-139203512
Sequence AAGCTGCTCAGGTGCTGCTT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 300
Summary {0: 1, 1: 0, 2: 0, 3: 17, 4: 282}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
998071789_998071794 20 Left 998071789 5:139203490-139203512 CCCAAGCAGCACCTGAGCAGCTT 0: 1
1: 0
2: 0
3: 17
4: 282
Right 998071794 5:139203533-139203555 CTAGATCTCTCCACCCCAAGAGG 0: 1
1: 0
2: 0
3: 3
4: 89
998071789_998071795 28 Left 998071789 5:139203490-139203512 CCCAAGCAGCACCTGAGCAGCTT 0: 1
1: 0
2: 0
3: 17
4: 282
Right 998071795 5:139203541-139203563 CTCCACCCCAAGAGGCTTCAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
998071789 Original CRISPR AAGCTGCTCAGGTGCTGCTT GGG (reversed) Intronic
900419342 1:2548957-2548979 AGGCTGCTCAGGTCCTGCCTGGG - Intergenic
900827195 1:4936138-4936160 AAGCTGAACTGGTGCTGCATTGG + Intergenic
901954002 1:12770902-12770924 GAGCTCCTCAGCTGCTGCTGTGG - Intergenic
901959208 1:12810968-12810990 GAGCTCCTCAGCTGCTGCTCTGG - Intergenic
902744566 1:18464913-18464935 AGGCTGCTCTGGGGCTACTTGGG + Intergenic
904050828 1:27637282-27637304 AAGATGCTGAGGTTCTGCTGGGG - Intergenic
905802767 1:40855963-40855985 GAGCTGCTCAGGTGGAGCTGTGG - Intergenic
906709616 1:47919506-47919528 AAGCAGCTCCGCTGCTGGTTGGG + Intronic
906955581 1:50371101-50371123 AGGCTGCTAAAGGGCTGCTTTGG - Intergenic
908672064 1:66559041-66559063 AAGCTCCTCAGGAGATCCTTAGG + Intronic
911427722 1:97741379-97741401 AAGCTTCCCAGGTGGTTCTTAGG - Intronic
912437327 1:109670988-109671010 CAGGTGCTCAGGTGCTCCTGGGG + Intronic
912672530 1:111644314-111644336 AAACTGCTCTGGTTCTTCTTGGG - Intronic
912776541 1:112509288-112509310 AAGCTGCGCAGCTCCCGCTTCGG + Exonic
914938811 1:152003998-152004020 AAGCTGCTAAGCTGCTGGTGGGG + Intergenic
915027298 1:152842941-152842963 ATGTAGCTCAAGTGCTGCTTAGG + Exonic
917329801 1:173868866-173868888 AAGCTGCTCAAGTGCTGGAGTGG + Intronic
917623284 1:176819963-176819985 AAGTTGCTCAGCTGGTGCTGGGG - Intronic
922064848 1:222126716-222126738 AAGCTCTTCAGGTGATTCTTAGG - Intergenic
922370484 1:224906046-224906068 AAGCTTCTCAGGTGCTTTTGAGG + Intronic
923366242 1:233264428-233264450 AAGCTGTACAGGGTCTGCTTAGG - Intronic
1064314803 10:14245478-14245500 AAGCTGCTCAAGTCCTGTTGTGG + Intronic
1066695877 10:38077118-38077140 AAGGGGCCCAGGTGCAGCTTGGG - Intergenic
1066984992 10:42456948-42456970 GAGCTGCTCAGGCTCTGCTGGGG + Intergenic
1067389593 10:45850727-45850749 GAGCTGCTCAGGCTCTGCTGGGG + Intronic
1067444654 10:46333797-46333819 GAGCTGCTCAGGCTCTGCTGGGG - Intergenic
1067501873 10:46813109-46813131 GAGCTGCTCAGGCTCTGCTGGGG - Intergenic
1067592709 10:47526899-47526921 GAGCTGCTCAGGCTCTGCTGGGG + Intronic
1067639826 10:48034982-48035004 GAGCTGCTCAGGCTCTGCTGGGG + Intergenic
1067873672 10:49985328-49985350 GAGCTGCTCAGGCTCTGCTGGGG - Intronic
1068144141 10:53044666-53044688 TAGCTCCTCAGGTGGTGCCTGGG + Intergenic
1068338710 10:55673013-55673035 AATCTGCTCAGCTTCTGCTGAGG + Intergenic
1070136801 10:73701091-73701113 GAGCTGCTCAGGCTCTGCTGGGG + Intergenic
1070785762 10:79161317-79161339 CAGCTGCCCAGATGCTGCTGTGG + Intronic
1073294503 10:102430812-102430834 TGGCTGCTTAGGTGCTACTTAGG - Intronic
1074325220 10:112444546-112444568 AAAGTGCCCAGGTGATGCTTAGG - Intronic
1075440917 10:122478727-122478749 AAGCATCTCAGGAGCTGCTCAGG - Intronic
1077975568 11:7244876-7244898 AGGCTTCTGAGTTGCTGCTTGGG - Intronic
1078698602 11:13659728-13659750 AAGGAGCCCAGGTGCAGCTTGGG + Intergenic
1078743591 11:14091108-14091130 TAGCTGCTCTGGTGGGGCTTTGG - Intronic
1080207402 11:29746219-29746241 AAACTTCTCAGGTGATGCTGTGG - Intergenic
1080507552 11:32931752-32931774 AAACAGCTCAGTTGCTGCTGAGG - Exonic
1081421020 11:42874609-42874631 TAGCTGCTCTGGTGGGGCTTTGG + Intergenic
1083161238 11:60855459-60855481 AAGCAGCTAAGGTCCGGCTTTGG + Intronic
1084369684 11:68732466-68732488 GAGCTGCTCAGCTGCTGGCTGGG - Intronic
1085121425 11:73969901-73969923 GACCTGCTGAGGTGCTGCTCTGG + Intronic
1085783290 11:79428913-79428935 AAGCTGCCCAGGTGATTCTAAGG - Intronic
1086151440 11:83615062-83615084 AAGAACCCCAGGTGCTGCTTAGG - Intronic
1088420174 11:109636370-109636392 CAGCTGATCTGGTGCTGCGTGGG + Intergenic
1090731295 11:129575231-129575253 AAGATGCTCAGCTGCTGGCTGGG - Intergenic
1093035865 12:14332062-14332084 AAGCTGATCAGTTGCTCCTAAGG + Intergenic
1098429977 12:70408559-70408581 CAGCTGCTTCGGGGCTGCTTCGG - Intronic
1100477439 12:94947423-94947445 AAGCTGCTCAGGTTTTGTTTTGG + Intronic
1100667834 12:96773678-96773700 AAGCTGCTTATGTGATGATTTGG - Intronic
1101807909 12:108080949-108080971 AGGCTGCACATGTCCTGCTTGGG - Intergenic
1103171912 12:118828122-118828144 GAGCTGCTAAGGTGCTTATTTGG - Intergenic
1103191701 12:119007060-119007082 CAGCTGCTAAGGGGCTGCTGGGG - Intronic
1104000615 12:124857581-124857603 AAGGAGCTCAGGCGCTGCTATGG + Intronic
1105257199 13:18751649-18751671 AAGATGCGCAGGTACAGCTTGGG - Intergenic
1105259863 13:18771011-18771033 AAGATGCACAGGTACAGCTTGGG - Intergenic
1105262543 13:18790334-18790356 AAGATGCACAGGTACAGCTTGGG - Intergenic
1105264464 13:18803790-18803812 AAGATGCACAGGTACAGCTTGGG - Intergenic
1107958296 13:45538693-45538715 CAGCTGCACAGGTGATGGTTTGG + Intronic
1109204188 13:59463473-59463495 AAGCTTCCCAGGTGATGCTTAGG + Intergenic
1109591293 13:64486587-64486609 AAGCTACTCAGTTGCTTCCTGGG - Intergenic
1111901513 13:94205554-94205576 AAGCTGCTCTAGTTGTGCTTTGG - Intronic
1113634984 13:111913300-111913322 ATGCTCAGCAGGTGCTGCTTTGG - Intergenic
1117956409 14:61126816-61126838 AAGCTACTCTGGTGCTGGTCAGG - Intergenic
1119488135 14:75005626-75005648 TGGCTGCTCTGGTGCTGCTGTGG + Intronic
1119558502 14:75571536-75571558 AATGTGCTCAGGGGCTGCTGAGG - Intergenic
1120194576 14:81467918-81467940 ATGGTGCTCAGGGGCTTCTTAGG - Intergenic
1121327499 14:93029733-93029755 AAGATGCTCATGGCCTGCTTGGG - Intronic
1122368500 14:101213711-101213733 AAGCTGGAAAGCTGCTGCTTTGG - Intergenic
1202833983 14_GL000009v2_random:64278-64300 AAGATGCACAGGTACAGCTTGGG + Intergenic
1124708732 15:31987179-31987201 AAGCTGCTCAGGGGCTGAGTTGG - Intergenic
1125267717 15:37902335-37902357 AAGCTGCCCAGGTGATTCTAAGG - Intergenic
1129239499 15:74243084-74243106 AAGCTGCTGAGTCCCTGCTTGGG + Intronic
1129904291 15:79175180-79175202 AAGCTCCTCAGGTGATTCTTTGG - Intergenic
1130665984 15:85870475-85870497 CAGCTGCCCACCTGCTGCTTTGG + Intergenic
1131021354 15:89101981-89102003 ACGCTACACAGGTGCTGCCTTGG - Intronic
1131469876 15:92687517-92687539 CAGCTGCTCAGAGGCTGCTGGGG + Intronic
1132250033 15:100329119-100329141 AAGCTTCCCAGGTGATGCTAAGG + Intronic
1133015243 16:2936727-2936749 AAGCTGCTCAGGAGCCGGATGGG - Intronic
1133904834 16:10012702-10012724 AAGATGCCCTGGTGCTGCCTTGG + Intronic
1136265976 16:29118684-29118706 GAGCTCCTCTGGGGCTGCTTCGG + Intergenic
1136990960 16:35151156-35151178 GGGCTGGGCAGGTGCTGCTTGGG + Intergenic
1141484193 16:84328092-84328114 AAGGTGAGAAGGTGCTGCTTGGG + Intronic
1141640198 16:85336366-85336388 AAGCTGATGAGCTGATGCTTAGG - Intergenic
1142054788 16:87986590-87986612 GAGCTCCTCTGGGGCTGCTTTGG + Intronic
1142173731 16:88635501-88635523 AACCTGCCCAGCTGCGGCTTGGG - Intergenic
1142701658 17:1665932-1665954 AAGCTGATCAGGTGGTGGTCAGG + Intronic
1145292932 17:21564122-21564144 AAGCAGATCAGTTGTTGCTTGGG + Intronic
1146230568 17:31104483-31104505 AAGATGCTCATATTCTGCTTCGG - Intronic
1147167085 17:38599322-38599344 AAGCTGCTCCTCTGCTCCTTAGG - Intronic
1148216835 17:45837919-45837941 ATTCTGCTCAGGTTCAGCTTGGG + Intergenic
1149339689 17:55672597-55672619 AAGGGGCTCAGGTACAGCTTAGG - Intergenic
1149387069 17:56152998-56153020 AAGATGCTCAGTTGAAGCTTTGG - Intronic
1150932945 17:69604764-69604786 AATCTACTAAAGTGCTGCTTAGG - Intergenic
1152179213 17:78807379-78807401 GAACTGCTCAGGGGCTGCCTGGG - Exonic
1153468635 18:5417448-5417470 TACCTGCCCAGGTCCTGCTTGGG - Intronic
1153752320 18:8245355-8245377 AGCATGCACAGGTGCTGCTTTGG + Intronic
1154423925 18:14257771-14257793 AAGATGCACAGGTACAGCTTGGG + Intergenic
1154427993 18:14286812-14286834 AAGATGCACAGGTACAGCTTGGG + Intergenic
1154428894 18:14293380-14293402 AAGATGCACAGGTACAGCTTGGG + Intergenic
1154433848 18:14329024-14329046 AAGATGCACAGGTACAGCTTGGG + Intergenic
1155588495 18:27396948-27396970 CTGCTGCTGAGATGCTGCTTTGG + Intergenic
1156804897 18:41166374-41166396 ACCTTGCTCAGGTGCTGCCTTGG + Intergenic
1161482430 19:4517685-4517707 AAGCTGCCCAGGGTCTGCATGGG + Exonic
1162344425 19:10111167-10111189 CCGCTGCTCCGGTGCGGCTTGGG - Exonic
1163338838 19:16691088-16691110 AAGCTGATCAGTGGGTGCTTGGG + Intergenic
1163401285 19:17094506-17094528 AAGCTGATCGGTGGCTGCTTGGG - Intronic
1167959492 19:53094938-53094960 AAGCTGCTATGGTGCAGCCTGGG - Intronic
1168413501 19:56154769-56154791 AAGCTGCTGATGTTCTGCTGAGG - Intronic
1202638699 1_KI270706v1_random:63414-63436 AAGATGCACAGGTACAGCTTGGG - Intergenic
925393109 2:3512474-3512496 CAGCTGCTCGGGTTCTGCTAGGG + Intronic
925430159 2:3785181-3785203 AATCTTCTCAGGTGCTTTTTAGG + Intronic
927853200 2:26512732-26512754 AAGAGGGTCAGGTGCTGCTCGGG + Intronic
929444236 2:41990197-41990219 AAGCTCTTGAGGTGCTGCCTTGG - Intergenic
929767424 2:44858368-44858390 AAGCAGATCAGTTGTTGCTTAGG + Intergenic
932861437 2:75296935-75296957 AAGATGCTATGCTGCTGCTTTGG - Intergenic
934491819 2:94766344-94766366 AAGATGCACAGGTACAGCTTGGG - Intergenic
934494158 2:94782932-94782954 AAGATGCACAGGTACAGCTTGGG - Intergenic
935058371 2:99587394-99587416 CAGCTGCTCAGGCTGTGCTTCGG - Intronic
935815714 2:106844072-106844094 CATCTGCTCAGATGCTGCTGGGG + Intronic
937841240 2:126526697-126526719 AAGGGCCTCAGGTACTGCTTGGG - Intergenic
939125375 2:138171938-138171960 AAGCGGCCCAGGTACAGCTTGGG + Intergenic
940924311 2:159346724-159346746 AACCTGCTAAGGTTCTGTTTTGG - Intronic
943289680 2:186053277-186053299 GAGGTGCTGAGCTGCTGCTTTGG - Intergenic
943972484 2:194428489-194428511 AACCAGCCCAGGTGCTGCTCAGG - Intergenic
945178804 2:207070560-207070582 AAGCTGCCCACTTGCTTCTTGGG + Intergenic
947989374 2:234474627-234474649 AATTTGCCCAGGTGCTGCTTTGG - Intergenic
948348879 2:237322221-237322243 AAGGTGCTCAGGTGGTGGATGGG - Intergenic
948471904 2:238187725-238187747 AAGCCGCTCAGTTGCTGGTAAGG + Intronic
948805436 2:240451890-240451912 AAGCTGCCCAGATCCTGCTTGGG - Intronic
1169560946 20:6800129-6800151 AAGTGGCTCAGTTGATGCTTTGG + Intergenic
1171170001 20:23007503-23007525 GACCTGCTCAGGGGCTGATTGGG - Intergenic
1171476871 20:25417205-25417227 AAGCTTCTCAGTTTTTGCTTGGG + Intronic
1174642092 20:52053546-52053568 AGGATGCTCAGGTGTTGCTGGGG + Intronic
1175857148 20:62127808-62127830 AAGCAGCTCAGCGGCTGCATGGG - Intronic
1175976258 20:62711800-62711822 AGGCTGGGCAGGTGGTGCTTTGG - Intronic
1176849542 21:13902232-13902254 AAGATGCACAGGTACAGCTTGGG - Intergenic
1179018512 21:37616384-37616406 AAGATGTTCAGGAGCTTCTTTGG + Exonic
1179084551 21:38206010-38206032 CAGCTGCTCTGGAGCTGCTGGGG - Intronic
1179981562 21:44898508-44898530 AAGACGCTCAGGTGCTGTTGGGG - Intronic
1180213437 21:46310057-46310079 AAGCTGCTCAGCAGTTGCATGGG + Intronic
1181315416 22:21967964-21967986 TAGGGGCTCAGGTGCTTCTTAGG - Intronic
1181996961 22:26890660-26890682 TAGGTGCTTAGGTCCTGCTTTGG + Intergenic
1183455266 22:37919086-37919108 AGGCTGCGCACGTGCTGCTGGGG - Exonic
1185334505 22:50265605-50265627 ATGCTGCTCAGGTCCTTCTGGGG + Exonic
1185339732 22:50285913-50285935 AGGCTGGTCAGGTGCTGCCTGGG + Intronic
953072243 3:39532427-39532449 AATAAGCTCAGGAGCTGCTTGGG + Intergenic
953449095 3:42991535-42991557 CAGCTGCAGAGGTGCTGCCTGGG + Intronic
953989761 3:47475448-47475470 AACCTGCTTTGGTGCTGTTTGGG - Intronic
954116520 3:48469657-48469679 AAGCTGACCAGGCCCTGCTTTGG - Intronic
954773174 3:52992215-52992237 AGGCAGCTCAGGACCTGCTTAGG - Intronic
958108224 3:89105079-89105101 AAGCTTCTCAGGTAATCCTTGGG - Intergenic
959577669 3:107951844-107951866 CAGCTCCCCAGGTGCTTCTTCGG - Intergenic
960637479 3:119797420-119797442 AAGCTGTTTAGGTGGTGCTCTGG + Intronic
961059807 3:123818783-123818805 AAGATTATCAGGTGCTGCTGAGG - Intronic
961165355 3:124759865-124759887 TGCCTGCTCAGTTGCTGCTTTGG - Intergenic
961470690 3:127109562-127109584 AGGCTGCTGAGGTGCAGTTTTGG + Intergenic
962253032 3:133850097-133850119 AGGCTGCTTAGGGTCTGCTTGGG - Intronic
963599958 3:147370384-147370406 AAGCTGCCCAGGTGGTGTGTAGG - Intergenic
966413461 3:179666310-179666332 AAGCTGCTGAGTTGCTCTTTTGG + Intronic
969140054 4:5061844-5061866 AAGAAGCTGAGGAGCTGCTTTGG - Intronic
969327237 4:6451072-6451094 AAGCTGGTCAGGCGATGCTCTGG + Intronic
969443087 4:7228740-7228762 CAGCTGCTCTGGGGCTGCTGTGG + Intronic
970626195 4:17886495-17886517 AAGCTGCCCAGATAATGCTTTGG + Intronic
971614075 4:28764692-28764714 AAATGGCTCAGGTGCTGATTTGG - Intergenic
971697274 4:29922447-29922469 AAGCTTCTCAGATGTTCCTTAGG - Intergenic
972191407 4:36596147-36596169 AATTTGCTGAGGTGCTGTTTTGG + Intergenic
973367568 4:49219978-49220000 AAGATGCACAGGTACAGCTTGGG - Intergenic
973393485 4:49575454-49575476 AAGATGCACAGGTACAGCTTGGG + Intergenic
973780408 4:54283406-54283428 AAGGAGTTCAGGTGCAGCTTGGG - Intronic
973989263 4:56387622-56387644 TATCTGCTCAGGCGCTCCTTGGG + Intergenic
974634852 4:64548268-64548290 AAGCAGATCAGGTGCTTCTCAGG - Intergenic
974982305 4:68973842-68973864 CAGCTGCACAGCTGCTCCTTTGG + Intergenic
976569431 4:86591729-86591751 AAGCTTTTCAGTTGATGCTTTGG + Intronic
981275919 4:142898119-142898141 TAGCTGCTCTGGTGCGGCCTTGG + Intergenic
983026215 4:162740282-162740304 TAGCTGCTCTGGTGCGGCCTTGG + Intergenic
983836374 4:172391653-172391675 AAGCTTCTTAGTTGCTGCTATGG - Intronic
984265770 4:177496213-177496235 TAGCTACTCTGGTGGTGCTTTGG + Intergenic
984706718 4:182852640-182852662 AAGCTGCTCATGTACTTCTCAGG + Intergenic
1202766037 4_GL000008v2_random:149273-149295 AAGATGCACAGGTACAGCTTGGG - Intergenic
985815922 5:2127885-2127907 AAGCCTCTCCTGTGCTGCTTGGG + Intergenic
985826793 5:2198037-2198059 CAGGTGCTCAGGCGCTGTTTGGG - Intergenic
986144119 5:5061050-5061072 AAGATTCTGAGGTACTGCTTGGG + Intergenic
986165582 5:5269237-5269259 AGGCAGCTCAGGTGCTGGTGAGG - Intronic
986462988 5:7992369-7992391 CAGCGGATCAAGTGCTGCTTTGG - Intergenic
986606278 5:9526644-9526666 AAGCTGCTCCGGGGCTTCTCCGG - Intronic
986768289 5:10948190-10948212 AAGTTGCTCAGCTGGTGTTTGGG + Intergenic
987183012 5:15386210-15386232 GAGCTGCTCTGGGGCTGCTGAGG + Intergenic
990312634 5:54554264-54554286 AAGCTCCCCAGGTGATGCTAAGG - Intergenic
990334417 5:54757931-54757953 AAGGTGCTCAGGTTCTCCTTGGG + Intergenic
992273397 5:75089294-75089316 AAGCTGTTCAGCAACTGCTTGGG + Intronic
994045529 5:95305359-95305381 AAGCTCCCCAGGTGATTCTTTGG - Intergenic
994548191 5:101197253-101197275 CAGCTTCTCAGGTGTTTCTTAGG - Intergenic
994881367 5:105501484-105501506 CAGCTGCACAGCTGCTGCTAGGG - Intergenic
995086036 5:108110212-108110234 ATTATGCTCAGGTTCTGCTTGGG - Intronic
995145917 5:108787078-108787100 CAGCTGCCCAGCTGCAGCTTGGG + Intronic
995528302 5:113068262-113068284 AGGCAGCTCAGGTGCTGTCTCGG + Intronic
997425478 5:133799937-133799959 AGGGTGCTCAGGTGCTGCAGGGG - Intergenic
998071789 5:139203490-139203512 AAGCTGCTCAGGTGCTGCTTGGG - Intronic
998291314 5:140917129-140917151 ACGTTGCTCAGCTGCTGCTGGGG + Intronic
998599073 5:143566381-143566403 AAGCTGCAAAGGTGAGGCTTAGG - Intergenic
1000157026 5:158562398-158562420 AAGATTCTCAGCTGGTGCTTGGG - Intergenic
1000754695 5:165143827-165143849 TAGCTCCTCAGCAGCTGCTTAGG - Intergenic
1001487450 5:172129592-172129614 AAGCTGGTTAGGTGGTGGTTGGG - Intronic
1001650327 5:173311291-173311313 GGGCTGCTCAGGAGCTGCTCAGG + Intergenic
1002054930 5:176593429-176593451 AAGCCGCTCAGGGGGTGCTAAGG + Intronic
1002340246 5:178511725-178511747 AGGAGGCTCAGGAGCTGCTTGGG - Intronic
1003962407 6:11221066-11221088 AAGATTCTCAGGAGTTGCTTCGG - Intronic
1006520576 6:34568836-34568858 GAGCTGGGCAGGTGCTGCCTGGG - Intergenic
1006739621 6:36297995-36298017 AAGCAGATCAGGGGTTGCTTGGG - Intronic
1007204542 6:40138139-40138161 AAGCTGGTCAGGTGCTGGTGGGG - Intergenic
1007796219 6:44350138-44350160 AAGCACCTCAGGTGATTCTTAGG - Intronic
1008473424 6:51909977-51909999 GAGCTGCTCAGTTGCTTCTCTGG - Intronic
1014834623 6:126146923-126146945 AAGATGCTCATATTCTGCTTAGG + Intergenic
1015513888 6:134066086-134066108 AACCTGAACAGGTGCTGCTGTGG + Intergenic
1015830716 6:137365952-137365974 AAGTTGCTCAGCTGCTGCCCGGG - Intergenic
1019524845 7:1476295-1476317 CTGCTGCTCAGCTGCTGCTGTGG - Exonic
1019820094 7:3236206-3236228 AAGCTGTCCAGCTTCTGCTTGGG + Intergenic
1020018660 7:4847827-4847849 AAACTGATCAGGGGCTGCCTGGG + Intronic
1021908848 7:25364094-25364116 AAAATGAACAGGTGCTGCTTAGG - Intergenic
1021977145 7:26021658-26021680 AAGCTGCCCAGGTGATTCTGAGG + Intergenic
1022242934 7:28530387-28530409 GAGCTGCTCAGGGGCAGCTTGGG + Intronic
1023703943 7:42919438-42919460 AATTTCCTCAGGTTCTGCTTCGG - Intronic
1024335525 7:48202651-48202673 TAGCTGCTCAGGTGGGGCCTTGG - Intronic
1024534796 7:50421254-50421276 AAGCTGCCCAGGTGCAGCCAGGG + Intergenic
1028630643 7:92929850-92929872 AACCTGCCCATGAGCTGCTTGGG + Intergenic
1031026697 7:116686877-116686899 GAGCTGCTCAGGTGCAGCTGAGG - Intronic
1031557266 7:123193023-123193045 ATGCATCTCAGGTGCTGGTTAGG - Intronic
1032248169 7:130230603-130230625 TAGCTGCTCTGGTGGGGCTTTGG + Intergenic
1032751002 7:134841647-134841669 AAGGTGATCATGTGCTTCTTTGG + Intronic
1033206496 7:139427480-139427502 AATCTGCTCTGATGCTCCTTTGG + Intergenic
1033720442 7:144053625-144053647 AAGCTGCTAAGAAGCAGCTTGGG - Intergenic
1034272292 7:149809112-149809134 AGGCTGCGCAGCTGCTGCCTCGG - Intergenic
1034922905 7:155098608-155098630 AAGCTGCTCAAATGGTGCTCAGG + Intergenic
1035247536 7:157573645-157573667 TAGCTGGTCAGCTCCTGCTTTGG + Intronic
1035724870 8:1818065-1818087 GGGCTGCTCAGGTGCTGCGATGG - Intergenic
1035821751 8:2600482-2600504 AACCTGCTGAGGTACTGCCTTGG + Intergenic
1036052379 8:5214712-5214734 TAGCTGTCCAGGTCCTGCTTAGG - Intergenic
1037288346 8:17324539-17324561 CAGCTGCTCAGGTGCTGGATGGG - Intronic
1037910349 8:22740516-22740538 AAGCTGCTGTGGTGGTGCTGAGG - Intronic
1038773841 8:30510245-30510267 AAGCAGCTCAGGAGCTGGTTTGG - Intronic
1041306274 8:56464481-56464503 AAAGGGCCCAGGTGCTGCTTGGG + Intergenic
1045617066 8:103928707-103928729 ATGCTGCTTAGGTCCTACTTAGG + Intronic
1045820441 8:106330577-106330599 AAGCTTCTCTGGAGCTGTTTTGG + Intronic
1046584383 8:116133402-116133424 AAGCTCCTCAGGTGCAGCCTTGG + Intergenic
1047712443 8:127566116-127566138 CAGCTGCTCAGGAGCCGCTAGGG - Intergenic
1049310887 8:141933286-141933308 AAGATGCTCAGGTGCTCCCAGGG - Intergenic
1052877764 9:33580237-33580259 AAGATGCACAGGTACAGCTTGGG + Intergenic
1052878650 9:33586424-33586446 AAGATGCACAGGTACAGCTTGGG + Intergenic
1052879081 9:33589509-33589531 AAGATGCACAGGTACAGCTTGGG + Intergenic
1053496895 9:38554710-38554732 AAGATGCACAGGTACAGCTTGGG - Intronic
1053498221 9:38563968-38563990 AAGATGCACAGGTACAGCTTGGG - Intronic
1053664347 9:40307137-40307159 AAGATGCACAGGTACAGCTTGGG + Intronic
1053664871 9:40310392-40310414 AAGATGCACAGGTACAGCTTGGG + Intronic
1053666184 9:40319517-40319539 AAGATGCACAGGTACAGCTTGGG + Intronic
1053913419 9:42927605-42927627 AAGATGCACAGGTACAGCTTGGG + Intergenic
1053913915 9:42930834-42930856 AAGATGCACAGGTACAGCTTGGG + Intergenic
1054247156 9:62677702-62677724 AAGAAGCCTAGGTGCTGCTTAGG - Intergenic
1054377337 9:64459545-64459567 AAGATGCACAGGTACAGCTTGGG + Intergenic
1054518425 9:66056766-66056788 AAGATGCACAGGTACAGCTTGGG - Intergenic
1054519743 9:66065892-66065914 AAGATGCACAGGTACAGCTTGGG - Intergenic
1054520267 9:66069148-66069170 AAGATGCACAGGTACAGCTTGGG - Intergenic
1054561274 9:66712234-66712256 AAGAAGCCTAGGTGCTGCTTAGG - Intergenic
1057161393 9:92890845-92890867 AAGATGCACAGGTACAGCTTGGG - Intergenic
1057676804 9:97142267-97142289 AAGATGCACAGGTACAGCTTGGG - Intergenic
1057677243 9:97145364-97145386 AAGATGCACAGGTACAGCTTGGG - Intergenic
1057677686 9:97148452-97148474 AAGATGCACAGGTACAGCTTGGG - Intergenic
1057752161 9:97802037-97802059 AAGCTGCTCAGCTGCAGAGTTGG - Intergenic
1057863190 9:98658340-98658362 AAGCTCCCCAGGTGCTCCATGGG + Intronic
1057869859 9:98709180-98709202 AGGCTGCTCAGGGGCGGCTCGGG + Exonic
1058834470 9:108848840-108848862 AAGGTGCTGATGTGCAGCTTGGG - Intergenic
1059686346 9:116640674-116640696 ATGGTGCTCAGGGGCTGCTTGGG - Intronic
1060374558 9:123106859-123106881 CAGCTGCTCAGTTGTTGGTTTGG + Intergenic
1060869457 9:127028192-127028214 AGCCTGCCCAGGTTCTGCTTTGG + Intronic
1062371904 9:136243977-136243999 AGGCTGCCTATGTGCTGCTTCGG + Intronic
1062635323 9:137487525-137487547 CAGCTGCTCAGGTGGTGCTGAGG - Intronic
1203546786 Un_KI270743v1:134162-134184 AAGATGCACAGGTACAGCTTGGG - Intergenic
1186314781 X:8357309-8357331 AAGTTGCTTAGTTGCTGCATTGG - Intergenic
1186421788 X:9432594-9432616 CAGTTTCTCAGGTGCTGCTAGGG + Intergenic
1186898470 X:14029416-14029438 AAGCTGCCCAGGTGATTCTGGGG - Intronic
1187254635 X:17630837-17630859 AAGCTGCCCAGGTGATTCTGAGG - Intronic
1187568904 X:20481038-20481060 AAGCTGCTCAGGTGGCGCAAAGG + Intergenic
1188849233 X:35111464-35111486 AATCTGCTCAGGTTATGCTGAGG + Intergenic
1193046389 X:77059280-77059302 AATGTTCTCAGGTACTGCTTGGG + Intergenic
1193083100 X:77424808-77424830 AAGCTGCGGAGGTGGTGCCTGGG + Intergenic
1196099096 X:111829623-111829645 AAGGTGCCCAGGTACAGCTTGGG + Intronic
1197184430 X:123570601-123570623 AAGTTTCTCAGGTGGTGGTTTGG - Intergenic
1197747325 X:129940364-129940386 AAGATGCTCAGGGGCAGCATTGG - Intergenic
1197979869 X:132205550-132205572 AATTTGCACAGATGCTGCTTTGG - Exonic
1198452810 X:136784714-136784736 AAGTTGCTCTGGTGCTGAGTTGG - Intergenic
1199619744 X:149688504-149688526 AAGCTGTTCTGAAGCTGCTTCGG + Intronic
1200183343 X:154165164-154165186 AAGCTACTCAGGTGCCGAGTAGG - Intergenic
1200188997 X:154202278-154202300 AAGCTACTCAGGTGCCGAGTAGG - Intergenic
1200194649 X:154239439-154239461 AAGCTACTCAGGTGCCGAGTAGG - Intergenic
1200200402 X:154277222-154277244 AAGCTACTCAGGTGCCGAGTAGG - Intronic
1200276996 X:154742798-154742820 AAGCAGATCAGTTGCTGCCTGGG + Intronic