ID: 998074955

View in Genome Browser
Species Human (GRCh38)
Location 5:139228345-139228367
Sequence TTATTAGGAGAGCCAGGGCA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 240
Summary {0: 1, 1: 0, 2: 2, 3: 10, 4: 227}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
998074955 Original CRISPR TTATTAGGAGAGCCAGGGCA AGG (reversed) Intronic
900016634 1:155138-155160 TTAATAGGAGAGGCAATGCATGG + Intergenic
900046895 1:513730-513752 TTAATAGGAGAGGCAATGCATGG + Intergenic
900069099 1:755448-755470 TTAATAGGAGAGGCAATGCATGG + Intergenic
900418489 1:2545784-2545806 TTAATATGAGAGCCAGCCCAGGG + Intergenic
900524451 1:3121679-3121701 TGATTAGGGGATCCGGGGCAGGG + Intronic
903403374 1:23075391-23075413 TTTTTAGTAGAGACAGGGCCAGG - Intronic
905385404 1:37600012-37600034 TTCTTAGCAGAGCCAGGGTGAGG + Intergenic
906061733 1:42953415-42953437 TTGTTAGGGTAGCCAGGGCTGGG + Intronic
906067734 1:42994268-42994290 TAATGAGGGGAGCCATGGCATGG - Intergenic
906610153 1:47196077-47196099 TTATTGTGAGAGGCCGGGCACGG + Intergenic
906969057 1:50491144-50491166 TTTTTTGGAGAGCCAGGGAGTGG - Intronic
908586251 1:65573018-65573040 TGACGAGGGGAGCCAGGGCATGG - Intronic
908982682 1:69977733-69977755 TTGTCAGGAGAGCCAAAGCAAGG - Intronic
909555718 1:76951485-76951507 TTATTGGGAGGGTCAGGGGAGGG + Intronic
910139047 1:84006425-84006447 TTATTATAAGAGCAAGGGAAGGG - Intergenic
911384297 1:97155572-97155594 TTATCAGGAGACCTAGGGCTGGG - Intronic
918029044 1:180785328-180785350 TTTTTAGCAGAGACAGGACAGGG + Intronic
918307820 1:183263352-183263374 TGGTAAGGAGAGTCAGGGCAGGG + Intronic
918565579 1:185926735-185926757 TTATTAGGAAATCTAGGGCAGGG - Intronic
919526167 1:198653997-198654019 TTATTAGAAAAGCCAGCGGAAGG - Intronic
921235144 1:213119153-213119175 TTTGTAGGAGAGGCTGGGCATGG + Intronic
922144404 1:222924926-222924948 TTATTAGGAAGACAAGGGCATGG - Intronic
922264780 1:223973355-223973377 TTAATAGGAGAGGCAATGCATGG + Intergenic
923741367 1:236657994-236658016 TTAAGAGGAGAGGCTGGGCACGG - Intergenic
923838274 1:237639460-237639482 TTCCTAGGGGAGCTAGGGCAAGG + Intronic
924357807 1:243201864-243201886 TTAATAGGAGAGCCCTGGCCTGG - Intronic
924565700 1:245196436-245196458 TCAACAGGAGAGCCAGGGAAGGG - Intronic
1063901652 10:10738944-10738966 ATAGTAGGAGAGACTGGGCATGG + Intergenic
1064748856 10:18504933-18504955 ATGTTAGGAGAGGCCGGGCACGG - Intronic
1064957782 10:20930559-20930581 TTAGTAGGAGAGACTAGGCAGGG - Intronic
1065931369 10:30482070-30482092 TAATTACCAGACCCAGGGCACGG - Intergenic
1066376489 10:34861932-34861954 TTATTAGGAGAGCTGGGGGTGGG - Intergenic
1070220546 10:74438523-74438545 TTATTAAGAGAGGCAAGGCCGGG - Intronic
1071923617 10:90379372-90379394 TTATCAGCAGAGCCAGAACAAGG + Intergenic
1072306901 10:94116402-94116424 TTTTTAGGAATGGCAGGGCATGG + Intronic
1074467486 10:113696338-113696360 TTTTTAGTAGAGACAGGGCCAGG - Intronic
1075925196 10:126245701-126245723 TTATCATGGGAGTCAGGGCAGGG + Intronic
1076930886 10:133530978-133531000 TTGGGAGGAGAGACAGGGCAGGG + Intronic
1076973225 11:150207-150229 TTAATAGGAGAGGCAATGCATGG + Intergenic
1080070319 11:28076257-28076279 TTGTTAGATGTGCCAGGGCAGGG - Intronic
1080151774 11:29059508-29059530 TTATAAGGGGGCCCAGGGCATGG + Intergenic
1080258125 11:30315839-30315861 TTATAAGGAAAGCAAGGCCAAGG + Intergenic
1081532142 11:43969352-43969374 TTATTATTTGAGACAGGGCAGGG - Intergenic
1081799102 11:45845464-45845486 TTAATAAGAGAGCGAGGGGAGGG + Intergenic
1081916359 11:46733491-46733513 TTACTAGGAGAGGCCAGGCATGG - Intronic
1085908126 11:80789060-80789082 TTAATAGTAGAGCAAGGGCAAGG + Intergenic
1087878221 11:103383762-103383784 TTAAAAGGAGAGGCCGGGCATGG - Intronic
1089789323 11:120931258-120931280 TTATTAGGAGGGCCCCTGCAGGG + Intronic
1090621029 11:128561303-128561325 TGAGTAGGACAGACAGGGCAGGG + Intronic
1090884857 11:130866848-130866870 TTATTAGCAAAGCCAGGACCTGG - Intergenic
1091491359 12:935556-935578 TTTTTAGTAGAGACAGGGCCGGG + Intronic
1094566256 12:31600822-31600844 TTACAAGGAAAGCCAGGCCAAGG + Intergenic
1095411270 12:41927074-41927096 TTTTTGGGAGAGCAAGGGGAAGG - Intergenic
1095841652 12:46700564-46700586 TCATTCTGACAGCCAGGGCAAGG - Intergenic
1096244491 12:49976524-49976546 CTATTGGGAGAGGCCGGGCACGG - Exonic
1096471576 12:51880866-51880888 TTTTTAGTAGAGACAGGGCTTGG + Intergenic
1097172020 12:57120802-57120824 TTTTTAGTAGAGACAGGGTATGG + Intronic
1101058673 12:100947891-100947913 AAGTTAGGAGAGGCAGGGCATGG + Intronic
1101577062 12:106007447-106007469 TTTTTTGGAGAGTCAGGGGATGG + Intergenic
1107438296 13:40401618-40401640 GTAGCAGGAGAGCCAAGGCAGGG + Intergenic
1107867485 13:44716847-44716869 TTTTTAGTAGAGACGGGGCAGGG - Intergenic
1107962319 13:45569558-45569580 TTCTTAGGACAGCCAGGGATCGG + Intronic
1115122556 14:29954843-29954865 TTATTAGAAAAGGTAGGGCATGG - Intronic
1117488962 14:56227155-56227177 TCATTAGGTGGGCCTGGGCAAGG + Intronic
1118188137 14:63556361-63556383 TTACTATGAGAGGCCGGGCACGG + Intergenic
1118312924 14:64706109-64706131 TTATTAGAAGTGGCATGGCAGGG + Intronic
1120943877 14:89975879-89975901 TTCTTAGGAGAGACTGAGCATGG + Intronic
1121566676 14:94915147-94915169 TCAGTGGGAGAGGCAGGGCATGG - Intergenic
1121924761 14:97917420-97917442 TTAGTAGGAGAGGCTGGGCATGG - Intergenic
1124806506 15:32889163-32889185 ATCTTAGGAGACCGAGGGCAGGG + Intronic
1125288313 15:38118519-38118541 TTATAAGGAGAAGAAGGGCATGG - Intergenic
1126744316 15:51810718-51810740 TTACTTGGAGAGGCAGGTCAGGG - Exonic
1129775390 15:78233266-78233288 TTCTCTGGAGACCCAGGGCAGGG + Intronic
1136622710 16:31440990-31441012 AGATTAGGAAAGCCTGGGCAAGG - Intronic
1137862227 16:51857809-51857831 CTATTAGGAGCTCCAGAGCAAGG + Intergenic
1138676838 16:58657508-58657530 TTATTATGGGAGACAGGGAAGGG - Intergenic
1139299450 16:65932882-65932904 ATACTAGGAGAGCCTGGGGAAGG - Intergenic
1139699084 16:68696128-68696150 TGATTAGGAGGGGCTGGGCACGG + Intronic
1139745004 16:69067216-69067238 TTATTAGCTGAGGCTGGGCACGG + Intronic
1141127951 16:81414558-81414580 ATACCAGGAGAACCAGGGCAGGG - Intergenic
1142447026 16:90147319-90147341 TTAATAGGAGAGGCAATGCATGG - Intergenic
1142460466 17:88012-88034 TTAATAGGAGAGGCAATGCATGG + Intergenic
1142693533 17:1621102-1621124 TTAGGAGGAGACCCAGGGCCAGG + Intronic
1143184721 17:5003348-5003370 TTCTTACGAGACCCAGGACAGGG + Intronic
1146557012 17:33834258-33834280 TTCATAGCAGAGCCAGGGCAGGG + Intronic
1148480978 17:47959224-47959246 TTAGAGGGAGAGCCAGGGAAAGG - Intergenic
1150521651 17:65873456-65873478 TTATTAGGAGAGTCAGATGATGG - Intronic
1151554776 17:74841167-74841189 TTGTCAGGACAGCCAGGGCTTGG + Intergenic
1152011448 17:77721280-77721302 TTATAAGGAGAACCAGGAAACGG + Intergenic
1152533133 17:80932213-80932235 AAATTAGGAGAGGCTGGGCATGG + Intronic
1155885621 18:31205037-31205059 GTGTGAGGAGCGCCAGGGCAGGG + Intergenic
1157449574 18:47775099-47775121 TTTTTAGTAGAGACAGGGCCAGG - Intergenic
1160650181 19:220512-220534 TTAATAGGAGAGGCAATGCATGG + Intergenic
1160885607 19:1345897-1345919 TTTTTTGGAGAGACAGGGCCTGG + Intergenic
1163467297 19:17475728-17475750 ATGTTAGGAGAGTCAGGGCAGGG - Intronic
1165932584 19:39369611-39369633 ATATCAGGAGAGCCAGGGTGGGG - Intronic
1168034704 19:53710104-53710126 TCATTAGGAGAGTAAGGGCCAGG + Intergenic
927233015 2:20843798-20843820 TGTTTGGGAGAGCCAAGGCAAGG + Intergenic
927240409 2:20915769-20915791 TTATGGGGAGGCCCAGGGCAGGG - Intergenic
927961910 2:27245903-27245925 TGATTAGGAGAGCCAAAGAAAGG - Intergenic
928649539 2:33389926-33389948 TTATAATGATAGGCAGGGCACGG - Intronic
928666640 2:33556535-33556557 TTATTAGAAGAGGCCGGGCGCGG - Intronic
928839729 2:35590699-35590721 CAATTAGGAGAGGTAGGGCAAGG - Intergenic
928992757 2:37252234-37252256 TTTTTAGCAGGGCCAGTGCAGGG - Exonic
930020781 2:47000908-47000930 TTATAAGCAGAGCCAGCCCAGGG + Intronic
931698668 2:64890988-64891010 TTATTAACTGAGCCAGGCCAAGG - Intergenic
932213125 2:69948320-69948342 TGATTAGCAGAGACAGGTCACGG + Intergenic
932795969 2:74696491-74696513 TTAATAAGAGAGGCAGGGCCGGG - Intergenic
935508621 2:103940473-103940495 TGGTTAGCAGAGGCAGGGCAGGG + Intergenic
936584457 2:113741820-113741842 TTATTAGTAGAGCCAGGGAATGG + Intronic
936636251 2:114261870-114261892 TATTTAGGAGAGCAAGGTCAAGG - Intergenic
938922271 2:136006156-136006178 TTATTAGCAGAGCTAAGTCATGG + Intergenic
939879463 2:147613551-147613573 TTTTTTGTAGAGACAGGGCAGGG + Intergenic
940224713 2:151389440-151389462 TTAAAAGAAGAGGCAGGGCATGG - Intergenic
942386235 2:175446368-175446390 TGATCAGGACAGCCAGGGGAAGG - Intergenic
942655863 2:178213410-178213432 TAAGTGGAAGAGCCAGGGCAGGG - Intronic
943063741 2:183065301-183065323 TTTTTAGTAGAGACAGGGCAGGG - Intergenic
943349359 2:186779263-186779285 TTTTTGGGCAAGCCAGGGCAGGG - Intergenic
943727423 2:191266626-191266648 TTTCTAGAAGAGCCAGGGCGAGG - Intronic
944069738 2:195655747-195655769 TTGTTTGGAAAGCCAGAGCATGG - Intronic
944759364 2:202797810-202797832 TTGTTAAGAGAGGCTGGGCATGG - Intronic
946440848 2:219693851-219693873 TTATTCTGAGAGCCAGGGGAAGG + Intergenic
946747907 2:222863611-222863633 TTTTTAGGAAAGCTAGGCCAAGG + Intronic
946964052 2:225017961-225017983 TGATTTGGAGAGGCAGGGAATGG - Intronic
947629704 2:231644228-231644250 TGATTTGGAGGGTCAGGGCAGGG - Intergenic
947845845 2:233243132-233243154 ATATTAGAATAGGCAGGGCATGG - Intronic
948533555 2:238629697-238629719 TTAGGAGGAGAGGCAGAGCACGG + Intergenic
1169113411 20:3047212-3047234 TTTTTAGGAGAGACGGGGCTTGG - Intronic
1171522639 20:25787325-25787347 TTTTTTGCAGAGCAAGGGCAGGG + Intronic
1171554188 20:26068558-26068580 TTTTTTGCAGAGCAAGGGCAGGG - Intergenic
1171867781 20:30500890-30500912 TTTTTAGTAGAGACGGGGCAAGG + Intergenic
1172706190 20:36883796-36883818 TTAAAAGGGAAGCCAGGGCAGGG + Intronic
1173826887 20:46053513-46053535 TGATGAGGAGATCCAGGGCCAGG - Intronic
1173923507 20:46763459-46763481 TTAGTAGAAGAGCCAGGCAAAGG + Intergenic
1175224097 20:57434780-57434802 TTCCCAGGAGAGCCAGGGAAAGG + Intergenic
1175816832 20:61887334-61887356 TGATTTCGAGAGGCAGGGCAGGG - Intronic
1176309005 21:5139963-5139985 CTCTTAGGGGTGCCAGGGCACGG - Intronic
1176517640 21:7798102-7798124 TTATCTGGAGACGCAGGGCAAGG - Intergenic
1176671664 21:9740441-9740463 GGAGTAGGAGAGCCAGAGCATGG + Intergenic
1177485294 21:21747848-21747870 TTATTAGGAAATACAGGGTAGGG - Intergenic
1178651668 21:34428114-34428136 TTATCTGGAGACGCAGGGCAAGG - Intergenic
1179644181 21:42765645-42765667 TTACTAGGAAAGTCCGGGCAGGG + Intronic
1179848056 21:44122070-44122092 CTCTTAGGGGTGCCAGGGCACGG + Intronic
1181270980 22:21658235-21658257 AGAGTAGGAGAGGCAGGGCAGGG - Intronic
1182673884 22:32021971-32021993 ATAGTGGGAGAGGCAGGGCATGG + Intergenic
1183227249 22:36558997-36559019 GTCTGAGGAGGGCCAGGGCAGGG - Intergenic
1183473190 22:38020558-38020580 TTTTTAGTAGAGGCCGGGCATGG - Intronic
1184757193 22:46523741-46523763 TTATTTGGGGAGCCTGGGGAGGG - Intronic
1185069624 22:48648928-48648950 TTCTCAGCAGAGTCAGGGCATGG + Intronic
951881436 3:27484340-27484362 TTAGTAGGAGAGCGAGGCCGCGG + Intronic
952293278 3:32039032-32039054 TTATAAAGAGGGTCAGGGCATGG + Intronic
953853604 3:46484509-46484531 TTTTTAGGGGAGCAAGGGTAGGG - Intronic
953860589 3:46541041-46541063 ATATTAGGATAGGCCGGGCATGG + Intronic
955745825 3:62139556-62139578 TTCTTGGAAGAGCCAGGGAAGGG - Intronic
957358392 3:79121084-79121106 TTATTAATAGAGACAGGGCCTGG - Intronic
965829961 3:172774674-172774696 TTTTTTGTAGAGACAGGGCAGGG + Intronic
966634363 3:182115574-182115596 CAACTGGGAGAGCCAGGGCAAGG + Intergenic
968367666 3:198199617-198199639 TTAATAGGAGAGGCAATGCATGG - Intergenic
968657572 4:1785313-1785335 TTATCAGGCCAGCCAGGCCAGGG - Intergenic
969201782 4:5612630-5612652 TAATTATGAGAGGCCGGGCATGG + Intronic
971485395 4:27155053-27155075 TTAGTAGGAGAGACAAAGCAGGG - Intergenic
972236449 4:37139169-37139191 TTATTAGAAAAGACAAGGCATGG + Intergenic
973777466 4:54256526-54256548 TTATTTGTAGAGGCTGGGCACGG - Intronic
973857554 4:55028530-55028552 TTATTAAGAGACCCAGTGCTTGG - Intergenic
978800222 4:112749075-112749097 TTATTAGTAGAGACAGGGTTTGG + Intergenic
979244001 4:118477616-118477638 TTAATAGGAGAGCCCTGGCCTGG + Intergenic
981049299 4:140294855-140294877 TAGTTATAAGAGCCAGGGCATGG - Intronic
982043206 4:151415362-151415384 TTTTTAGGAGAGCCAGGGTTTGG + Intronic
985964874 5:3332224-3332246 TTCTCAGCAGAGCCATGGCAGGG - Intergenic
986335677 5:6753608-6753630 TGATTGGGAGAGCCATGGCGAGG + Intronic
987016283 5:13823068-13823090 ATGGTAGGAGACCCAGGGCAAGG + Intronic
987103864 5:14617606-14617628 GGATTAGCAGAGCCATGGCAGGG + Intergenic
987420892 5:17719080-17719102 TTAATTCGAGAGCCAGTGCAAGG + Intergenic
988534708 5:32056648-32056670 ATAATAGGAGAGCTGGGGCAGGG + Intronic
989438584 5:41443595-41443617 TTATTAGGAGAGACAGAGCATGG + Intronic
992083687 5:73259178-73259200 CTTTGAGGAGAGCCAGGGCTGGG + Intergenic
997987368 5:138513395-138513417 TTTTTAGTAGAGACAGGGCCGGG + Intronic
998074955 5:139228345-139228367 TTATTAGGAGAGCCAGGGCAAGG - Intronic
998318245 5:141203368-141203390 ATACTAGGGGAGCCTGGGCACGG - Intergenic
998471140 5:142384820-142384842 TTTTTAGTAGAGACGGGGCAGGG - Intergenic
1002178332 5:177415563-177415585 TTAAAAGCAGAGCCAGGGTATGG + Intronic
1002498725 5:179633600-179633622 TTTTTTGGACAGGCAGGGCACGG - Intronic
1002511637 5:179723479-179723501 TTATAAGGAGAGCAAGAGGATGG + Intronic
1002726886 5:181304846-181304868 TTAATAGGAGAGGCAATGCATGG - Intergenic
1003609933 6:7603381-7603403 TTATTTGTAGAGTCTGGGCAAGG - Intronic
1003865187 6:10356599-10356621 TTATTAGTAGAGACAGGACCAGG - Intergenic
1006143560 6:31945208-31945230 TTGTCAGCAGAGCCAAGGCAGGG - Exonic
1011064061 6:83305374-83305396 TGATCAGGAGAGCCAGGGTGGGG + Intronic
1013858249 6:114602042-114602064 TCTTTAGGAGAACCAGGGTAAGG + Intergenic
1014030804 6:116701487-116701509 TTATTAACAGAGCCAGTGCTGGG - Intronic
1017412856 6:154187276-154187298 TTTTTACAAGAGGCAGGGCAAGG - Intronic
1018533972 6:164798965-164798987 TTATTCCCACAGCCAGGGCAAGG - Intergenic
1019729692 7:2623181-2623203 ATATTATGAGGGCCAGGGCCGGG - Intergenic
1022888265 7:34668779-34668801 AGCTTATGAGAGCCAGGGCAAGG - Intronic
1023849282 7:44141159-44141181 TTCCCAGGAGAGCCAGGGCCAGG + Intronic
1023880919 7:44320971-44320993 GCAAAAGGAGAGCCAGGGCAGGG + Intronic
1023938486 7:44755851-44755873 TTATAAGGATAGCCAGGCCTCGG + Intronic
1024090954 7:45939453-45939475 TGATCTGGAAAGCCAGGGCATGG + Intergenic
1024251175 7:47506778-47506800 TCTTTAGGAAAGCCAGGGCTGGG - Intronic
1025283117 7:57642525-57642547 TTTTTTGCAGAGCAAGGGCAGGG + Intergenic
1027655056 7:80919764-80919786 TTTTTAGTAGAGACAGGGCCAGG + Intronic
1028080872 7:86574069-86574091 TTTTTAGTAGAGACAGGGTAGGG - Intergenic
1028556856 7:92134457-92134479 TTAGTAGGAGACCTGGGGCAAGG - Exonic
1029977287 7:104846760-104846782 TTCATAGCAGAGCCAGGACAGGG - Intronic
1030053437 7:105560255-105560277 TTACTAGTGCAGCCAGGGCATGG + Intronic
1031867087 7:127049661-127049683 GTATTAGGAGAGCCATGAGAAGG + Intronic
1032846606 7:135756820-135756842 AAATTATGAGAGCCAGAGCATGG - Intergenic
1034983594 7:155494135-155494157 TTATTAGGACAGGCTGGACATGG - Intronic
1035970561 8:4243215-4243237 CTATTAGGAGAGTCAGGAAAGGG + Intronic
1037118836 8:15258463-15258485 GAAATAGGAGAGCCAGTGCAGGG - Intergenic
1039481940 8:37880474-37880496 TTTTTAGTAGAGACAGGGTATGG + Intronic
1041458974 8:58091049-58091071 TGGTTAGGAGAGCAAAGGCATGG - Intronic
1041508145 8:58624217-58624239 TTTTTAGTAGAGACAGGGCGGGG + Intronic
1041922132 8:63194191-63194213 TTTTTGGGAGAGGCCGGGCATGG + Intronic
1046407668 8:113795495-113795517 TTTTTAGGAGAGCCAGGAATAGG - Intergenic
1046888090 8:119391105-119391127 TTATTTGGATACCCATGGCAGGG + Intergenic
1050151070 9:2620437-2620459 TTTCCAGGAGAACCAGGGCAAGG + Intergenic
1051275478 9:15394128-15394150 TTTTTTGGAGAGCCAGGGTCTGG + Intergenic
1051420744 9:16886897-16886919 TCATTTGGAGAGTCAGGGTAAGG - Intergenic
1053363868 9:37509091-37509113 TTATTTGTAGAGACAGGGGAAGG + Intergenic
1056340287 9:85623462-85623484 TAAAGAGGAGAGGCAGGGCATGG + Intronic
1058440096 9:104998744-104998766 TTAGAAGGAGAGCCAAGGGACGG + Intergenic
1058777785 9:108302248-108302270 TTATTATCTGAGCCAGGGCAGGG + Intergenic
1059297012 9:113280192-113280214 TTATTAGGAGAGTGAAGGAAAGG - Intronic
1059365370 9:113782697-113782719 CTATTAGGAGGGCCAGGGCCAGG - Intergenic
1059376320 9:113884261-113884283 ATAGTCGGAGAGCCAAGGCACGG + Intronic
1059492266 9:114678282-114678304 TTATTTGGGCAGCCAGGGGAAGG - Intergenic
1060016150 9:120088121-120088143 TTATTACAAAGGCCAGGGCAAGG + Intergenic
1060224739 9:121783936-121783958 TTGCCAGCAGAGCCAGGGCAGGG + Exonic
1060764678 9:126284686-126284708 TTCTTAGGATAGCCAGTGCTTGG - Intergenic
1060855341 9:126910551-126910573 TTTTTAGTAGAGACAGGGCCAGG - Intergenic
1061378105 9:130238027-130238049 TGATTAGGAGGGTCTGGGCAGGG + Intergenic
1062249243 9:135586045-135586067 TCAGTAGGAGCTCCAGGGCATGG + Intergenic
1062752007 9:138262322-138262344 TTAATAGGAGAGGCAATGCATGG - Intergenic
1186767492 X:12785883-12785905 TTAGTAGGAGAGGCTGTGCATGG - Intergenic
1188902553 X:35752023-35752045 TTATTTTGAAAGTCAGGGCATGG - Intergenic
1192910999 X:75604191-75604213 TTATTAGGAGAGGCTGTGGAGGG + Intergenic
1199810770 X:151346453-151346475 GGATTAGCAGAGCCTGGGCAGGG + Intergenic
1201858022 Y:18567006-18567028 CTATTAGCAGAGCTAGGGCCTGG - Intronic
1201875299 Y:18753375-18753397 CTATTAGCAGAGCTAGGGCCTGG + Intronic