ID: 998080864

View in Genome Browser
Species Human (GRCh38)
Location 5:139274057-139274079
Sequence CCCAGTAGCCGCCCCGGGGC GGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 240
Summary {0: 1, 1: 0, 2: 0, 3: 18, 4: 221}

Found 9 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
998080851_998080864 15 Left 998080851 5:139274019-139274041 CCTAGGCGGGGTCAAGGGCCCCG 0: 1
1: 0
2: 1
3: 9
4: 142
Right 998080864 5:139274057-139274079 CCCAGTAGCCGCCCCGGGGCGGG 0: 1
1: 0
2: 0
3: 18
4: 221
998080847_998080864 24 Left 998080847 5:139274010-139274032 CCGGCCTTTCCTAGGCGGGGTCA 0: 1
1: 0
2: 0
3: 6
4: 79
Right 998080864 5:139274057-139274079 CCCAGTAGCCGCCCCGGGGCGGG 0: 1
1: 0
2: 0
3: 18
4: 221
998080856_998080864 -9 Left 998080856 5:139274043-139274065 CCACCGAAGCCACGCCCAGTAGC 0: 1
1: 0
2: 0
3: 10
4: 101
Right 998080864 5:139274057-139274079 CCCAGTAGCCGCCCCGGGGCGGG 0: 1
1: 0
2: 0
3: 18
4: 221
998080846_998080864 25 Left 998080846 5:139274009-139274031 CCCGGCCTTTCCTAGGCGGGGTC 0: 1
1: 0
2: 0
3: 5
4: 102
Right 998080864 5:139274057-139274079 CCCAGTAGCCGCCCCGGGGCGGG 0: 1
1: 0
2: 0
3: 18
4: 221
998080855_998080864 -8 Left 998080855 5:139274042-139274064 CCCACCGAAGCCACGCCCAGTAG 0: 1
1: 0
2: 1
3: 5
4: 95
Right 998080864 5:139274057-139274079 CCCAGTAGCCGCCCCGGGGCGGG 0: 1
1: 0
2: 0
3: 18
4: 221
998080852_998080864 -3 Left 998080852 5:139274037-139274059 CCCCGCCCACCGAAGCCACGCCC 0: 1
1: 0
2: 1
3: 36
4: 258
Right 998080864 5:139274057-139274079 CCCAGTAGCCGCCCCGGGGCGGG 0: 1
1: 0
2: 0
3: 18
4: 221
998080854_998080864 -5 Left 998080854 5:139274039-139274061 CCGCCCACCGAAGCCACGCCCAG 0: 1
1: 0
2: 1
3: 36
4: 285
Right 998080864 5:139274057-139274079 CCCAGTAGCCGCCCCGGGGCGGG 0: 1
1: 0
2: 0
3: 18
4: 221
998080853_998080864 -4 Left 998080853 5:139274038-139274060 CCCGCCCACCGAAGCCACGCCCA 0: 1
1: 0
2: 2
3: 27
4: 231
Right 998080864 5:139274057-139274079 CCCAGTAGCCGCCCCGGGGCGGG 0: 1
1: 0
2: 0
3: 18
4: 221
998080849_998080864 20 Left 998080849 5:139274014-139274036 CCTTTCCTAGGCGGGGTCAAGGG 0: 1
1: 0
2: 0
3: 10
4: 69
Right 998080864 5:139274057-139274079 CCCAGTAGCCGCCCCGGGGCGGG 0: 1
1: 0
2: 0
3: 18
4: 221

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
998080864 Original CRISPR CCCAGTAGCCGCCCCGGGGC GGG Exonic
900110383 1:1003014-1003036 CCCAGCTGCTGCCCAGGGGCAGG - Intergenic
901686366 1:10945821-10945843 CACTGAAGCCTCCCCGGGGCTGG + Intergenic
901797968 1:11691590-11691612 CCGAGGGGCAGCCCCGGGGCCGG - Exonic
903813369 1:26046852-26046874 CCCAGGAGCCGCTGCGGGGGAGG - Intergenic
903932507 1:26871288-26871310 CCCAGAAGCTGCCATGGGGCAGG + Intergenic
904036874 1:27563765-27563787 CCCAGCACCCGCCACTGGGCGGG - Intronic
904542065 1:31239811-31239833 CCCGCCAGCCGCCCCGGGGCAGG - Intergenic
905504223 1:38464293-38464315 CACAGTAGCTTCCCCTGGGCTGG - Intergenic
905584350 1:39105340-39105362 CGCTGCAGCCGCGCCGGGGCGGG + Intronic
905971550 1:42145811-42145833 CCCAGCAGCCGGCCGGGCGCTGG - Intergenic
908951691 1:69568724-69568746 CCCAGAGGCCGGCCGGGGGCGGG + Intronic
917057819 1:171003541-171003563 CCCAGTACCAGCCCAGAGGCTGG - Intronic
918423667 1:184387419-184387441 CCGGGTAGCCGAGCCGGGGCGGG - Intronic
921866614 1:220093991-220094013 CCCTGCAGCCGCCGGGGGGCGGG - Intergenic
921923415 1:220691924-220691946 CCCTGAAGCCCCCCCGGGGGCGG - Intronic
922732100 1:227954029-227954051 CTCAGCAGACGCCCCTGGGCTGG - Intergenic
1062947977 10:1475161-1475183 CTCAGGAGCCCCCCCGGGGCAGG + Intronic
1064553051 10:16521406-16521428 CCCGGTGGCCGCGCCGGCGCCGG - Exonic
1066064251 10:31750626-31750648 CCCAGTGCCCGCCTCGGGGAGGG + Intergenic
1069709265 10:70478635-70478657 CCCAGCCGCAGCCCCCGGGCGGG - Intergenic
1069859233 10:71460220-71460242 CCCTGTACCAGCCCCTGGGCTGG - Intronic
1070786903 10:79167134-79167156 CCCAGTAGCCTTCCCTGGACAGG + Intronic
1070954354 10:80454512-80454534 CCCAGGAGCGGCCCCGCGGGCGG + Intronic
1073196425 10:101695101-101695123 CCCATGAGCGGCCGCGGGGCCGG + Exonic
1075539346 10:123299388-123299410 CCCACCACCCACCCCGGGGCTGG - Intergenic
1075748436 10:124743994-124744016 CACAGTAAGCGACCCGGGGCCGG - Exonic
1076697933 10:132256053-132256075 CCCAGTTGGCTCCCCGAGGCTGG - Intronic
1077056995 11:598640-598662 CACAGAAGCCGCGCCGGGCCCGG + Intronic
1077178400 11:1200910-1200932 CTCAGGACCAGCCCCGGGGCTGG + Intronic
1077184696 11:1230842-1230864 CCCAGTGGGGGCCCCTGGGCAGG + Intronic
1077608091 11:3625778-3625800 CCCAGTACCAGACCTGGGGCTGG - Intergenic
1079362000 11:19777278-19777300 CGCAGCAGCGGCCCCGGGGCGGG + Intronic
1080443078 11:32313338-32313360 CCCAGCACCCGCCCCTGGGGAGG + Intergenic
1082916928 11:58447005-58447027 CCCAGTAGCAGCCCAGAGCCAGG + Intergenic
1083843000 11:65315247-65315269 CCCAGCATCCCCACCGGGGCTGG + Intronic
1084086329 11:66856979-66857001 CTCAGGAGCCGGCCCGGGCCCGG + Intronic
1084310500 11:68313418-68313440 CCGCGTAGCCGACCCGGGGATGG - Intronic
1085049088 11:73370659-73370681 TCCAGGAGCCTCCCCTGGGCCGG - Intergenic
1085463388 11:76708563-76708585 TCCAGCAGCCCCCCCGAGGCAGG - Intergenic
1088369490 11:109073738-109073760 CCCAGCAGCCTCCCAGGTGCTGG - Intergenic
1088810204 11:113387147-113387169 CCCCGTGGCCACCCCGAGGCTGG + Intergenic
1089309293 11:117547345-117547367 CCCAGTAGCTGCACGGCGGCAGG + Intronic
1095958442 12:47819486-47819508 GCCTGTAGCTGCCCCGGGGCGGG + Intronic
1096396371 12:51269776-51269798 CGCAGTAGCCGGGCCGGGACCGG + Intronic
1101893012 12:108732268-108732290 CAGAGTGGCCGCCCCTGGGCTGG + Intergenic
1102829849 12:115987895-115987917 CCCAGCAGTCGCCCTGGGGAGGG + Intronic
1104941394 12:132397198-132397220 CCCAGGAGGGGCCCCGGGGAGGG - Intergenic
1104941413 12:132397259-132397281 CCCAGGAGGGGCCCCGGGGAGGG - Intergenic
1104941467 12:132397442-132397464 CCCAGGAGGGGCCCCGGGGAGGG - Intergenic
1104941520 12:132397621-132397643 CCCAGGAGGGGCCCCGGGGAGGG - Intergenic
1104941559 12:132397743-132397765 CCCAGGAGGGGCCCCGGGGAGGG - Intergenic
1104941574 12:132397804-132397826 CCCAGGAGGGGCCCCGGGGAGGG - Intergenic
1104941594 12:132397888-132397910 CCCAGGAGGGGCCCCGGGGAGGG - Intergenic
1104973760 12:132542962-132542984 ACCCGTAGCCGCCCAGGGTCTGG + Intronic
1105897185 13:24726334-24726356 CCCAGGAAACGCCCTGGGGCCGG + Intergenic
1106922519 13:34578735-34578757 CCCACAAGCAGCCCCGGGCCTGG - Intergenic
1108484493 13:50910231-50910253 CCCACTACCCGGCCCGGCGCGGG + Intronic
1108872160 13:55001045-55001067 CCTAGTCCCCGCCACGGGGCCGG + Intergenic
1109545607 13:63837846-63837868 CTCAGTAGCCGCCTCGCGGGGGG - Intergenic
1112088076 13:96052982-96053004 CCGAGAAGCCGCCCCGGGTCGGG + Intronic
1112328280 13:98458553-98458575 ACGAGTGGCCGCCTCGGGGCCGG - Intronic
1116821950 14:49634827-49634849 CCCAGCAGCCGGCCCGGCTCCGG - Exonic
1117176553 14:53152468-53152490 CCCGGTCCCCGCCCTGGGGCCGG + Exonic
1119296541 14:73537761-73537783 CACAGCAGCCGCCCGGGGTCGGG - Exonic
1119300785 14:73569766-73569788 CACAGCAGCCGCCCGGGGTCGGG - Exonic
1120736281 14:88057057-88057079 CCCAGTACCAGCCCGGAGGCTGG - Intergenic
1121645932 14:95516873-95516895 CCCTGTCGCGGACCCGGGGCGGG + Intronic
1122179185 14:99943361-99943383 CCATGTAGGCGCCCCAGGGCAGG - Intergenic
1122634349 14:103123236-103123258 CCCAGCAGCCGGGCAGGGGCGGG - Intergenic
1122771490 14:104099826-104099848 CCCTGGAGCCTCCCCGGGGCTGG - Intronic
1122905026 14:104797653-104797675 CCCAGCAGCAGCCGTGGGGCTGG - Intergenic
1122918692 14:104870753-104870775 CTCAGTGGCCGCCCCTGGCCTGG + Intronic
1123026330 14:105425970-105425992 CCCGGCAGCCTCCCTGGGGCGGG + Intronic
1124247270 15:28081704-28081726 CCCGGCAGCCCCCCTGGGGCAGG + Exonic
1127355611 15:58196276-58196298 CCCAGTAGTCACTCAGGGGCAGG - Intronic
1129301589 15:74628692-74628714 CCCAGTAGCCCCCTCAGGGTTGG + Intronic
1130014596 15:80176750-80176772 ACCAGTGGCCTCCCCCGGGCGGG - Intronic
1132155783 15:99494684-99494706 CCCATTGGCCGCCCAAGGGCTGG - Intergenic
1132681761 16:1145353-1145375 CCGCGTAGCTGCCCCGGGGATGG - Intergenic
1132994748 16:2817201-2817223 CCCAGGGGGCGCCCCGGGCCCGG + Intronic
1133021625 16:2969451-2969473 CCCAGCCTCCGCCCCGGCGCGGG + Exonic
1133946855 16:10355926-10355948 CCCAGTAGCCTCCCCGAGTCTGG - Intronic
1134085467 16:11354491-11354513 CCCAGTAGTAGCCCCTGAGCTGG + Intergenic
1134441559 16:14302186-14302208 CCCTATGGCCGGCCCGGGGCGGG - Intergenic
1135417588 16:22280392-22280414 CCCTGTTGCAGCCCAGGGGCAGG - Intronic
1135429779 16:22373854-22373876 CCGAGAAGCCGCCCCGTCGCAGG - Intronic
1139289412 16:65844016-65844038 CCCAGTGGGTGCCCCTGGGCTGG + Intergenic
1139570255 16:67807046-67807068 CCCAGAGGCCCCCCCGCGGCGGG - Intronic
1139859541 16:70009891-70009913 ACCAGTGGCCGCCCAGAGGCGGG - Intergenic
1141509203 16:84501677-84501699 CCCAGTAGGAACCCCAGGGCTGG + Intronic
1141675314 16:85514434-85514456 CCCAGGAGCTGCCCTGGGGTGGG - Intergenic
1141836738 16:86545605-86545627 CTCAGTAGCGGCCTCAGGGCTGG - Intronic
1142120108 16:88382992-88383014 CCCAGCACCCGGCCCAGGGCTGG + Intergenic
1142227410 16:88884334-88884356 CCCAGGAGCCCCCCCAGGACAGG - Intronic
1142354215 16:89594488-89594510 CACAGCAGCCTCCCCTGGGCTGG - Intronic
1142592632 17:1013012-1013034 CCCAGGAGCAGCCACAGGGCCGG + Intronic
1142757482 17:2024696-2024718 CCCAGCAGCAGCCCCTCGGCGGG + Intronic
1143001575 17:3798240-3798262 CACAGTAGCCTCCCCGGCCCCGG - Intronic
1143174476 17:4948387-4948409 CCCAGTAGCAGCGCCATGGCCGG - Exonic
1143183369 17:4997454-4997476 CCGAGTAGCCGCGCCACGGCCGG + Intronic
1143550400 17:7627142-7627164 CCCAGTAGCTTCCCGGGCGCTGG + Exonic
1143602851 17:7960605-7960627 CCCAGGGGCCTCTCCGGGGCAGG + Intergenic
1149280948 17:55105381-55105403 CCCAGTAGTCATCCAGGGGCAGG + Intronic
1149993078 17:61393534-61393556 CCCAGGAGCTGCCCCAGGTCTGG - Intergenic
1152095207 17:78268478-78268500 CCCAGTAGGCCCTCCGGGGCCGG + Intergenic
1158357658 18:56638679-56638701 CCCAGCAGCCACCGCGCGGCAGG + Intronic
1159016909 18:63108458-63108480 CTCAATAGCCGCCCTGTGGCAGG + Intergenic
1160558767 18:79743027-79743049 GCCAGTAGCCGCGCCGAGGAGGG + Intronic
1160675488 19:389047-389069 CCCAGAAGCGGCCCAGAGGCCGG - Intergenic
1161153534 19:2721285-2721307 CCAGGTAGGCGGCCCGGGGCGGG - Exonic
1161800785 19:6415854-6415876 ACCAGTACCCACCCCAGGGCTGG - Exonic
1162698478 19:12495749-12495771 CTCAGTAGCCGCGCGGGGACAGG - Intronic
1163123498 19:15232043-15232065 CGCAGCAGCCGCGCCGGGGCCGG + Exonic
1163158204 19:15450068-15450090 CCCCCTCGCCGCCCCGGGGGGGG + Intergenic
1163313049 19:16525462-16525484 ACGAGCAGCCGCCCTGGGGCGGG - Exonic
1165446329 19:35858708-35858730 CCCAGAAGCCCCCCAGGTGCTGG + Exonic
1166391372 19:42410656-42410678 CCCAGCAGGCGGCCCAGGGCCGG + Exonic
1166897602 19:46033609-46033631 GCCAGTTGCTGCCACGGGGCGGG - Intergenic
1167040618 19:47020828-47020850 CACCCTAGCCGGCCCGGGGCTGG - Intronic
926579166 2:14615859-14615881 CCCAGTAGCCTTACTGGGGCAGG + Intergenic
926943698 2:18165470-18165492 CCCAGTAGTCGCTCAGGAGCAGG + Intronic
927203695 2:20593789-20593811 CCCTGGAGCCGCCACGGGGATGG + Intronic
933560107 2:83877446-83877468 CACAGTGGCCGCTCCGAGGCCGG + Intergenic
936954965 2:118014057-118014079 CCCGGTAGCAGCTCCGCGGCAGG - Exonic
938996454 2:136683655-136683677 CCCAGTACCAGCCCAGGGCCTGG + Intergenic
939992437 2:148888166-148888188 CCCAGTCGCCGGCCCCGGGAAGG + Intronic
941384967 2:164841478-164841500 CCCAGTAAACCCCACGGGGCGGG - Intronic
941782536 2:169460546-169460568 CCCAGTAACCAGCCTGGGGCTGG + Intergenic
945225890 2:207530515-207530537 ACCCGGAGCCGCCCCGGGGGAGG + Intronic
947834548 2:233166161-233166183 CCCAGCAACCGCCCCGGGTGTGG + Intronic
948364557 2:237446206-237446228 CCCAGGAACCCCACCGGGGCAGG - Intergenic
949023085 2:241752300-241752322 CCCAGAGGACGCCCCTGGGCTGG - Intronic
1169214732 20:3786516-3786538 CGCCGCCGCCGCCCCGGGGCGGG + Exonic
1172773787 20:37395998-37396020 CTCTGTGGCTGCCCCGGGGCTGG + Intronic
1173166096 20:40688279-40688301 CCCACTAGCCACCCCGGGCCCGG - Exonic
1173813581 20:45971266-45971288 CGCCGCGGCCGCCCCGGGGCAGG - Exonic
1173946204 20:46952737-46952759 CCCACTGGCTTCCCCGGGGCAGG + Intronic
1174056353 20:47800881-47800903 CCCAGTAGCTTCCCCGGGCCAGG + Intergenic
1174376198 20:50128263-50128285 CTCAGGAGCCGCCCAGGAGCAGG - Intronic
1175366811 20:58461443-58461465 CCCACCAGCCGCCCAGGTGCAGG + Exonic
1175985700 20:62763253-62763275 CTCAGTAGCCTGCACGGGGCTGG - Intergenic
1178681042 21:34671942-34671964 CCCAGCAGCCTCTCAGGGGCTGG - Intronic
1179176393 21:39010950-39010972 CCCAGCACCCACCCCAGGGCAGG - Intergenic
1179802611 21:43818027-43818049 CCCAGGGGCTGCCCCGGGCCTGG + Intergenic
1179893747 21:44350430-44350452 CCCTGCAGCAGCACCGGGGCCGG - Intronic
1181670652 22:24424161-24424183 GCCGGCAGCCGCCGCGGGGCAGG - Intronic
1183201496 22:36388048-36388070 CCCAGGCTCCGCCCCGGAGCCGG - Intergenic
1183486232 22:38089064-38089086 CCCTCCTGCCGCCCCGGGGCGGG + Intronic
1183607138 22:38872374-38872396 CCTAGCAACCGCCCCGGGGGAGG - Intergenic
1183903378 22:41022302-41022324 CCCAGAGGCCGCACCTGGGCCGG + Intergenic
1184749633 22:46477923-46477945 CCCAGCATCCTCCCGGGGGCTGG - Intronic
1184788817 22:46686531-46686553 CCCAGCAGCCTTCCCGGCGCTGG + Exonic
1185008621 22:48300304-48300326 CCCAGTGGCTGCCCCAGGCCTGG - Intergenic
1185106535 22:48872970-48872992 GCCAGCAGCCGCCCCAGGGAAGG - Intergenic
1185130320 22:49035245-49035267 ACCAGGAGCCTCCCAGGGGCCGG - Intergenic
954156426 3:48687346-48687368 CCCAGAAGCCCTCCTGGGGCAGG + Intergenic
954374674 3:50188021-50188043 CCCTGGAGCCTCCCTGGGGCTGG - Exonic
956269043 3:67430333-67430355 CCCAGTAGCCACTCAGGAGCAGG - Intronic
958013880 3:87915043-87915065 CCCAGTACCAGCCCAGAGGCAGG + Intergenic
960971417 3:123142695-123142717 CCCAGAGGCTGCCCCTGGGCTGG - Intronic
966982844 3:185153570-185153592 CCCTGTGGCCGCGCTGGGGCAGG - Intergenic
968728872 4:2260621-2260643 CCCAGTAGGGGACCAGGGGCTGG + Intronic
969614108 4:8242376-8242398 TCCAGAACCCGCCGCGGGGCTGG + Intergenic
972304726 4:37820549-37820571 CCCAGCAGCCGCCCCCGCCCGGG + Intergenic
973034713 4:45391200-45391222 CCCAGGAGCCACCCGGGGCCAGG + Intergenic
974047289 4:56908404-56908426 CACAGCAGCCGCCCGGGGGCTGG + Intronic
975132001 4:70839999-70840021 CCCAGTCTCCGCCCTTGGGCGGG + Intergenic
978973159 4:114835375-114835397 CCCAGTAGTCACCCAGGAGCAGG + Intronic
979141575 4:117182694-117182716 CCCAGTAGCCACTCCGGGGTAGG + Intergenic
983425767 4:167581910-167581932 CCCATTGACCGCCCAGGGGCTGG + Intergenic
991958744 5:72021064-72021086 CCCAGCAGACGCCCCAGAGCTGG + Intergenic
994670251 5:102755116-102755138 CCCGGGAGCCGCCCCCGGGGAGG + Intronic
996080868 5:119256395-119256417 CCCAGTAGCAGCCCAGAGCCTGG + Intergenic
996567269 5:124892759-124892781 ACCAGGAGCCGCCCTGGAGCAGG - Intergenic
998080864 5:139274057-139274079 CCCAGTAGCCGCCCCGGGGCGGG + Exonic
998567739 5:143231219-143231241 CCCAGTACCCAGCCCAGGGCTGG + Intergenic
999328291 5:150656798-150656820 CACAGCAGCCGAGCCGGGGCGGG - Intronic
999602854 5:153285816-153285838 CCCAGTAGTCACCCAGGAGCAGG - Intergenic
1001395780 5:171419111-171419133 CAGTGGAGCCGCCCCGGGGCTGG + Intergenic
1004660629 6:17706407-17706429 CCCCTTACCCGCCCCGGAGCGGG - Exonic
1005662519 6:28013650-28013672 CCCAGTATACTCACCGGGGCTGG + Intergenic
1006453790 6:34120672-34120694 CCCAGCAGCCTCCCAGGAGCAGG + Intronic
1009695575 6:67098278-67098300 CCCAGTAGCCACTCAGGAGCAGG - Intergenic
1012225145 6:96694752-96694774 CCCAGTACCAGCCCAGAGGCTGG + Intergenic
1015366386 6:132401576-132401598 CCCTGCAGGCGGCCCGGGGCGGG - Intergenic
1016435896 6:144036541-144036563 CCCGGTAGCAGCCCCAGGACTGG - Intronic
1017163773 6:151390277-151390299 CCCCGGCCCCGCCCCGGGGCGGG - Intronic
1017717158 6:157221070-157221092 GCCAGGAGCCGGCCAGGGGCGGG - Intergenic
1018872761 6:167796015-167796037 TGCAGGAGCCGCCCCGAGGCAGG + Intronic
1018909105 6:168091707-168091729 CCCAGTAGAGGCCCACGGGCTGG + Intergenic
1020383004 7:7566829-7566851 CCCGGGAGGCGCCTCGGGGCGGG - Intergenic
1024408170 7:49006865-49006887 CCCAGTAGCCATTCAGGGGCAGG + Intergenic
1024455831 7:49605412-49605434 CCCAGTAGCAGCCCAGAGCCTGG + Intergenic
1025236647 7:57239273-57239295 CCCAGCAGCTTCCCCGGGCCAGG - Intergenic
1028987670 7:97021119-97021141 TCCAGTCGCCGCCCCGGGGAAGG - Intronic
1034254017 7:149714754-149714776 CCCAGAAGGCGCCGCGGCGCCGG - Intergenic
1034421112 7:150991420-150991442 CACAGCAGCGGCCCAGGGGCAGG + Intronic
1034509248 7:151520556-151520578 CGCACCAGCCGCCCCGGTGCTGG - Intergenic
1035438960 7:158880014-158880036 CTTAGCAGCCGCCCCGAGGCCGG + Intronic
1037262924 8:17027599-17027621 CCGAGGACCCGCCCCGCGGCCGG + Exonic
1039453719 8:37695284-37695306 CCCAGAGGCCGCCTGGGGGCAGG - Intergenic
1042903061 8:73747085-73747107 CCCGGCAGCCGCCAGGGGGCGGG - Intronic
1043567992 8:81570034-81570056 GCCAGTTGCTGCCACGGGGCGGG + Intergenic
1047763625 8:127972239-127972261 CCCAGTGGCCTCCGTGGGGCAGG + Intergenic
1049212169 8:141391889-141391911 CCCCGAGGCCGCCCCTGGGCTGG - Intergenic
1049279753 8:141738229-141738251 CCCAGGAGCCGACCCGGGGGTGG + Intergenic
1049306742 8:141908001-141908023 CCCAGAAGCAGCCCTGGGGCGGG + Intergenic
1049336811 8:142090989-142091011 CCCAGCAGCCGCCCTGGAACCGG - Intergenic
1049541445 8:143210943-143210965 CCCACTAGCCTTTCCGGGGCGGG + Intergenic
1049621085 8:143598578-143598600 CCCCGTAGCCGCCCTCGGCCGGG - Exonic
1049685206 8:143936674-143936696 CGCAGAAGCCTCCCCAGGGCAGG + Intronic
1049788494 8:144462544-144462566 CCCGGCGGCCGCCCCGGGCCCGG + Intronic
1050147450 9:2584014-2584036 CCCAGTACCAGCCCCGAGCCAGG + Intergenic
1052451684 9:28639078-28639100 CCCAGTAGCCACTCAGGAGCAGG + Intronic
1052478570 9:28992747-28992769 CCCAGTAGCCACTCAGGAGCAGG - Intergenic
1057232903 9:93335621-93335643 CCCAGGGGGCGCCCCGGGCCAGG - Exonic
1057252609 9:93516000-93516022 CCCAGGGGGCGCCCCGGGCCAGG + Exonic
1057337434 9:94166612-94166634 CCGCGTGGCCGCCGCGGGGCCGG + Intergenic
1057488613 9:95506050-95506072 CCCGAGAGGCGCCCCGGGGCTGG - Intronic
1058070799 9:100598860-100598882 CGCAGTAAGCGCGCCGGGGCCGG + Intergenic
1059123276 9:111661545-111661567 CGCGGGTGCCGCCCCGGGGCGGG - Exonic
1059248560 9:112867866-112867888 CTCAGTAGCAGCCCCAGGGGTGG - Intronic
1059249022 9:112871647-112871669 CCTAGCAGCCGCCCCAGGCCTGG + Exonic
1060200941 9:121651564-121651586 CCCAGCCCCCGCCGCGGGGCCGG + Intronic
1061575593 9:131503816-131503838 CCCAGGAGCTGCCCAGGGTCAGG + Intronic
1062033157 9:134371180-134371202 CCCAGCAGCCCCCACTGGGCCGG - Intronic
1062373189 9:136250809-136250831 CTAAGCAGCCGCCCCGGGGCTGG + Intergenic
1062478952 9:136742694-136742716 CCCGGCAGCCGCCCAGGAGCAGG - Intronic
1062497976 9:136840532-136840554 GGCAGTGGCCGCCCTGGGGCGGG + Exonic
1062696968 9:137880500-137880522 CCCAGGAGCCAGGCCGGGGCGGG + Intronic
1185464139 X:345329-345351 CCCAGTCGCTGCCCCGTGTCTGG - Intronic
1186350119 X:8731941-8731963 CGCAGCAGCCGCGCCGGGGCCGG + Exonic
1188664578 X:32803719-32803741 CCCAGTAGTCACCCAGGAGCAGG + Intronic
1192086391 X:68102257-68102279 CCCAGTAGTCACCCAGGAGCAGG - Intronic
1192274472 X:69615932-69615954 CCCAGGCCCCGCCCCGCGGCTGG + Intergenic
1193030161 X:76889048-76889070 CCCAGTAGCCACTCAGGAGCAGG - Intergenic
1193601884 X:83516757-83516779 CCCAGCAGCCTCCTCAGGGCAGG + Intergenic
1194127753 X:90040989-90041011 CCCCGCAGCCGCCAGGGGGCGGG - Intergenic
1199724781 X:150569001-150569023 CCCACTCACCGCCCCGGGACGGG - Intronic
1201494008 Y:14573855-14573877 CCCAGTAGCCATTCAGGGGCAGG + Intronic