ID: 998080869

View in Genome Browser
Species Human (GRCh38)
Location 5:139274068-139274090
Sequence CCCCGGGGCGGGGTTCCCCT CGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 165
Summary {0: 1, 1: 0, 2: 0, 3: 18, 4: 146}

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
998080852_998080869 8 Left 998080852 5:139274037-139274059 CCCCGCCCACCGAAGCCACGCCC 0: 1
1: 0
2: 1
3: 36
4: 258
Right 998080869 5:139274068-139274090 CCCCGGGGCGGGGTTCCCCTCGG 0: 1
1: 0
2: 0
3: 18
4: 146
998080853_998080869 7 Left 998080853 5:139274038-139274060 CCCGCCCACCGAAGCCACGCCCA 0: 1
1: 0
2: 2
3: 27
4: 231
Right 998080869 5:139274068-139274090 CCCCGGGGCGGGGTTCCCCTCGG 0: 1
1: 0
2: 0
3: 18
4: 146
998080859_998080869 -7 Left 998080859 5:139274052-139274074 CCACGCCCAGTAGCCGCCCCGGG 0: 1
1: 0
2: 1
3: 20
4: 211
Right 998080869 5:139274068-139274090 CCCCGGGGCGGGGTTCCCCTCGG 0: 1
1: 0
2: 0
3: 18
4: 146
998080857_998080869 -1 Left 998080857 5:139274046-139274068 CCGAAGCCACGCCCAGTAGCCGC 0: 1
1: 0
2: 0
3: 4
4: 67
Right 998080869 5:139274068-139274090 CCCCGGGGCGGGGTTCCCCTCGG 0: 1
1: 0
2: 0
3: 18
4: 146
998080855_998080869 3 Left 998080855 5:139274042-139274064 CCCACCGAAGCCACGCCCAGTAG 0: 1
1: 0
2: 1
3: 5
4: 95
Right 998080869 5:139274068-139274090 CCCCGGGGCGGGGTTCCCCTCGG 0: 1
1: 0
2: 0
3: 18
4: 146
998080851_998080869 26 Left 998080851 5:139274019-139274041 CCTAGGCGGGGTCAAGGGCCCCG 0: 1
1: 0
2: 1
3: 9
4: 142
Right 998080869 5:139274068-139274090 CCCCGGGGCGGGGTTCCCCTCGG 0: 1
1: 0
2: 0
3: 18
4: 146
998080856_998080869 2 Left 998080856 5:139274043-139274065 CCACCGAAGCCACGCCCAGTAGC 0: 1
1: 0
2: 0
3: 10
4: 101
Right 998080869 5:139274068-139274090 CCCCGGGGCGGGGTTCCCCTCGG 0: 1
1: 0
2: 0
3: 18
4: 146
998080854_998080869 6 Left 998080854 5:139274039-139274061 CCGCCCACCGAAGCCACGCCCAG 0: 1
1: 0
2: 1
3: 36
4: 285
Right 998080869 5:139274068-139274090 CCCCGGGGCGGGGTTCCCCTCGG 0: 1
1: 0
2: 0
3: 18
4: 146

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
998080869 Original CRISPR CCCCGGGGCGGGGTTCCCCT CGG Exonic
900314703 1:2050900-2050922 CCCCGGGACCGGGTTTCCCTGGG + Intronic
900345640 1:2209057-2209079 CCCCCAGGCCGGGTTCCCCAGGG + Intronic
900591710 1:3463164-3463186 CCCGGAGGCTGGGTTCCCCCCGG - Exonic
900793949 1:4696406-4696428 CCCAGGGACAGGGCTCCCCTAGG - Intronic
901895047 1:12304578-12304600 CCCTGGGAATGGGTTCCCCTGGG - Exonic
902946710 1:19846036-19846058 CCTAGGAGCTGGGTTCCCCTCGG + Intergenic
903813033 1:26045550-26045572 CCCCGGGGCGGGGCTGCCTGGGG + Intronic
905803942 1:40862495-40862517 CCAAGGGGCGGGGTTCCAGTGGG - Intergenic
906263142 1:44407845-44407867 CCCCGGGGCGGGGCTGCTCGGGG + Intronic
906452276 1:45960640-45960662 TCCCGTGGCCTGGTTCCCCTGGG - Intronic
919892014 1:201982607-201982629 GCTCGGGGCGGGGCTCCCCTCGG + Exonic
922753853 1:228083241-228083263 CCCCGAGGCGGGGGTCCGCCCGG - Exonic
924172444 1:241356760-241356782 CCCCGGCGCGGGGCTCCCGGGGG + Intronic
1069509304 10:69029690-69029712 TCCCCAGGCTGGGTTCCCCTTGG - Intergenic
1075705429 10:124497508-124497530 CCTCCGGGTGGGGCTCCCCTGGG + Intronic
1076747091 10:132519946-132519968 CCCCGGGGCTGGCGTCCCCTGGG - Intergenic
1076849614 10:133086548-133086570 CCCCAGGCCGGGGGTCCCCATGG - Intronic
1077445832 11:2590399-2590421 TCCCAGGGCGTGGTCCCCCTTGG + Intronic
1077459068 11:2699774-2699796 CCCCTCGGCGCGGTTCTCCTCGG - Intronic
1078429767 11:11280134-11280156 CCCCGGGCGGGGGGTGCCCTGGG - Intronic
1080588342 11:33700522-33700544 CGCCGGGGCGGGGAGCGCCTGGG + Exonic
1084165588 11:67373425-67373447 CCCCGGCGCGGGGCTCCCGGGGG + Intronic
1084215642 11:67645572-67645594 CCCCGGGCCTAGTTTCCCCTGGG - Intronic
1084276359 11:68053107-68053129 CCCCTGGGCAGGGTTCTCCAAGG - Exonic
1084728596 11:71058830-71058852 CCCAGGGATGGGGTTCCCCCGGG - Intronic
1088764648 11:112963212-112963234 CCGCAGGGCGGGGTTTCTCTTGG - Intronic
1089170339 11:116507232-116507254 ACCTGGGGCGGGGTGGCCCTTGG - Intergenic
1090211080 11:124921405-124921427 CTCCGGGGCCGGGTTCTCCTCGG + Exonic
1091446566 12:547031-547053 CCCCGGACCGAGGTCCCCCTCGG + Intronic
1092217934 12:6695470-6695492 TCCCAGGCCGGGGTCCCCCTCGG + Exonic
1100865687 12:98854248-98854270 ACCCGTGGCTGGTTTCCCCTAGG - Intronic
1103941146 12:124501911-124501933 CCCCCGGGCCGGCTTCTCCTCGG - Intronic
1104890863 12:132139469-132139491 CCCAAGGGCGGGGAGCCCCTGGG - Intronic
1105705597 13:22965870-22965892 CCCTGGGGCTGGGGTCCCCTGGG + Intergenic
1105760036 13:23505321-23505343 CCCCTGGGAGTGGTTCCCCTGGG - Intergenic
1105858501 13:24390855-24390877 CCCTGGGTCTGGGGTCCCCTGGG + Intergenic
1110630005 13:77697570-77697592 CCCCTGGGTGGGCTTCCCCACGG + Intergenic
1119469050 14:74882159-74882181 CCCGGGGCCGTGGTTGCCCTCGG + Intronic
1122130841 14:99604010-99604032 CCCCGCGCCGGGGCTCCGCTGGG + Exonic
1122815056 14:104308084-104308106 CCCCGGGGCTCGGATCCGCTGGG + Intergenic
1122864433 14:104597171-104597193 CCTGGGGGCGGGGGTCGCCTGGG - Intronic
1122922564 14:104886044-104886066 TCCCGGTGCCGGGCTCCCCTGGG + Exonic
1125476925 15:40054056-40054078 CGCAGGGGCTGGGTCCCCCTGGG + Intergenic
1125499755 15:40232252-40232274 CCCAGGGGCTGGGGACCCCTGGG + Intergenic
1127142652 15:55993471-55993493 CTGCGGGGCGGGCTTCCCTTCGG - Intronic
1130156714 15:81356969-81356991 CCACGGGGTGGAGTTCCCATGGG - Intronic
1132577986 16:672651-672673 CCCTGGGGCTCGGTCCCCCTAGG - Intronic
1132697919 16:1210176-1210198 CCTGGGGGCGGGGGTCCCGTGGG - Intronic
1133118252 16:3590498-3590520 CCCCAGGGCGGGAGTCCCCGCGG - Exonic
1137787987 16:51152639-51152661 CCCCAGGGCGGGGTGCCCAGGGG - Intergenic
1141638615 16:85328803-85328825 CCCCGGGGCGGGGAGGCCCCGGG - Intergenic
1143106208 17:4531737-4531759 CCCCGGGACTGGGAGCCCCTGGG - Intronic
1143175669 17:4953553-4953575 CCCCGGGGTGGGGGTTCCCAGGG + Intronic
1143512679 17:7405037-7405059 CCCCGGGGCGGGGGTCAGCGCGG - Intronic
1143778820 17:9218650-9218672 CCCCGGGGTGGGGCTTACCTTGG + Intronic
1144144805 17:12387263-12387285 CCCTGGGGCTCAGTTCCCCTGGG + Intergenic
1146033993 17:29390533-29390555 CGGCGGGGCGGGGTCCCCCGGGG - Intronic
1146183872 17:30712521-30712543 TCCCGAGGCGGGGGTTCCCTGGG + Intergenic
1146896433 17:36545163-36545185 CCCAGGGGCGGGGTCGCGCTGGG + Intronic
1147772442 17:42877310-42877332 CCCCTGGGCTGGGTTAGCCTTGG + Intergenic
1152029389 17:77832293-77832315 CCCCGGGGCTGGGGACCCCTGGG - Intergenic
1152266202 17:79296534-79296556 CCCCGGGGAGGGGTTAGACTGGG - Intronic
1152610767 17:81314115-81314137 CCCCGGGCCTGGGTTCCCTCTGG - Intronic
1152654880 17:81514822-81514844 CCCCGGGCCGGGCTTCCCGGCGG - Intronic
1152742090 17:82022882-82022904 GCGCGGGGCGGGGTTCCGGTGGG - Exonic
1160802455 19:976710-976732 CCCAGGAGCTGGGTTCCCCCGGG - Intergenic
1160841268 19:1147936-1147958 CCCCTGGGCGGGGGGCCCCCAGG - Intronic
1160874887 19:1292306-1292328 CCGGGGGTGGGGGTTCCCCTGGG + Intronic
1161264671 19:3358790-3358812 ACCTGGGGCGGGGGTCCCCTGGG - Intergenic
1161304172 19:3557655-3557677 CCCCGGGGCGCGGCTCCGATTGG - Intronic
1161594122 19:5142540-5142562 CCCCGGGGCTGGGTTTCTCCTGG + Intronic
1161982423 19:7637060-7637082 CCGCGGGGCGGGGTCCACGTGGG + Intronic
1162111729 19:8403338-8403360 CTGCAGGGAGGGGTTCCCCTCGG + Intronic
1163413726 19:17172857-17172879 CCCCGTGGCCGTGTTCCGCTGGG + Exonic
1164160609 19:22623495-22623517 CCCCTGGGCTGGGCTCCCCGCGG - Intergenic
1165266720 19:34667413-34667435 CCCCGGGCCCAGGTTCTCCTGGG - Intronic
1166054330 19:40279494-40279516 GCCCGGGGAGGGGTGACCCTGGG + Intronic
1166198060 19:41219494-41219516 CCTTGGGGCAGGGATCCCCTCGG + Intronic
1167149102 19:47698815-47698837 CCCACGGGCTGGGGTCCCCTGGG - Intronic
929000627 2:37344526-37344548 CCCCGGGGCTGGGCGGCCCTGGG - Intergenic
932487366 2:72092322-72092344 CCCCAGGGAGCGCTTCCCCTTGG - Intergenic
935731083 2:106065516-106065538 CCCAGGGGCTGCGTTCCCCTTGG + Intronic
937993903 2:127679210-127679232 CCCCAGGGAGGGGTGCTCCTGGG - Intronic
938093792 2:128448999-128449021 TCCCGGGTCAGGGTGCCCCTTGG + Intergenic
938583976 2:132670919-132670941 CCCCGGGACGGCGTTCTCCTAGG - Intronic
941083342 2:161088140-161088162 TCCCAGGGTGAGGTTCCCCTGGG - Intergenic
946181094 2:217949349-217949371 CTCCAGGGCAGGGTTTCCCTTGG + Intronic
947807823 2:232980842-232980864 CCTGGTGGCGGTGTTCCCCTAGG - Intronic
948822763 2:240558173-240558195 CCCCTGGGCCGAGTACCCCTGGG + Intronic
1168990922 20:2095176-2095198 CCCCAGGGCTGGCTGCCCCTCGG + Intergenic
1169068530 20:2707830-2707852 CCCTGGGGCAGGGTCTCCCTGGG + Intronic
1171308266 20:24124438-24124460 CCCAGGGGAGGGGTTCCTCTAGG + Intergenic
1175225293 20:57440890-57440912 CCGGGGGGGCGGGTTCCCCTCGG + Intergenic
1175371071 20:58492552-58492574 CCCATGGGCAGGGTTCCCATTGG - Intronic
1175800702 20:61799730-61799752 CCCAGGAGCGGGGATACCCTGGG - Intronic
1176059905 20:63168002-63168024 CCACAGGGCGGAGTTTCCCTGGG - Intergenic
1178856574 21:36255204-36255226 CCCAGGGGCGGGGTTGCAGTGGG - Intronic
1179189069 21:39108003-39108025 CCCTGGGGCTGGGTCCCCGTGGG - Intergenic
1179547629 21:42123250-42123272 CCCCCTTGCTGGGTTCCCCTCGG - Intronic
1179710769 21:43211823-43211845 CTCCCGGGCAGGGCTCCCCTCGG + Intergenic
1180064692 21:45406228-45406250 CCTTTGGGCGGGGCTCCCCTGGG - Intronic
1180151481 21:45950476-45950498 CTCCGGGGCGGGGTGGCCTTGGG + Intergenic
1182355434 22:29720542-29720564 CGCCGGGGCGGGGATCCCGGCGG - Intronic
1183428281 22:37751165-37751187 CCCCGGGGCTGTGCCCCCCTGGG + Intronic
1183597130 22:38819376-38819398 CCCCAGGGCCAGGGTCCCCTTGG - Exonic
1183650904 22:39152756-39152778 CCCGGGGGCGGGGTTCCGATGGG - Intergenic
1184147276 22:42619102-42619124 CCCCAGCTCGGGGTTCCCCAAGG + Exonic
1185402341 22:50625562-50625584 CCACGGGGAGGGGTTACCCTGGG + Exonic
949434462 3:4013328-4013350 CCCAGGGGCTGGGGACCCCTTGG + Intronic
961448689 3:126992689-126992711 CCCCAGGGTGGGGGTGCCCTGGG + Intronic
961779362 3:129312774-129312796 CCCTGGGGCTGGGTTCCCAAGGG + Intergenic
966712010 3:182980694-182980716 CCCGGGCGCGGGGGTCCCCCGGG + Intronic
968728943 4:2260906-2260928 CCCTGGGCCGGGGCTCCCCGGGG - Intronic
968754599 4:2408807-2408829 CCGTGGGGCGGGGCTCACCTGGG - Intronic
968901668 4:3435039-3435061 TCCTGGGGCTGGGGTCCCCTGGG + Intronic
981429595 4:144645064-144645086 CCCTGGGGAGAGGTTCCCCTGGG - Intergenic
985548942 5:523767-523789 CCCCGGGGCCGGGTTTCCTTCGG - Intronic
986152081 5:5138209-5138231 CCCCGGTGCGGGGATCCACTAGG + Intergenic
986449414 5:7850581-7850603 CCTGGGGGCGGGGTTACCTTAGG - Intronic
988852978 5:35197408-35197430 CCCAAGTGCGGGGTTCCCCCTGG + Intronic
996765503 5:127030988-127031010 CCTCCGGGCGGGGTTCCGATGGG - Intergenic
997283621 5:132663452-132663474 GCCCAGGGCGGGGAGCCCCTTGG + Intergenic
997500681 5:134371319-134371341 CAGCGGGGCGCGGTTCCCCCTGG - Exonic
998080869 5:139274068-139274090 CCCCGGGGCGGGGTTCCCCTCGG + Exonic
998850439 5:146345998-146346020 CGCCGGGGCGGGGTTACCGCGGG - Intergenic
999188889 5:149731847-149731869 CCGCGTGGCGGGCTTCCTCTCGG - Intronic
999288225 5:150406882-150406904 CCCTGGGGCAGGGCTCCCATGGG + Exonic
1000814083 5:165899072-165899094 CCCAGGGGCTGGGGACCCCTGGG - Intergenic
1002593065 5:180304466-180304488 CCCTGGGGCAGGGTTTCCCCAGG - Intronic
1003868496 6:10383670-10383692 GCCCGGGGCGGCGTGTCCCTCGG - Intergenic
1006380225 6:33692981-33693003 CTCCGGGCCAGGGTTCCCCAGGG - Intronic
1006443507 6:34066200-34066222 CCACGTGCCGGGGTTTCCCTGGG - Intronic
1007633485 6:43285212-43285234 CCCCGGGGCGGGGGGACCCCGGG - Exonic
1007912526 6:45530188-45530210 CCCCTGGGAGGGGTTCACTTTGG - Intronic
1014045246 6:116877208-116877230 CCCCGGGCTGGGGCTCCGCTGGG + Intronic
1016118017 6:140312803-140312825 CACGGGGGCGGGGTTGCCCAAGG - Intergenic
1017839415 6:158209686-158209708 CCCCGGTGCGGGGATCCACTGGG - Intergenic
1018452531 6:163922409-163922431 CTACGGGGAGGTGTTCCCCTTGG + Intergenic
1019457494 7:1138107-1138129 CCCCGGGGCGGGCTCCCGCGGGG - Exonic
1020270116 7:6589889-6589911 TCCGGGGGCGGGGTCCACCTGGG + Intergenic
1023220559 7:37916897-37916919 CCGCGGCGCGGGCTCCCCCTCGG + Exonic
1023968284 7:44974857-44974879 CCACGAGGTGGGCTTCCCCTGGG - Intronic
1024996736 7:55278213-55278235 CCCCAGGGAGGGGGTGCCCTGGG + Intergenic
1026806707 7:73433724-73433746 CCCCGGGGCGGGGCTCCGGGAGG - Intergenic
1027563964 7:79767900-79767922 CCCCGATGCGGGATTCCACTGGG - Intergenic
1029708805 7:102288610-102288632 CCCAGGGGTGGGCTTCCCTTGGG + Intronic
1034552184 7:151828126-151828148 CCTGGGGTCGGGGCTCCCCTGGG - Intronic
1035264754 7:157684777-157684799 CCCCCGGGCCGGGGTCTCCTCGG + Intronic
1035662808 8:1360260-1360282 CTCCGGGGCGGGGCTTCTCTGGG + Intergenic
1038039774 8:23714854-23714876 CCCCGGGTCGCGGTTCCCTGCGG + Intergenic
1039474588 8:37833077-37833099 CCCCTGGGCGGGGGTGCCCCGGG + Exonic
1040515548 8:48131143-48131165 CCACGGGGCGGGCGTCCCCGGGG + Intergenic
1048990910 8:139759695-139759717 CACGGGGGCCGGGCTCCCCTGGG + Intronic
1049285446 8:141772611-141772633 CCCAGGGACATGGTTCCCCTGGG - Intergenic
1049671431 8:143871818-143871840 CCCCGGGGAGGGGAGCCCCAGGG - Exonic
1060555184 9:124504425-124504447 CCCCGGGGAGGGGGTCCCGGCGG - Intronic
1061400977 9:130368271-130368293 CCCCGGGGAGGGGTTGACCTGGG - Intronic
1061693927 9:132356670-132356692 CCTCGGGCCAGGGTTCTCCTCGG - Intergenic
1061842604 9:133368095-133368117 CAGCGGGAAGGGGTTCCCCTAGG + Intronic
1061860345 9:133464751-133464773 CCCCAGCGTGGGCTTCCCCTGGG + Intronic
1062610592 9:137371689-137371711 CCCCGGGGCTGGGCACCCCCAGG + Intronic
1062625938 9:137441561-137441583 CCCGGGGGCGGGGCGACCCTGGG - Intronic
1186107881 X:6226601-6226623 TCCCTCGGCGGGGTTCTCCTGGG - Intronic
1186655342 X:11605912-11605934 CCCCGGGATGGGGTTGCTCTTGG - Intronic
1192035234 X:67555802-67555824 CCCCGTGGCAGGATTTCCCTGGG + Intronic