ID: 998086136

View in Genome Browser
Species Human (GRCh38)
Location 5:139325218-139325240
Sequence CTGCTTTACTTGAAGGGAAA CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 272
Summary {0: 1, 1: 0, 2: 3, 3: 22, 4: 246}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
998086136_998086141 -4 Left 998086136 5:139325218-139325240 CCGTTTCCCTTCAAGTAAAGCAG 0: 1
1: 0
2: 3
3: 22
4: 246
Right 998086141 5:139325237-139325259 GCAGACAGAAGGGATGCTGCAGG 0: 1
1: 0
2: 2
3: 32
4: 365

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
998086136 Original CRISPR CTGCTTTACTTGAAGGGAAA CGG (reversed) Intronic
902061456 1:13647010-13647032 CTCCTTTACTTCAATGGAACAGG - Intergenic
902085173 1:13854585-13854607 GGGATTTACTTGAAGGGGAAGGG - Intergenic
903003534 1:20283410-20283432 CGGCTTTAATTGAAGGGAGGAGG + Intergenic
903569725 1:24295321-24295343 TTTCTTTACTGGAAAGGAAAAGG + Intergenic
903869306 1:26421358-26421380 CTGGTGTATTTGAAGGGGAATGG - Intronic
905984266 1:42263505-42263527 CTCCTTTCCTTTAAAGGAAAAGG + Intronic
907055484 1:51363343-51363365 TTGGTTTTCTTGAAGGAAAATGG - Intronic
907291040 1:53412999-53413021 CTGCTTTCCTTGCAGGGAGCAGG + Intergenic
909034179 1:70578698-70578720 CTTCTTTCCTTGAATGAAAATGG + Intergenic
909111446 1:71483296-71483318 CTGTTTTACTCTAAGTGAAAGGG + Intronic
909959320 1:81819344-81819366 CTGCTTTAGTGGAAGGGAGAAGG + Intronic
910489210 1:87749646-87749668 CTGCTGGTCTTGTAGGGAAATGG - Intergenic
911381477 1:97120395-97120417 CAGCTTTCCTTGAAGACAAAGGG + Intronic
913294141 1:117302420-117302442 CTGCATTAATTGTAGTGAAAGGG + Intergenic
913563479 1:120047125-120047147 CTGCTGTGCTTGAAGGAAAGAGG - Intronic
913634644 1:120746452-120746474 CTGCTGTGCTTGAAGGAAAGAGG + Intergenic
914284073 1:146206489-146206511 CTGCTGTGCTTGAAGGAAAGAGG - Intronic
914342695 1:146773817-146773839 CTGCTTTGCTAGGAGGGAACTGG + Intergenic
914545104 1:148657228-148657250 CTGCTGTGCTTGAAGGAAAGAGG - Intronic
914621462 1:149413460-149413482 CTGCTGTGCTTGAAGGAAAGAGG + Intergenic
916583859 1:166132564-166132586 CTGCTGTACAAGAAGGGAGATGG - Intronic
920302935 1:205000493-205000515 CTTCTATGCTTGAAGGGGAAGGG + Intronic
920826368 1:209427335-209427357 CTGCATTACTTTTTGGGAAATGG + Intergenic
922152872 1:223020445-223020467 CTGGTTTACTGGAAGGGAACAGG - Intergenic
922626154 1:227045781-227045803 CTGTTTTTGTTGAAGGAAAAAGG - Intronic
922684570 1:227629232-227629254 CAGTTTAACTTGAAGGGAATGGG + Intronic
923198751 1:231692024-231692046 CTGATATACTTGTAGGCAAAGGG + Intronic
923445595 1:234067905-234067927 CTACTTTATTTGAAGGTAAATGG - Intronic
924783532 1:247173234-247173256 CAACTTTACATAAAGGGAAAAGG + Intergenic
1070703987 10:78624337-78624359 TTGATTTTCTGGAAGGGAAATGG - Intergenic
1074207750 10:111298858-111298880 GTGTTTTACTTGAAGAGAAGAGG + Intergenic
1074690982 10:116003868-116003890 CTTCTTTACTGAAAGGAAAAGGG + Intergenic
1077746122 11:4907841-4907863 CTCCTTAAGGTGAAGGGAAATGG - Exonic
1079568312 11:21910619-21910641 ATGCTTAACTTAAAAGGAAAGGG - Intergenic
1079929614 11:26541689-26541711 CTACTTTACTTTAAGCTAAATGG + Intronic
1079987634 11:27215549-27215571 CTGGTTTACAGGAAGGGTAAAGG + Intergenic
1080912764 11:36621143-36621165 TATCATTACTTGAAGGGAAAGGG + Intronic
1081430137 11:42967740-42967762 CATCTTCTCTTGAAGGGAAAAGG + Intergenic
1083475767 11:62914472-62914494 CTGATTTTGTTTAAGGGAAAGGG - Intronic
1084633365 11:70372192-70372214 CTGCTTTTCATAAATGGAAAAGG - Intronic
1085879639 11:80451147-80451169 CTGCTCTAGGTGAAGGGTAAAGG - Intergenic
1085933443 11:81114286-81114308 CTGAGTTACTTGAAGTTAAAAGG - Intergenic
1086857509 11:91883190-91883212 CAGTTTTACTTGAAGTGAAATGG - Intergenic
1087389845 11:97518461-97518483 TTTCTTTACTCCAAGGGAAAGGG + Intergenic
1088083816 11:105954133-105954155 CTACTTTATTTGATGGGAACAGG - Intronic
1089464112 11:118672985-118673007 CTGCTTTTCTGGAAGTTAAAGGG - Intronic
1090639662 11:128719583-128719605 CTGGTGGACTTGAAGGGCAACGG + Intronic
1091452401 12:581491-581513 CTGCTTTGCTGGCAGGGAAAAGG - Intronic
1095425895 12:42074494-42074516 CTGCTTGGTTTGAAGAGAAAGGG + Intergenic
1096539070 12:52293867-52293889 CTGCTATGCTTCAAGGGCAAAGG + Intronic
1097884967 12:64719950-64719972 ATGCTGTTCTTGAAGGCAAAGGG - Intronic
1100187293 12:92151644-92151666 CTTCATTAGTTTAAGGGAAAGGG - Intergenic
1101391738 12:104307164-104307186 CTGCTTACCTTGAAGAAAAAAGG + Intronic
1105982545 13:25533716-25533738 CTGCTGTGCTAGAACGGAAATGG - Intronic
1108498192 13:51045228-51045250 CAGCTTTACTTGCAGGCAACTGG - Intergenic
1109929020 13:69187966-69187988 CTGTTTTACCTACAGGGAAAGGG - Intergenic
1111415557 13:87938993-87939015 CTGCAATTCTTGAGGGGAAATGG + Intergenic
1111493450 13:89016534-89016556 GTTTTTTACTTGAAGGTAAATGG - Intergenic
1112453692 13:99537842-99537864 CTGCTAAACTTGAACCGAAAAGG + Exonic
1115310212 14:31971839-31971861 CTCCTTTACTTAAAGGCAATTGG + Intergenic
1116595513 14:46838970-46838992 TTGCTTTAATTGAAAGTAAATGG - Intergenic
1116789050 14:49320081-49320103 CTGCCATACTTCAAGGGAGATGG - Intergenic
1117290218 14:54325059-54325081 CTGCTTTACTTTACCAGAAATGG - Intergenic
1120975207 14:90242304-90242326 TTTCTTTACTCCAAGGGAAAAGG - Intergenic
1125671644 15:41477795-41477817 CTGGTATTCTTGAAGGGAAAAGG + Intronic
1125902129 15:43358238-43358260 TTGCTTTACAGAAAGGGAAATGG + Exonic
1126399322 15:48253111-48253133 CTGCTTTACTGGCAGAGTAAGGG - Intronic
1127052086 15:55094976-55094998 CTTCTTCATCTGAAGGGAAAAGG + Intergenic
1128311788 15:66635493-66635515 TTGTTTTACTTGGTGGGAAAGGG + Intronic
1130921542 15:88349853-88349875 CTGCTTCACCTGCTGGGAAAAGG - Intergenic
1131795856 15:96016184-96016206 CTTCTTTAATTTAGGGGAAAAGG + Intergenic
1132103794 15:99048217-99048239 CTGATTAACATGAAAGGAAATGG + Intergenic
1133512283 16:6471736-6471758 TTGCTTTTCTTCAAGGCAAAGGG + Intronic
1133799381 16:9072702-9072724 CTTTTTTGCTTGAAGGGAGAAGG + Intergenic
1138166784 16:54809469-54809491 CTGCCTTCCTTGAAGCTAAATGG + Intergenic
1139347524 16:66313673-66313695 TTGCTTAACTTGCAGGGAAAGGG + Intergenic
1139991290 16:70941511-70941533 CTGCTTTGCTAGGAGGGAACTGG - Intronic
1140272703 16:73480928-73480950 GTTATTTACTTCAAGGGAAAGGG + Intergenic
1142682732 17:1559998-1560020 CTGCTGTTCTTGAAGATAAAAGG - Intronic
1143180402 17:4980810-4980832 CTGCTTGTTTTGAGGGGAAATGG - Intronic
1143985905 17:10913820-10913842 CTGAACTACTTGAAGGAAAAGGG + Intergenic
1146474724 17:33153685-33153707 TGTCTTTCCTTGAAGGGAAATGG - Intronic
1146496418 17:33326625-33326647 CTGGTTTTCCTCAAGGGAAAAGG - Intronic
1147301509 17:39531993-39532015 CTGCTTTATGTGCAGGGAGAAGG - Exonic
1147403060 17:40192425-40192447 CTGTTTTTCTTGAAGGAAAGGGG + Intronic
1147686744 17:42290458-42290480 CTTCTTTACTTGAGGGGAGTGGG + Intronic
1147720861 17:42538471-42538493 CAGCTTTACCTGCAGGTAAAAGG + Exonic
1148590035 17:48809336-48809358 CTTCCTTCCTTGAAGGTAAACGG + Intronic
1149852253 17:60045019-60045041 CTGCATGACTTGGAGGGAAAGGG - Intronic
1151282654 17:73088391-73088413 CAGCCTGACTTGAAGGGAATAGG - Intronic
1153619673 18:6965483-6965505 ATCCCTGACTTGAAGGGAAAGGG - Intronic
1154356911 18:13628346-13628368 CTGCCTTGCCTGCAGGGAAACGG - Intronic
1155371436 18:25105678-25105700 CTGATTTGCTTGAAGTGATATGG + Intronic
1155928989 18:31685721-31685743 ATGCTGTACCTGAAAGGAAAAGG + Intronic
1157568536 18:48696965-48696987 CTCCTTCAGTTAAAGGGAAAAGG - Intronic
1159279324 18:66265014-66265036 CTGGTTTAGGAGAAGGGAAAAGG - Intergenic
1159615239 18:70572257-70572279 CTGTTTTAATTTAATGGAAAGGG + Intergenic
1159823429 18:73175467-73175489 ATGCTTAACTTGAAGGAGAATGG - Intronic
1159938688 18:74388992-74389014 CTGCTTTCCTGGCAGAGAAATGG - Intergenic
1160087664 18:75792937-75792959 GTGCATCACTTGAAGGTAAATGG + Intergenic
924961390 2:37734-37756 CAAGTTTACCTGAAGGGAAAAGG + Intergenic
925153533 2:1633838-1633860 CTGCTTTATTTAAAAAGAAATGG + Exonic
925960968 2:9015597-9015619 ATGCTTTATTTAAAGGGACAGGG + Intergenic
926962541 2:18374289-18374311 CTTTTTTAATTGAAGAGAAATGG - Intergenic
927796466 2:26053371-26053393 CTGATTTACTTGGGGGGAAATGG + Intronic
928131780 2:28656896-28656918 CTGCTGTTCTTACAGGGAAATGG + Intergenic
928414112 2:31077443-31077465 CTGGGGTAATTGAAGGGAAAAGG - Intronic
929846222 2:45531128-45531150 CTGCTTTCCTTGAAAAGAAAAGG + Intronic
930108024 2:47655285-47655307 CTGCTTTGCTTGTGGGGCAAAGG + Intergenic
931889205 2:66651447-66651469 TTGCTTTACTGCAAGGGAACTGG - Intergenic
933467136 2:82666964-82666986 CTGTTCTACTTCAAGGGGAAAGG - Intergenic
936630278 2:114194559-114194581 CTGATTTACTTGAAAGGAAAGGG + Intergenic
936773094 2:115938639-115938661 TTTCTTTACTGGAAGAGAAATGG - Intergenic
938045659 2:128117413-128117435 TTGCTTTATGTGAAAGGAAATGG + Intronic
938629280 2:133148452-133148474 TTGCTTTTCTTAAAGTGAAATGG + Intronic
940135283 2:150428826-150428848 CTGCTATACTTGATAGCAAATGG - Intergenic
940321026 2:152376601-152376623 CTGCCTTACCTGTAGGGAAAGGG + Intronic
940338172 2:152550597-152550619 CTTATTTACTTTCAGGGAAACGG - Intronic
941613155 2:167685922-167685944 CTGCTTTACTTAAATAAAAAAGG + Intergenic
944178148 2:196856769-196856791 CTTTTTTACTTGAAGGATAATGG + Intronic
945395864 2:209316519-209316541 CTGCAATAATTGAATGGAAAAGG + Intergenic
945699596 2:213152726-213152748 CTTCTATAATTAAAGGGAAAAGG + Intergenic
946851812 2:223914835-223914857 CTGCTTTAGCTGAAGAAAAATGG - Intronic
947374885 2:229485619-229485641 TTTCTTCATTTGAAGGGAAATGG - Intronic
1169577280 20:6979185-6979207 CTGTCTTAGTTGAAGGGAAGAGG + Intergenic
1170172354 20:13429547-13429569 CTACCTAACTTGATGGGAAATGG - Intronic
1170204799 20:13786407-13786429 GTGCTTTCTTTGGAGGGAAAGGG - Intronic
1170213638 20:13870151-13870173 CTTCTTTACTTTCATGGAAAAGG - Exonic
1170795914 20:19546605-19546627 CTCCTTTTTTTGAGGGGAAAGGG + Intronic
1172609364 20:36238444-36238466 CTGCTTTATTTAAAGTAAAAAGG + Intronic
1173363948 20:42368447-42368469 CAGCCATACTTGAAGGGCAATGG - Intronic
1173877266 20:46381847-46381869 TTGCTTTAGTGGAAGAGAAAAGG - Intronic
1174947703 20:55006730-55006752 CTGTTTTAATTGTAGGGACAAGG + Intergenic
1175090292 20:56497426-56497448 CCGCTTTATTTGAAGGGAAAGGG - Exonic
1177490709 21:21822458-21822480 GGGATTTACTAGAAGGGAAAAGG - Intergenic
1179149631 21:38798871-38798893 CTGCTCTAGTTTAGGGGAAAAGG - Intergenic
1182348428 22:29683598-29683620 TTGCTTTATTTGAAAAGAAAAGG - Intronic
1183422768 22:37721812-37721834 CTGCTTTAGGTGAAGAGTAAAGG - Intronic
1183686519 22:39364110-39364132 CCACTTTACTTGAGGGGAGATGG - Intronic
1184361571 22:44022300-44022322 CTCCTTTACTGAAAGGAAAAGGG + Intronic
1185317948 22:50186723-50186745 CTGCTCCAATTGAAGGGCAAAGG - Intronic
950900788 3:16495651-16495673 CTGCCCTACCTGAAGGGAAAGGG + Intronic
951033637 3:17909076-17909098 CTGCTTTACTTGCTCAGAAAAGG - Intronic
951863447 3:27279847-27279869 CTGCTTCACTTAAAGCTAAACGG + Intronic
953498955 3:43414238-43414260 CTGTTTTTCTGAAAGGGAAAAGG - Intronic
958919556 3:100089091-100089113 ATACTTTACTGGTAGGGAAATGG - Intronic
960319458 3:116216812-116216834 CTGCTTTACTTGATGGGGAAAGG + Intronic
960509385 3:118530391-118530413 CTTCAGTACTTAAAGGGAAAAGG + Intergenic
961413010 3:126736657-126736679 CTGCTGCACTAGATGGGAAAGGG - Intronic
961675899 3:128566411-128566433 GTGCTTTAATTGCAGGGAATGGG + Intergenic
961981319 3:131082052-131082074 CTGCTTTGCTTGGAGGAAAGTGG + Intronic
963384304 3:144571273-144571295 ATGCTTGACTTGAAGGAAAGAGG + Intergenic
963631615 3:147738597-147738619 CTTCTTTAGATGAAGGGATATGG - Intergenic
964363242 3:155920865-155920887 CTGCTTTACTACAACAGAAAAGG - Intronic
965381121 3:167989903-167989925 CTGCTTTAAGTGCATGGAAAGGG + Intergenic
965512699 3:169586163-169586185 CTACTTTACTTGCAAAGAAATGG - Intronic
966123180 3:176546213-176546235 CTGTTCCACTTGAAGGGACATGG - Intergenic
967338283 3:188368881-188368903 CTGGTTTACCTGAAAGGAAGAGG + Intronic
967518712 3:190402461-190402483 CTGCTTGCCAGGAAGGGAAAGGG + Intronic
971400135 4:26268545-26268567 GTGCTTTTATTGAAGAGAAAAGG - Intronic
971941134 4:33217093-33217115 GTGCTTTCCTTGAAGACAAAGGG - Intergenic
972589021 4:40466534-40466556 TTGCTTAAGTGGAAGGGAAAAGG + Intronic
972652355 4:41030397-41030419 CTTTTTTACTTTAAGGGACAGGG + Intronic
974016237 4:56651826-56651848 GTGCTTGAATTGAAGAGAAAGGG + Intronic
974052880 4:56957599-56957621 CTCCATGACATGAAGGGAAAAGG + Intergenic
975667127 4:76743114-76743136 GTGCTTCTCCTGAAGGGAAATGG + Intronic
975727264 4:77304079-77304101 CTGCTTTACCAGAAGGGCACAGG - Intronic
977106963 4:92898558-92898580 CTGCTTTGCATCAGGGGAAAAGG + Intronic
977669337 4:99677842-99677864 TGGCTTTACTTGGTGGGAAATGG - Intergenic
978635543 4:110801098-110801120 CTGCTTTACATGTGAGGAAATGG + Intergenic
978892183 4:113843233-113843255 ATGAATTACTTTAAGGGAAAGGG - Intergenic
979689544 4:123546212-123546234 TTTCTTTACCTGACGGGAAAGGG - Intergenic
981397561 4:144271862-144271884 CAGTTTTACTTTTAGGGAAAAGG + Intergenic
981971429 4:150667070-150667092 CTGCTTTACTTAAAAGCTAACGG + Intronic
982014303 4:151138077-151138099 ATGCTTTGATTGATGGGAAATGG + Intronic
982465678 4:155727977-155727999 CTGCTTTCCAGGAAGGAAAATGG + Intronic
982565046 4:156975462-156975484 CAGCTTTACTTCAAAGGAAAAGG - Intergenic
982786046 4:159538150-159538172 CTCCATTCCTTAAAGGGAAAGGG - Intergenic
983165743 4:164475311-164475333 CACCTTCACTTAAAGGGAAACGG - Intergenic
984171157 4:176360918-176360940 CTGCTGTACTTTAGGAGAAAGGG - Intergenic
984634879 4:182100016-182100038 TTGATTTACATGAAGGGATAAGG - Intergenic
987985170 5:25136563-25136585 CTGCTCTACTTGAAAAGAGATGG - Intergenic
989123451 5:38027581-38027603 TCCATTTACTTGAAGGGAAATGG + Intergenic
989403894 5:41039135-41039157 CTGCTTTCCCTGAAGGAAAGGGG - Intronic
991380005 5:66011160-66011182 TTGGGTTACGTGAAGGGAAAAGG + Intronic
997243757 5:132328521-132328543 CTTCTTGATTTGAAGGGCAAAGG - Intronic
998086136 5:139325218-139325240 CTGCTTTACTTGAAGGGAAACGG - Intronic
998330979 5:141326957-141326979 CTCCTTTACTTGTAGGGGAAGGG - Intergenic
998369918 5:141654221-141654243 GTGCTTGACTTGGAGAGAAAGGG + Exonic
998790844 5:145765069-145765091 CTGGATTCTTTGAAGGGAAAAGG - Intronic
999703389 5:154249137-154249159 CTGCATTATGTGAAAGGAAAAGG - Intronic
999826407 5:155277776-155277798 CAGCTTTAGTTGGAGGGTAAAGG - Intergenic
1000182700 5:158827605-158827627 CTGCCTGACATGAAGGGAAGAGG - Intronic
1000794831 5:165652080-165652102 CTGCTTTTCTTGCATAGAAAAGG + Intergenic
1001956686 5:175852648-175852670 CTGCGTTACTTGTAGCCAAATGG - Intronic
1002797826 6:489562-489584 GTTCTTTACATGAAGGTAAAAGG + Intronic
1003293509 6:4803437-4803459 CTGCTTCACTTCAAGGCAGATGG - Intronic
1003303770 6:4908263-4908285 CTGGTTAACCTGATGGGAAAGGG + Intronic
1003444317 6:6170922-6170944 CTGAATAACTTGAAGGGAACTGG - Intronic
1004438680 6:15624538-15624560 CTGCTTTTATTGAAGGGCAAAGG - Intronic
1004763032 6:18692051-18692073 TTGCTTTACTTGGAAAGAAAAGG - Intergenic
1006670031 6:35724482-35724504 CTCCTTCATTTGAAGGGAGAAGG + Intronic
1006679798 6:35788583-35788605 CTGTTTTACAGGTAGGGAAACGG + Intronic
1007983285 6:46180826-46180848 CTGCTTTTCTTGAGGGGAGAGGG + Intergenic
1008013634 6:46492926-46492948 ATGCTTTACTTGGAAAGAAAGGG - Intergenic
1008509250 6:52260911-52260933 CTGCTGTACATGTAGGGAAGTGG - Intergenic
1008651400 6:53567080-53567102 ATGCCCTACTCGAAGGGAAATGG - Intronic
1009468441 6:64002392-64002414 CTGCTTTACTGCAAGGGCAGGGG - Intronic
1011646756 6:89466326-89466348 TTACTTTCCTTGAAGAGAAATGG + Intronic
1011755971 6:90498495-90498517 CTGCTCAAATTAAAGGGAAAAGG - Intergenic
1011912203 6:92454509-92454531 TTACTTTTCTTGAAGGAAAAGGG + Intergenic
1014265652 6:119274518-119274540 CTGATATAAATGAAGGGAAAAGG - Intronic
1014668035 6:124263992-124264014 CTGTTTTCCTTGTAGGAAAAAGG + Intronic
1015505990 6:133989023-133989045 GTGCTTTATCTGAAGGGAGAGGG + Exonic
1015855945 6:137624803-137624825 CTTCTCTGCTTGAAGAGAAAGGG - Intergenic
1015885346 6:137911953-137911975 CTGCTTGGCTTGAAGGGAGAAGG - Intergenic
1016087169 6:139928047-139928069 CTGGCTTGCTAGAAGGGAAAAGG + Intergenic
1017638206 6:156464463-156464485 CTTTTCTATTTGAAGGGAAAGGG + Intergenic
1019714576 7:2532589-2532611 CTGCTTTGCTGGAAGGCAAGAGG + Intergenic
1019741744 7:2678464-2678486 CTGCTTTGCTGGAAGGCAAGAGG - Intergenic
1020345378 7:7156700-7156722 ATGCCTCCCTTGAAGGGAAATGG + Intergenic
1023069796 7:36418082-36418104 CTGCTTTATTTTAAAGGATATGG + Intronic
1027445394 7:78267655-78267677 CTGATTTATGTGAAGAGAAAGGG + Intronic
1027933391 7:84569632-84569654 TTGTTTTACATGAAGGGAAGTGG - Intergenic
1027943765 7:84719507-84719529 CTGCTTTATTTTAGGGGAGAGGG + Intergenic
1028264723 7:88708937-88708959 CTGCTTTACTTTGGGAGAAATGG + Intergenic
1028827740 7:95293246-95293268 GTGAGTTACTTGAAGGGAGATGG - Intronic
1033559582 7:142518893-142518915 CAGCTTTAGTTAATGGGAAATGG + Intergenic
1033674736 7:143529181-143529203 CTGCTTTAATTTAAGGAATAAGG - Intergenic
1033697100 7:143800258-143800280 CTGCTTTAATTTAAGGAATAAGG + Intergenic
1034500430 7:151447337-151447359 CTGCTTCACTTGAAGGGCCATGG - Intergenic
1035908630 8:3541251-3541273 CTGCATTACTTTGAGGGTAATGG - Intronic
1037062692 8:14534661-14534683 CTGCCTTAATGGGAGGGAAAGGG + Intronic
1037217902 8:16480113-16480135 CAGCTTGACATGAAGGGAGATGG - Intronic
1037433961 8:18843452-18843474 CTTCGTTATATGAAGGGAAAGGG - Intronic
1038462555 8:27729269-27729291 CTGCTTCAGTTGTGGGGAAATGG - Intergenic
1038813241 8:30873565-30873587 CGGATTTACTTCAAGGGAAGAGG - Intronic
1039570823 8:38585222-38585244 CTCCTTTACTAAAAGGGACATGG - Intergenic
1039748789 8:40457666-40457688 CTGTTTTGTTTGAAGGGAGATGG - Intergenic
1041411103 8:57556450-57556472 TTGCTTTACATGCAGGGACAAGG - Intergenic
1041927395 8:63250896-63250918 CTGAGTTCCTTGAAGGCAAATGG - Intergenic
1042095484 8:65211363-65211385 TTGCTTAACTTGAGGGGGAAAGG - Intergenic
1042612056 8:70609897-70609919 TAGCTTTCCATGAAGGGAAAGGG - Intronic
1043100787 8:76042705-76042727 GTGATTTACTTGAAGGCTAAAGG - Intergenic
1044031661 8:87245954-87245976 CTGCTGTACTTTAAATGAAATGG - Intronic
1047453875 8:124991235-124991257 TTGCTGAACTTGAAGGCAAATGG + Intergenic
1047477954 8:125253136-125253158 TAGCTTTACTTAAAGAGAAATGG - Intronic
1049093185 8:140532332-140532354 CTGCTTTTCTGGAAGGGGAAGGG - Intronic
1055364869 9:75532402-75532424 CTGCATTACATGAAAGGAAATGG + Intergenic
1056145979 9:83729485-83729507 CTGCTTTTCATGAAAGGAATTGG + Intergenic
1056316735 9:85397548-85397570 CTCTTTTTCTTGAGGGGAAAGGG - Intergenic
1057066518 9:92057406-92057428 CTGCCTTTCTGGAAGGCAAATGG - Intronic
1057547847 9:96031488-96031510 CTACTTTGCTTGTTGGGAAAGGG - Intergenic
1060630441 9:125152965-125152987 CTACAGTACTTGAAAGGAAAGGG + Intronic
1060712819 9:125887234-125887256 CTGCTTTTCATGAAAGGAATTGG - Intronic
1061118791 9:128630487-128630509 CTGCTTTAGGCCAAGGGAAAAGG - Intronic
1185713644 X:2324198-2324220 CTGTTCTCCTTGGAGGGAAATGG - Intronic
1186121684 X:6370327-6370349 CTATTTTACTGGAAGGAAAAAGG - Intergenic
1186711783 X:12205417-12205439 CCTCTTACCTTGAAGGGAAATGG - Intronic
1188084650 X:25888516-25888538 CTGCTATTCTTACAGGGAAAGGG + Intergenic
1188413445 X:29902437-29902459 CTTATTCACTTGAAGGAAAAGGG - Intronic
1188721675 X:33529690-33529712 CTGGTTTCCTTGAAGGGGATGGG + Intergenic
1189395569 X:40619526-40619548 CTGGATTATTTGAAGGGAAAAGG + Intergenic
1189453619 X:41163339-41163361 CTGATTGGCTTGAGGGGAAAAGG + Intronic
1192095923 X:68210597-68210619 CTGCTTTACAACAAGGGAGATGG + Intronic
1194480579 X:94417065-94417087 CTACTTTACTTGTAGGAAAATGG + Intergenic
1196676069 X:118421149-118421171 CTGCTTTGCTTTAGGGAAAAGGG + Intronic
1196966001 X:121055772-121055794 CTCCCTTACCTGAAGGGACAAGG - Intergenic
1198171961 X:134115801-134115823 TTGATTTATTTGAAAGGAAATGG - Intergenic
1199487453 X:148363652-148363674 TTTCTTTACTTGAAATGAAAAGG + Intergenic
1200367129 X:155678556-155678578 CTTTTTTACTCCAAGGGAAAGGG - Intergenic
1201386522 Y:13445769-13445791 CTGGTTTTTTTCAAGGGAAATGG + Intronic