ID: 998091717

View in Genome Browser
Species Human (GRCh38)
Location 5:139374920-139374942
Sequence TAGCATCCTCTAAATGGGCA GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
998091708_998091717 7 Left 998091708 5:139374890-139374912 CCATAGGATGGTCTGTTCCAGCC 0: 1
1: 0
2: 0
3: 8
4: 85
Right 998091717 5:139374920-139374942 TAGCATCCTCTAAATGGGCAGGG No data
998091704_998091717 26 Left 998091704 5:139374871-139374893 CCACTTGACTGTCTCAGGCCCAT 0: 1
1: 0
2: 1
3: 19
4: 162
Right 998091717 5:139374920-139374942 TAGCATCCTCTAAATGGGCAGGG No data
998091707_998091717 8 Left 998091707 5:139374889-139374911 CCCATAGGATGGTCTGTTCCAGC 0: 1
1: 0
2: 0
3: 6
4: 92
Right 998091717 5:139374920-139374942 TAGCATCCTCTAAATGGGCAGGG No data
998091709_998091717 -10 Left 998091709 5:139374907-139374929 CCAGCCCCCAGTCTAGCATCCTC 0: 1
1: 0
2: 2
3: 25
4: 265
Right 998091717 5:139374920-139374942 TAGCATCCTCTAAATGGGCAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
998091717 Original CRISPR TAGCATCCTCTAAATGGGCA GGG Intronic
No off target data available for this crispr