ID: 998091799

View in Genome Browser
Species Human (GRCh38)
Location 5:139375374-139375396
Sequence ATATACCATCTGGCTAAATC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 97
Summary {0: 1, 1: 0, 2: 1, 3: 9, 4: 86}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
998091799_998091804 23 Left 998091799 5:139375374-139375396 CCAGATTTAGCCAGATGGTATAT 0: 1
1: 0
2: 1
3: 9
4: 86
Right 998091804 5:139375420-139375442 CTTCAGGAGGCCGAGACAGAAGG 0: 2
1: 19
2: 457
3: 5639
4: 50236
998091799_998091803 10 Left 998091799 5:139375374-139375396 CCAGATTTAGCCAGATGGTATAT 0: 1
1: 0
2: 1
3: 9
4: 86
Right 998091803 5:139375407-139375429 TGTACTCTCAGCTCTTCAGGAGG 0: 1
1: 10
2: 731
3: 16902
4: 165035
998091799_998091801 7 Left 998091799 5:139375374-139375396 CCAGATTTAGCCAGATGGTATAT 0: 1
1: 0
2: 1
3: 9
4: 86
Right 998091801 5:139375404-139375426 ACCTGTACTCTCAGCTCTTCAGG 0: 1
1: 7
2: 585
3: 17466
4: 198775

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
998091799 Original CRISPR ATATACCATCTGGCTAAATC TGG (reversed) Intronic
902951808 1:19890139-19890161 ATGTACCAGCTGGCTGACTCAGG - Intronic
907629024 1:56061478-56061500 TTATACCATCTGGGTAAGTTTGG + Intergenic
908100321 1:60784439-60784461 AAATACCATCTGACAACATCTGG - Intergenic
910260231 1:85287116-85287138 ATATACCAGCTGGCGAATACTGG - Intergenic
917250708 1:173057434-173057456 ATTTACAATCTGGCTCCATCTGG - Intergenic
919195613 1:194281174-194281196 AAATACCATCTTGATAACTCGGG - Intergenic
919328830 1:196143008-196143030 GTCTACCATCAGGCTATATCAGG + Intergenic
1063246714 10:4227826-4227848 ATAGACCAGCTGAGTAAATCTGG - Intergenic
1068682497 10:59835347-59835369 TTAGACCATCTGTCTAAATATGG - Intronic
1069222303 10:65899955-65899977 ACATCCCATCTTGTTAAATCTGG - Intergenic
1070111616 10:73492634-73492656 ATATACCATCTTGCTTAATCAGG + Intronic
1072049683 10:91690930-91690952 ATCTACCATATGCCTAAAGCTGG + Intergenic
1075935308 10:126335762-126335784 CTTGACCATCTGGCTAAAGCAGG - Intronic
1077906189 11:6535574-6535596 GGATACCAACTGGCTAAATCTGG + Intronic
1078947584 11:16087680-16087702 CTATCCCATCTGCCTCAATCTGG - Intronic
1082698197 11:56396781-56396803 ATATACAACCTGGTTAAATCAGG - Intergenic
1083950465 11:65952721-65952743 ATATACCATGTTGCTCAAGCTGG + Intronic
1091596408 12:1881839-1881861 ATAAGCCATCTGGCCAAATTTGG - Intronic
1094088394 12:26619956-26619978 ATATACCAAGTGGCAAATTCTGG + Intronic
1096170738 12:49467587-49467609 AAATATCATCTGACAAAATCAGG - Intronic
1100009785 12:89939380-89939402 TTATACCAGTTGGCTATATCTGG + Intergenic
1101715328 12:107306647-107306669 ATTTACTATCTCACTAAATCTGG - Intergenic
1104778715 12:131405960-131405982 GGACACCATCTGGCTACATCTGG - Intergenic
1105956674 13:25289549-25289571 ATATTCCTTATGGTTAAATCTGG + Intergenic
1107611366 13:42116570-42116592 GTATACCTACTGGATAAATCAGG + Intronic
1108169774 13:47729129-47729151 ATATAACAAGTGGCTGAATCAGG - Intergenic
1109366311 13:61361059-61361081 ATATAACATCTTGCTAGATGAGG + Intergenic
1111226251 13:85274871-85274893 ATATACAATCTGGGTGCATCTGG - Intergenic
1112986856 13:105460839-105460861 ACATACCATCTCTCCAAATCTGG - Intergenic
1115041216 14:28931388-28931410 GTATACCATCTGTTTGAATCAGG + Intergenic
1116627539 14:47284807-47284829 ATATATCATCTGGGTAATGCTGG - Intronic
1120587113 14:86326000-86326022 ATAATCCATCTTGTTAAATCAGG - Intergenic
1129121109 15:73397309-73397331 ATATACCTTTTGGCCAACTCTGG + Intergenic
1130125403 15:81089679-81089701 ATAAACTATCTGGCTCAGTCTGG - Intronic
1131943884 15:97597955-97597977 CCCTACCATCTGGCTTAATCTGG + Intergenic
1132300624 15:100773469-100773491 ATACACCATCTGGAAAATTCAGG - Intergenic
1139433079 16:66921536-66921558 CCATCCCAGCTGGCTAAATCTGG + Intergenic
1147475368 17:40706664-40706686 ATATCCCATCAGGGTAAATGGGG + Intergenic
1154066484 18:11111429-11111451 TTATACCATCTGGCAAAACTAGG + Intronic
1156744925 18:40378438-40378460 ATATAACATTTGGCCAAATGGGG + Intergenic
1156853410 18:41754833-41754855 AAAAACGATTTGGCTAAATCAGG + Intergenic
1161017240 19:1989372-1989394 AGAGACCCTCTTGCTAAATCTGG + Intronic
1166987601 19:46670877-46670899 ATAAACCATGTGGCTAATTGTGG + Intergenic
930949699 2:57125582-57125604 ATATGCCATCTGGCTAGAGGTGG - Intergenic
943667862 2:190629007-190629029 ATATGTCATCTGTCTAATTCTGG - Intergenic
945529977 2:210940577-210940599 TTATACCCACAGGCTAAATCGGG + Intergenic
1169373528 20:5047185-5047207 ATATACCAACTGGCTGAAAGAGG - Intergenic
1173272707 20:41552869-41552891 AGAGACTAACTGGCTAAATCAGG + Intronic
1174575397 20:51533502-51533524 AAATTCCATCTGGATAAATCAGG + Intronic
1175496672 20:59419293-59419315 ATAGACCAACTGGATAGATCAGG - Intergenic
1177794914 21:25765158-25765180 CTACACAATCTGCCTAAATCTGG + Intronic
1183554717 22:38516273-38516295 ATATGGCATCTGGCTAAGGCTGG - Intergenic
949336784 3:2983486-2983508 ATAGAACATGTGGCTAACTCTGG + Intronic
953468951 3:43150421-43150443 ATATAGCTTCTGCCTATATCGGG - Intergenic
954267891 3:49484458-49484480 AGGTACCATCTGATTAAATCAGG - Intronic
955653915 3:61223660-61223682 ATACACCATCTGGCAAAATGTGG - Intronic
957368479 3:79258474-79258496 ATTTACAATATGCCTAAATCAGG - Intronic
958168245 3:89905333-89905355 CTATACCATGAGCCTAAATCTGG - Intergenic
958500479 3:94900810-94900832 AAATACTATCTGACTTAATCTGG - Intergenic
959251442 3:103952959-103952981 TTATACCATCTGGCTATAGATGG + Intergenic
960907207 3:122613279-122613301 ATATCCCATCTGGTTAATTCTGG + Intronic
964213696 3:154255865-154255887 ATATACAATCTTGCTAATACTGG - Exonic
966382620 3:179358505-179358527 ATATCCCATCTCCTTAAATCTGG - Intronic
974045916 4:56898333-56898355 AAATACCAGCTGGATAAATAGGG + Intergenic
977428027 4:96893758-96893780 ATATGGCATTTGGCTAAATCTGG - Intergenic
979914344 4:126411910-126411932 AAATACCATTTGTCTAATTCTGG - Intergenic
981495979 4:145393135-145393157 ATTTATCATTTGGCTGAATCTGG - Intergenic
982913862 4:161180362-161180384 ATTTACCATATGATTAAATCAGG - Intergenic
986940735 5:12946012-12946034 ATATATCACCTGGCAAAATCAGG - Intergenic
998091799 5:139375374-139375396 ATATACCATCTGGCTAAATCTGG - Intronic
998570454 5:143252163-143252185 ATATTCCATCTCATTAAATCAGG - Intergenic
1002964342 6:1947663-1947685 ACATAAAATCTGGCTTAATCTGG + Intronic
1010780872 6:79945162-79945184 AAATACCATCTGCCTACATAAGG + Intronic
1016345375 6:143107562-143107584 ATATGCCAACTGGCTATATCTGG + Intronic
1020375075 7:7476344-7476366 ATATACAAACTGCCTATATCAGG + Intronic
1020721849 7:11755242-11755264 ATATACCATGTCCCTAAATGAGG - Intronic
1021295711 7:18903799-18903821 ATGTACCATTTGGCTCACTCTGG + Intronic
1024424475 7:49210092-49210114 AGATAGTATCTGGCAAAATCTGG - Intergenic
1025913173 7:65844071-65844093 ATATTCCATCTGACTAGGTCAGG - Intergenic
1026042951 7:66884024-66884046 GTATACCAGCTGACTAAATGGGG + Intergenic
1027798447 7:82721991-82722013 TTATACTTTCTGGTTAAATCTGG + Intergenic
1027818780 7:83015585-83015607 ATATGCCATCTGTTTATATCGGG - Intronic
1031636678 7:124109363-124109385 ATACACCAGATGGCTAAATCTGG + Intergenic
1031801528 7:126252763-126252785 ACATACCATCTGGAAAAATAGGG - Intergenic
1041132835 8:54721123-54721145 ATATACCATCATGTTACATCAGG - Intergenic
1042722306 8:71839868-71839890 ATATTCCTTCTGGCCAACTCAGG - Intronic
1043160035 8:76835408-76835430 TTATTCCAGCTGGATAAATCTGG - Intronic
1043691010 8:83151747-83151769 ATATCCCATATGTCTAAATTTGG + Intergenic
1051511008 9:17877948-17877970 ATATACCATCTGCCTAGAGAAGG - Intergenic
1052131408 9:24852824-24852846 ATATATTATATGGATAAATCAGG - Intergenic
1052251928 9:26408673-26408695 CTAAACTGTCTGGCTAAATCAGG - Intergenic
1055532883 9:77204182-77204204 ATATACTATGTTGCTAAAACTGG - Intronic
1058130216 9:101243469-101243491 ATTTACAGTCTGGCTAAATATGG + Intronic
1061334652 9:129924310-129924332 ATTTACCCTCTGGCTTAAGCTGG - Intronic
1189516344 X:41716743-41716765 TTATCCCATCTGGCAAAATTGGG + Intronic
1193336962 X:80301431-80301453 ATAAAACATTTGGGTAAATCTGG - Intergenic
1196140060 X:112251552-112251574 ATATAAAACCTGGTTAAATCTGG - Intergenic