ID: 998093441

View in Genome Browser
Species Human (GRCh38)
Location 5:139383897-139383919
Sequence CCCCTCAGGGTCCCTGAGGC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 400
Summary {0: 1, 1: 0, 2: 3, 3: 29, 4: 367}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
998093430_998093441 24 Left 998093430 5:139383850-139383872 CCTAAAATTCAGGTTGGTCTGAG 0: 1
1: 0
2: 0
3: 20
4: 131
Right 998093441 5:139383897-139383919 CCCCTCAGGGTCCCTGAGGCAGG 0: 1
1: 0
2: 3
3: 29
4: 367
998093432_998093441 -7 Left 998093432 5:139383881-139383903 CCCTCACCACCCTGCACCCCTCA 0: 1
1: 0
2: 4
3: 71
4: 808
Right 998093441 5:139383897-139383919 CCCCTCAGGGTCCCTGAGGCAGG 0: 1
1: 0
2: 3
3: 29
4: 367
998093431_998093441 -2 Left 998093431 5:139383876-139383898 CCTTGCCCTCACCACCCTGCACC 0: 1
1: 0
2: 5
3: 100
4: 916
Right 998093441 5:139383897-139383919 CCCCTCAGGGTCCCTGAGGCAGG 0: 1
1: 0
2: 3
3: 29
4: 367
998093429_998093441 29 Left 998093429 5:139383845-139383867 CCAATCCTAAAATTCAGGTTGGT 0: 1
1: 0
2: 1
3: 7
4: 143
Right 998093441 5:139383897-139383919 CCCCTCAGGGTCCCTGAGGCAGG 0: 1
1: 0
2: 3
3: 29
4: 367
998093433_998093441 -8 Left 998093433 5:139383882-139383904 CCTCACCACCCTGCACCCCTCAG 0: 1
1: 0
2: 5
3: 85
4: 713
Right 998093441 5:139383897-139383919 CCCCTCAGGGTCCCTGAGGCAGG 0: 1
1: 0
2: 3
3: 29
4: 367

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
998093441 Original CRISPR CCCCTCAGGGTCCCTGAGGC AGG Intronic
900513678 1:3071523-3071545 CCCCCCAAGGTGGCTGAGGCAGG + Intronic
900514126 1:3073230-3073252 CCCCTCAGGGGAGGTGAGGCTGG + Intronic
900625221 1:3604884-3604906 CTCCTCAGCCTCCCTGGGGCTGG + Intronic
900772237 1:4554419-4554441 GCCAGCAGGGTCCCCGAGGCTGG - Intergenic
900988569 1:6087130-6087152 CCCCTCATAGTCCCTGAGCCAGG + Intronic
901199256 1:7457491-7457513 CCCCTCAGTGTCCCCGGGCCAGG + Intronic
901199268 1:7457526-7457548 CCCCTCAGTGTCCCCGGGCCAGG + Intronic
901339760 1:8485908-8485930 CTACTCAGGGAGCCTGAGGCAGG - Intronic
901626083 1:10625858-10625880 CCCCTCAGAGTCCCTCGAGCTGG + Intronic
902238664 1:15074013-15074035 GCCTTCAGGGCCCCTGAGCCCGG + Intronic
902404567 1:16175651-16175673 CACCTCAGGGGCCCTGGGCCTGG + Intergenic
902508002 1:16950470-16950492 TGCCTCAGCCTCCCTGAGGCTGG + Intronic
902531248 1:17092091-17092113 ACCTTCAGGATACCTGAGGCAGG - Intronic
902640848 1:17765190-17765212 CTCCTCTGGGTCCCTGAGTGTGG + Intronic
902928940 1:19716863-19716885 CCGCTCAGCTTCCTTGAGGCTGG - Intronic
903325750 1:22567598-22567620 TCCTTCAGGGTCCCTGACGGTGG + Intronic
903741190 1:25559616-25559638 CTCCGCAGGGCCCCTGAAGCAGG - Intronic
903761191 1:25699877-25699899 CCACTCGGGGCCTCTGAGGCAGG + Intronic
903812026 1:26039899-26039921 CCCTTGGGGGTCCCTGAGGACGG + Exonic
904285279 1:29449884-29449906 GGCCTCAGGGTCCCTGGGGTGGG + Intergenic
904532838 1:31180673-31180695 CCCTTCCAGGTCCCTGAGGCTGG - Exonic
904612069 1:31731307-31731329 GCCCTCAGGGCCCACGAGGCAGG + Exonic
904890533 1:33776292-33776314 TCCCTCACGGTCTCTAAGGCTGG - Intronic
905213769 1:36392407-36392429 CCACTCAGGGAGGCTGAGGCAGG + Intronic
905441343 1:37998118-37998140 CCCCACAGGGTCCCGGAAGCTGG - Exonic
905502561 1:38451227-38451249 CAGCTCAGCTTCCCTGAGGCCGG - Intergenic
905881885 1:41469216-41469238 CACCTCAGGGTCTGTGAGACAGG - Intergenic
906193521 1:43914424-43914446 CCCCTCAGACTTCCAGAGGCGGG + Intronic
906476720 1:46174388-46174410 CCCCTCAGGGTCCCAGTCTCTGG + Intronic
907261282 1:53220533-53220555 CCCCTCCGTGTCCCCGCGGCGGG + Intronic
907444654 1:54499862-54499884 CCTCTCAGGCCCCCTGAGGTTGG - Intergenic
907529450 1:55079299-55079321 CCCATCAGGGCCCCAGAGGGAGG - Intronic
908517884 1:64912160-64912182 TCCATCAGGGTCTCCGAGGCTGG + Intronic
910216341 1:84848308-84848330 CCCCTGCTGGGCCCTGAGGCTGG + Intronic
912165432 1:107037932-107037954 ACCATCAGAGTCCCTGAAGCTGG + Intergenic
915739523 1:158107995-158108017 AGCTTCAGGGGCCCTGAGGCTGG - Intergenic
915977506 1:160400660-160400682 CCCCTCAAGGCCCCGGGGGCTGG - Exonic
916040196 1:160954930-160954952 CCTCTGAGGGTACCTGAGCCTGG + Intergenic
917081294 1:171259127-171259149 CCCCTCAGGGGATCTGAGGCGGG - Intronic
920047885 1:203145436-203145458 CTTCTCAGGGTTGCTGAGGCAGG + Intronic
922466251 1:225847034-225847056 CCCCCCAGGAGGCCTGAGGCTGG - Exonic
922729694 1:227943086-227943108 CCCCGCAGGGTCCAAGAGGGAGG - Intronic
922915855 1:229257109-229257131 CCTCACAGGGATCCTGAGGCAGG + Intergenic
924727924 1:246687242-246687264 CCCCTCTGAGTCCCTGACTCCGG + Intergenic
1064772579 10:18738659-18738681 CCCTTCAGTGTCCCTGAGAGTGG + Intergenic
1065711844 10:28525636-28525658 TCCCTCAGGGAGGCTGAGGCAGG - Intergenic
1065727056 10:28677185-28677207 GCCGTCAGGGTCTCGGAGGCGGG + Intergenic
1067064271 10:43094958-43094980 CCCCACGTGGTCCCTGAGACAGG + Intronic
1067217592 10:44315968-44315990 CCCCTGGGGCTCCCTCAGGCAGG + Intergenic
1068030294 10:51698067-51698089 CCTGTCTGGGTCCCTGAGGAGGG + Exonic
1069636160 10:69926122-69926144 GCACTCAGGGGCCCTGAGGCAGG - Intronic
1069970840 10:72167748-72167770 CTCCTCAGCCTCCCTGTGGCTGG + Intronic
1070334786 10:75445691-75445713 CCACTCAGGGCCCCTGGGGGAGG - Intronic
1073460154 10:103661454-103661476 CCCCGCAGGCTCCCTCATGCCGG - Intronic
1074560917 10:114534479-114534501 GCACTCATGATCCCTGAGGCGGG + Intronic
1075911762 10:126131182-126131204 GCACCCAGGGTCCCCGAGGCAGG - Intronic
1076494310 10:130886822-130886844 CCCCCCAGGGGCCCTGGGCCAGG + Intergenic
1076526194 10:131113665-131113687 CCAGCCAGGGTCCCCGAGGCTGG + Intronic
1076720350 10:132389668-132389690 CCCCACAGGATGCCTGAGGGAGG - Intergenic
1076722621 10:132399300-132399322 ACCCACAGGTTCCCTGAGGTGGG - Intronic
1076808908 10:132876494-132876516 CCCCTCATGGTTCTGGAGGCCGG - Intronic
1076871107 10:133195575-133195597 CCCCTCAGGGTGCCTGAGGTGGG + Intronic
1077031574 11:470422-470444 CTCTTCAGGCTCCCCGAGGCTGG - Intronic
1077152107 11:1077123-1077145 GCCCTCAGGGCCTCTGAGGGGGG + Intergenic
1077284305 11:1758980-1759002 CCTCTCCGGGTACCTGAGCCAGG - Exonic
1077529580 11:3088890-3088912 TCCCTCGCGGTCCCGGAGGCTGG - Intronic
1078495206 11:11810681-11810703 GCCCTCAGGGTCCAAGAGACTGG - Intergenic
1080327435 11:31093684-31093706 CCCCTCAGCTTTCCTGAGCCTGG - Intronic
1080503597 11:32892625-32892647 CCCCTCGGAGTCCCTGAAGTCGG + Intergenic
1080905742 11:36543148-36543170 CCTCTCAGGGTCTCAGATGCTGG + Intronic
1081621055 11:44619382-44619404 CCCCACAGCGTCCCTGGCGCAGG + Exonic
1081698257 11:45133947-45133969 CCCTTCAGGGTTCCTGTGCCAGG - Intronic
1082695784 11:56363019-56363041 CCCCTCATGGCCCCTGAATCTGG + Intergenic
1083882829 11:65556985-65557007 GCCCTGAGGGCCTCTGAGGCAGG + Intronic
1083894065 11:65611464-65611486 GCCCTCAGCCTCCCTGAGCCTGG - Intronic
1083923878 11:65794435-65794457 GCCCCCAGTGTCCCTGAGGAGGG - Intronic
1084632576 11:70363758-70363780 GCACTCAGGGACTCTGAGGCAGG - Intronic
1085307694 11:75497471-75497493 CCCCTCACTGTCCAGGAGGCAGG - Intronic
1085413449 11:76305521-76305543 CCCTCCAGGGCCCCAGAGGCAGG - Intergenic
1087749491 11:101990924-101990946 CCACTCAGGGAGGCTGAGGCAGG + Intronic
1087766536 11:102161170-102161192 CTCCTCAGGGAGGCTGAGGCAGG - Intronic
1089063502 11:115644992-115645014 CCCTTCAGGAGCCCTGAGGCTGG - Intergenic
1089156479 11:116406705-116406727 CTCCTGAGGGTCCTTGAAGCAGG - Intergenic
1089638498 11:119831983-119832005 CCCCTCAGAGTCCCTGGGCTGGG + Intergenic
1089689799 11:120180319-120180341 CAGCTCAGGGTCCCCAAGGCTGG + Intronic
1089768213 11:120783974-120783996 CCCCTCAGCCTCCCTGAGGCTGG - Intronic
1090438590 11:126708033-126708055 CCCCTCCGCATCCCTGAAGCAGG + Intronic
1091632220 12:2170854-2170876 GCCTGCAGGGGCCCTGAGGCAGG + Intronic
1091699532 12:2650798-2650820 TCCCTCAGGGGCCCTGGGGAAGG - Intronic
1091994534 12:4982813-4982835 ACTCTCTGGGTCCCTGAGGATGG + Intergenic
1093991343 12:25592601-25592623 CCTCACAGGGTCCTTGGGGCGGG + Intronic
1097178401 12:57156726-57156748 CCCCTCAGAGCCCCTGTGCCAGG - Intronic
1097961128 12:65532869-65532891 CCGATCAGAGTCCGTGAGGCTGG - Intergenic
1102471781 12:113163478-113163500 CCTCTGCTGGTCCCTGAGGCAGG - Intronic
1103393246 12:120589264-120589286 CCCCCCAGGGTCCTTGAGGGAGG - Intergenic
1104599217 12:130141278-130141300 CTGCCCAGGGTCCCAGAGGCAGG - Intergenic
1104847458 12:131853721-131853743 CACCTCAGGGAGGCTGAGGCGGG - Intergenic
1104906513 12:132216331-132216353 CCCCACAGGGTCCCTCACACAGG + Intronic
1105292287 13:19060813-19060835 CCGCTCAGGGCCCCTGAGTGGGG - Intergenic
1105720331 13:23107447-23107469 ACCCTCAGTTTCACTGAGGCCGG + Intergenic
1106795424 13:33200203-33200225 CCCCTAAGGGTTCCTGGGGCTGG + Intronic
1106921814 13:34572162-34572184 TCCTTCAGGTTCTCTGAGGCTGG + Intergenic
1107002173 13:35560648-35560670 TCCCACAGGGTGCCTGGGGCTGG + Intronic
1107757080 13:43636089-43636111 CACCTCAGGCTGCCTGAGGTTGG + Intronic
1107801965 13:44116779-44116801 CCCCTCAGGGTGGCTGGGCCAGG - Intergenic
1112046367 13:95602066-95602088 CCGCTGAGTGTTCCTGAGGCTGG - Intronic
1112509679 13:99998009-99998031 CCCCTGTGGGTCCCGGAAGCCGG + Intergenic
1112956929 13:105072243-105072265 CACCTCTGAGTCCCTGAAGCAGG - Intergenic
1113642566 13:111968587-111968609 CCCCTCAGGGGCCCAGAACCTGG + Intergenic
1113902842 13:113806225-113806247 CTCCTCGGGGTCCCTGGTGCAGG - Intronic
1114066175 14:19061729-19061751 CCCCTCGCGGGCCCTGACGCAGG + Intergenic
1114096093 14:19338295-19338317 CCCCTCGCGGGCCCTGACGCAGG - Intergenic
1114415150 14:22537916-22537938 CCCCTGATCTTCCCTGAGGCTGG + Intergenic
1115643063 14:35347625-35347647 CCCCGCAGGGTCGCCCAGGCTGG + Intergenic
1117076125 14:52106661-52106683 CTCCTCAGGGGCTCTGAGTCAGG - Intergenic
1117325792 14:54667916-54667938 GCCCTCAGGGCTCCCGAGGCAGG - Intronic
1119011155 14:70990451-70990473 CTACTCAGGGTGGCTGAGGCAGG + Intronic
1119895527 14:78216530-78216552 CCCCTGAGCTTCCCTGTGGCTGG + Intergenic
1120289182 14:82545231-82545253 CCACTCAGGGAGGCTGAGGCAGG + Intergenic
1121014417 14:90539584-90539606 CCTCTCTGGCTCACTGAGGCAGG - Exonic
1121271493 14:92641031-92641053 CCTCTCTGGGTCCCTGGTGCTGG + Intronic
1121541179 14:94727993-94728015 CCCCCACTGGTCCCTGAGGCTGG + Intergenic
1122027186 14:98886585-98886607 CCAGACAGGCTCCCTGAGGCTGG + Intergenic
1122143517 14:99675915-99675937 CTCCTCAGGGTCCCACAGCCCGG - Exonic
1122415873 14:101549221-101549243 CCCCACAGCGTCCCCGAGGAGGG + Intergenic
1123111111 14:105867205-105867227 CCCCTGAGGGTCACTTAGCCTGG + Intergenic
1124011722 15:25844626-25844648 CCACTCAGGGTGCATGGGGCGGG - Intronic
1124240862 15:28026714-28026736 CACCTCAGGGAGTCTGAGGCGGG + Intronic
1126783715 15:52159817-52159839 CCCCTCTGGCTCCCTGACCCTGG - Intronic
1128031024 15:64480125-64480147 CTCCTCAGGGGGTCTGAGGCAGG + Intronic
1128229607 15:66025370-66025392 CCCCTCAGTCAGCCTGAGGCAGG + Intronic
1128332206 15:66763251-66763273 CTCCTCAGGGTTCCTCAGGCTGG + Intronic
1128691878 15:69730831-69730853 CACGTCAGGGTCCGAGAGGCAGG + Intergenic
1128768806 15:70266818-70266840 CCCCTCCAGGCCGCTGAGGCTGG + Intergenic
1129596826 15:76971675-76971697 CTCCTCAGGGGGGCTGAGGCAGG - Intergenic
1129725297 15:77898543-77898565 TCCCTCATGGTGCCTGAGGGTGG + Intergenic
1130042840 15:80419288-80419310 CCCTTCAGGTCCACTGAGGCAGG + Intronic
1130545968 15:84857860-84857882 CACCTCACGGTCCAGGAGGCCGG - Exonic
1130976136 15:88776660-88776682 ACTCTCAGGCTCCCTGAGGAAGG + Intergenic
1131260677 15:90885954-90885976 CCTCTCAGGGCCCCAGAGACTGG + Intronic
1131512791 15:93058681-93058703 CCCTTCAGGGTACCTGAGGGTGG - Intronic
1132483533 16:178162-178184 CCACTCAGCTCCCCTGAGGCTGG + Intergenic
1132603550 16:784353-784375 CACCTCAGGGACTCTGGGGCTGG + Intergenic
1132609879 16:810344-810366 CCCCTCTGGTTCCCTGAGGAGGG + Intronic
1133225436 16:4338347-4338369 CCCCACATGCTCCCTGAGCCAGG - Exonic
1133237057 16:4392304-4392326 CACCTCAGGGTGACAGAGGCAGG - Intronic
1133336307 16:5008754-5008776 TCCTGCAGGGTCCCTGAGGCTGG - Intronic
1137504063 16:49035755-49035777 GCCCTCATGGTCCCTGGAGCTGG + Intergenic
1138122779 16:54413858-54413880 CCCCTGGGAGTCCCTGATGCAGG - Intergenic
1138277979 16:55750127-55750149 CTCCTCCAGGTTCCTGAGGCTGG - Intergenic
1138348640 16:56334952-56334974 GCCCGCAGGTTCCCTGGGGCAGG - Intronic
1139440341 16:66963608-66963630 CCCCGCAGGGTCCGGTAGGCCGG + Exonic
1140251051 16:73294698-73294720 CTACTCAGGGTGGCTGAGGCAGG + Intergenic
1141595085 16:85092454-85092476 TCCCTCCCCGTCCCTGAGGCTGG - Exonic
1141605530 16:85151495-85151517 CCACTCAGGAGCCCAGAGGCAGG - Intergenic
1141721717 16:85759701-85759723 GGCCTCAGGCTCCATGAGGCAGG - Intergenic
1142112717 16:88340840-88340862 CCTCTCACGGTCCCTCAGGGTGG - Intergenic
1142279307 16:89139374-89139396 CCCCTGGGGCTTCCTGAGGCGGG + Intronic
1142623515 17:1179321-1179343 CCCCTGAGGCTCGCGGAGGCCGG + Intronic
1142734153 17:1884136-1884158 CCCCTCAGGGGACTGGAGGCAGG + Intronic
1142851449 17:2706730-2706752 CCCCACAGGGTCCCTGAGAAAGG + Intronic
1143253786 17:5541154-5541176 CTACTCAGGGAGCCTGAGGCAGG - Intronic
1143871371 17:9959316-9959338 CCATTCAGGTTCCCTGAGGGTGG + Intronic
1144079276 17:11747803-11747825 AGCCTCAGAGTCCCTGTGGCGGG + Intronic
1145403768 17:22568972-22568994 CTACTCAGGCTCCCTGAGGAGGG - Intergenic
1145764679 17:27450248-27450270 CCCCTCAGGGTGGCTGAGAGAGG - Intergenic
1146259966 17:31414778-31414800 TCCCAGTGGGTCCCTGAGGCGGG + Intronic
1146303459 17:31709934-31709956 CCCCTCAGGGCCCAGCAGGCCGG + Intergenic
1146569255 17:33938817-33938839 CCTCCCAGAGTCACTGAGGCAGG - Intronic
1146923705 17:36730099-36730121 GGGCTCAGGGTCCCTGGGGCTGG - Intergenic
1147120233 17:38331277-38331299 CCCCTCGGGTTCCTGGAGGCTGG + Exonic
1147135799 17:38433690-38433712 CCCCTGATGTTCCCAGAGGCTGG - Intronic
1147539722 17:41347001-41347023 CCCCCCAGGGCCCCGGAGGCAGG - Intronic
1147541671 17:41365332-41365354 CCCCCCAGGGCCCCGGAGGCAGG - Intronic
1147545145 17:41395402-41395424 CCCCCCAGGGCCCCGGAGGCAGG - Intronic
1147595616 17:41715369-41715391 CCCCACAGAGGCCCAGAGGCAGG - Intronic
1147742621 17:42677437-42677459 CGTCTCAGGGTCCCTGAGAAAGG + Intergenic
1148238202 17:45983278-45983300 CCTCTCTGGGGCCCTCAGGCAGG - Exonic
1148685814 17:49500652-49500674 AGCCTCAGGGTCCCAGATGCAGG - Intronic
1150638517 17:66933549-66933571 GCCCTCAGGCTCACAGAGGCAGG + Intergenic
1151348676 17:73518817-73518839 CCCCTCAGTGGCCCCAAGGCAGG + Intronic
1151369543 17:73639298-73639320 CCCCTCAGACTCCCTGGGCCTGG - Intronic
1151715751 17:75830290-75830312 GCCCCCAGGGTCGCTGAGACAGG + Intronic
1152088300 17:78233327-78233349 CCCCTCAGAGTCCCTCAGGCAGG - Intronic
1152634269 17:81424034-81424056 CCCTTCAGGATTCCTGGGGCTGG - Intronic
1152669228 17:81591975-81591997 ACCCTGAGGGTCCCTGTGGAAGG - Intronic
1152878271 17:82800756-82800778 CTCCACAGGGGCCTTGAGGCAGG - Intronic
1154102788 18:11491351-11491373 CTCCTCAGGGTCCCTGCAGATGG + Intergenic
1155164663 18:23222691-23222713 TCTCTCAGGGTCCCTCAGCCTGG + Intronic
1155655577 18:28188588-28188610 CTACTCAGGATGCCTGAGGCAGG - Intergenic
1157159926 18:45304736-45304758 CATCTCAGGGTCCCTGGGGTAGG - Intronic
1159954258 18:74508148-74508170 CTCCTCTGGTTCCATGAGGCCGG + Intronic
1160298686 18:77659402-77659424 CCCCTGAGGAGCTCTGAGGCTGG + Intergenic
1160453605 18:78980693-78980715 CCCCCCAGGGTCTCTGCGCCAGG + Intronic
1160865850 19:1255639-1255661 CCCCTCAGCCTCCCTGCTGCAGG + Exonic
1161068564 19:2249691-2249713 CCCCCCAGGGTCCCGCAGCCAGG - Exonic
1162122961 19:8483422-8483444 CTCCACAGCATCCCTGAGGCAGG - Intronic
1162208697 19:9075019-9075041 CCCATCAGTGTCACTGAGTCAGG - Intergenic
1162301460 19:9847420-9847442 AGCCCCAGGGTCCCAGAGGCAGG - Intronic
1162335017 19:10054985-10055007 CACCTCAGGGTCTCTGGAGCAGG - Intergenic
1162967861 19:14164485-14164507 CCCCTGAGGGACCCTCAGTCGGG - Intronic
1163758773 19:19121692-19121714 CCTCCCAGGGTCCCCCAGGCAGG - Intronic
1164396255 19:27866376-27866398 CCCCTTAGGATGCCTGAGGTCGG - Intergenic
1164587360 19:29484378-29484400 CTCCTCACTGTCCCTGAAGCAGG - Intergenic
1164855287 19:31516396-31516418 CCAGTCAGGGTCCCTGTGGAGGG + Intergenic
1165110406 19:33498890-33498912 CCCGCCAGGGTCCTTGAGACAGG + Intronic
1165118145 19:33541500-33541522 CCACTCAGAGTCCCAGAGCCAGG - Intergenic
1165449043 19:35871772-35871794 CATCTCAAGGTTCCTGAGGCAGG + Intronic
1165454921 19:35904807-35904829 ACACGCAGGGACCCTGAGGCTGG - Intronic
1166333093 19:42090002-42090024 CCCATCAGGGTCCATGTGGTGGG - Exonic
1166732779 19:45068157-45068179 CCCCTCCCTGTCCCTGGGGCTGG - Intronic
1166939867 19:46356056-46356078 CCCCGCATACTCCCTGAGGCTGG + Intronic
1167499123 19:49835750-49835772 CCCCTACGGTACCCTGAGGCTGG - Exonic
1167965147 19:53138224-53138246 CTCCTCAGGGAGACTGAGGCAGG - Intronic
1168681729 19:58320701-58320723 CCCTTCAGGGTCACCGGGGCGGG + Intergenic
925034344 2:674300-674322 CCACGCAGAGGCCCTGAGGCAGG - Intronic
925218447 2:2117389-2117411 ACCCTCAGGATCCCTGAGGGTGG - Intronic
925385304 2:3458003-3458025 CCCCTCTGGGCCCCTTCGGCTGG - Intronic
926197175 2:10771117-10771139 CCACGCAGGCTCCCTGAGGAGGG + Intronic
926637027 2:15191875-15191897 CCTCAAAGGGACCCTGAGGCTGG - Intronic
927907007 2:26865963-26865985 CCCCTCACTGTCCCTGATGGTGG - Intronic
928894701 2:36247313-36247335 CCAGTCAGGGACCCTGAAGCTGG + Intergenic
932436443 2:71704923-71704945 CCCCTCCTGGTCCCTGAGGGAGG - Intergenic
933350195 2:81144641-81144663 CCCATCTGTGTTCCTGAGGCAGG - Intergenic
933990692 2:87632164-87632186 CCCCCCAGGGTCCCTGACAGTGG - Intergenic
934034454 2:88077393-88077415 CTCTTAAGGGTCCCTGACGCCGG - Intronic
934990354 2:98915973-98915995 GCCCTCAGGGTCACTGGGCCAGG + Intronic
936151199 2:110023294-110023316 CTCCTCAGAGACCCTGAGGCTGG + Intergenic
936193476 2:110348075-110348097 CTCCTCAGAGACCCTGAGGCTGG - Intergenic
936278619 2:111120386-111120408 CCTCTGAGGGTCCCTGGCGCCGG - Intronic
936303152 2:111318659-111318681 CCCCCCAGGGTCCCTGACAGTGG + Intergenic
938481832 2:131669485-131669507 CCCCCCCGGGTCTCTGAGGAGGG + Intergenic
938715166 2:134012835-134012857 CCACTCAGGGAGGCTGAGGCAGG + Intergenic
945046908 2:205789649-205789671 CCCCTCTGCCTCCCAGAGGCCGG + Intronic
947624931 2:231613385-231613407 CCCCGCGGGGTCCCTGGGGTGGG - Intergenic
947793088 2:232878849-232878871 CCCATCAGGGAGCCAGAGGCGGG + Exonic
947815755 2:233035045-233035067 CACCACAGGCTCACTGAGGCAGG - Exonic
947915251 2:233828442-233828464 CCCCACACAGACCCTGAGGCAGG + Intronic
948259201 2:236590444-236590466 TCTCTCAGAGTTCCTGAGGCTGG + Intergenic
948696636 2:239736253-239736275 CCCCTGCGGGTCCCAGAGCCCGG + Intergenic
1169769656 20:9187084-9187106 TCCCTCAGGGAGGCTGAGGCAGG - Intronic
1172624118 20:36337606-36337628 ACCCTCAGGATCCCAGAGTCAGG - Intronic
1173825159 20:46043537-46043559 ACCCTCAGGGTCAGTGAGTCTGG - Intronic
1173834721 20:46117964-46117986 ACCGTGAGGGTCCCTGTGGCAGG + Intergenic
1174449588 20:50611010-50611032 CCCCTCACCATCCCTGAGGAAGG + Intronic
1175416623 20:58805404-58805426 CTCCTCAGGCACCCTGGGGCTGG + Intergenic
1175769521 20:61614799-61614821 CTCTTCAGGCTCCCTGAGGATGG + Intronic
1175847798 20:62067714-62067736 GCCCCCAGGGTCCCAAAGGCTGG + Intergenic
1175918627 20:62439516-62439538 GCCCACAGGCACCCTGAGGCTGG + Intergenic
1178314287 21:31556323-31556345 CCACTCGGGGTAACTGAGGCAGG + Intronic
1178360381 21:31944417-31944439 CCCCTCAGGATCACTGAAACGGG - Intronic
1179148204 21:38787583-38787605 CCCCTCTGGGCCCCTGGGGGAGG + Intergenic
1179428784 21:41304370-41304392 CTGCTCAGGGTCCCAGATGCAGG - Intronic
1180042667 21:45288157-45288179 CTCCTGAGGGTCCGCGAGGCCGG + Intergenic
1180484653 22:15784320-15784342 CCCCTCGCGGGCCCTGACGCAGG + Intergenic
1180669247 22:17540580-17540602 CCCTTCTGGGTCCCTGGAGCGGG - Exonic
1181168002 22:20993540-20993562 ACCCTCAGGGCCCAGGAGGCAGG - Intronic
1181307925 22:21927479-21927501 CCCCTCAATGTCCCAGAGGCAGG + Intronic
1181680833 22:24494943-24494965 TCCCTCAGGGGCCCTGGCGCGGG - Intronic
1181742308 22:24931097-24931119 CCCCTCAGCATCACTGAGGATGG + Intergenic
1184482173 22:44754096-44754118 GCCCTCAGGGGCCCAGAGTCTGG + Intronic
1184777005 22:46628278-46628300 ACTCACAGGGTCCCTCAGGCGGG - Intronic
1185052653 22:48561958-48561980 GCACTCAGGGAGCCTGAGGCCGG - Intronic
1185143406 22:49116623-49116645 CCTCTCATGGTCGCTGGGGCCGG + Intergenic
1185281462 22:49971755-49971777 GCCGGCAGGGTCCCTGGGGCAGG + Intergenic
1185315163 22:50175812-50175834 CCCCACAGGGGCCCAGGGGCTGG - Intronic
950000018 3:9649546-9649568 CCCCTCAGTGTGCCTCAAGCGGG - Exonic
950118999 3:10469534-10469556 CCCCTCAGGGGGCCTGACGCTGG - Intronic
950583809 3:13879465-13879487 TCCCCCAGAGTCCCTCAGGCTGG + Intronic
952690204 3:36196567-36196589 CACCTGAAGGTCCCTGAGCCAGG - Intergenic
952885363 3:38008481-38008503 CCCACCAGGGCCCCTGAGCCAGG + Exonic
952990043 3:38823922-38823944 CCCCTGTGGGCCCCTGAGGTGGG + Intergenic
953326268 3:42014227-42014249 CCCCGCAGGGTCCCGGCGCCCGG - Intronic
953568262 3:44051510-44051532 ACCAGCAGGGTCCCTCAGGCAGG - Intergenic
954378182 3:50205692-50205714 CACCACAGGCTTCCTGAGGCAGG + Intronic
954450070 3:50567028-50567050 CCTCTGATGGTCCCTGAGGAAGG + Intronic
956634177 3:71346917-71346939 TGCCTCAGCCTCCCTGAGGCAGG - Intronic
957039536 3:75326876-75326898 AACCTCAGTTTCCCTGAGGCTGG + Intergenic
961005819 3:123404678-123404700 ACCCTCAGAGCCCCTGCGGCTGG - Intronic
961044265 3:123698154-123698176 AACCTCAGTTTCCCTGAGGCTGG + Intronic
961311863 3:126007449-126007471 CCCTTCAGGGTGCCAGAAGCTGG - Intronic
962253826 3:133856815-133856837 CCCCAGTGGGTCTCTGAGGCAGG + Intronic
963259420 3:143177625-143177647 CCCCTCAGGGTCACAGGGGTGGG + Intergenic
965584025 3:170299336-170299358 CTACTCAGGGTATCTGAGGCAGG - Intronic
967945463 3:194800418-194800440 ACTCTCAGGGACCCTGAGGGTGG + Intergenic
968870362 4:3238983-3239005 CCTCTCTGGGTCCCTGGTGCTGG + Intronic
969459569 4:7321858-7321880 GCCCTCAGGGCCCCAGAGGGTGG - Intronic
969666302 4:8559270-8559292 CCTCTCGGGCTCCTTGAGGCTGG - Intronic
970171027 4:13290762-13290784 CCTCCCAGGGTCCCTGTGACTGG - Intergenic
972581912 4:40402773-40402795 CACACCTGGGTCCCTGAGGCAGG - Intergenic
973331602 4:48915030-48915052 CCCTCCCTGGTCCCTGAGGCAGG + Intergenic
973789378 4:54364207-54364229 CCCCTCCCGATCCCAGAGGCTGG - Intergenic
978107134 4:104916738-104916760 CCCCTCAGGCCCCTTGAGGTAGG + Intergenic
980858026 4:138463953-138463975 CCCTTCAGGGGGCCTGAGGGAGG + Intergenic
981503432 4:145476184-145476206 CCCCTCAGGTTAACCGAGGCTGG + Intergenic
984280392 4:177663309-177663331 CCTCTCAGGGTCCCTGGGAAGGG - Intergenic
985525457 5:399172-399194 AGCCCCAGGGTCTCTGAGGCCGG + Intronic
985564387 5:608178-608200 TCCCTCTGGGTGCCTGAGCCAGG - Intergenic
991059167 5:62353852-62353874 CCCCTCAGGGTCCCTTCAGATGG + Intronic
992449624 5:76864513-76864535 CACCTCAGCCTCCCAGAGGCAGG + Intronic
992752291 5:79872515-79872537 CTCCTCAGGGGACCTGGGGCTGG + Intergenic
997412589 5:133701519-133701541 CCATTCAGGGAACCTGAGGCTGG - Intergenic
997866671 5:137469945-137469967 CCCATCTGGGACCCAGAGGCTGG + Intronic
997980391 5:138464795-138464817 GCTCTCACGGTCCCTGAGGTGGG + Intergenic
998093441 5:139383897-139383919 CCCCTCAGGGTCCCTGAGGCAGG + Intronic
998154346 5:139776034-139776056 CTCCCCAAGGTCCCTGAGGAGGG + Intergenic
999206147 5:149849524-149849546 CCACTCAGGTTCCCTGAGCCTGG + Exonic
999300927 5:150489906-150489928 TCCTTCAGGGTTCCTGAGGATGG + Intronic
1000157239 5:158563856-158563878 CCCCTCACGCTCCCTGTGGCTGG + Intergenic
1000288197 5:159846188-159846210 TCCCTTGGGGACCCTGAGGCTGG - Intergenic
1001504546 5:172266930-172266952 CCCCAGAGGCTGCCTGAGGCAGG + Intronic
1002069493 5:176670893-176670915 CCCGGCACTGTCCCTGAGGCTGG + Intergenic
1002300683 5:178255835-178255857 CTCCTCATGCTCCCAGAGGCTGG - Intronic
1002309464 5:178305983-178306005 CTCCTCCGGGTCCCCGAGGTTGG - Intronic
1002456297 5:179346797-179346819 CACCTAAGGGTGCCCGAGGCTGG + Intergenic
1002532480 5:179856579-179856601 CTACTCAGGGTCGCTGAGGCAGG - Intronic
1002834625 6:855719-855741 CGCCCCAGGGTCCCTGAGCAAGG - Intergenic
1004896235 6:20150672-20150694 CTACTCAGGGACGCTGAGGCAGG - Intronic
1004983938 6:21059053-21059075 CCCCTCAGGGTCTCTGTCCCAGG + Intronic
1006081524 6:31570346-31570368 CCCCTCAGGGACCTTGTGCCTGG + Intergenic
1006186853 6:32186354-32186376 CCCCTCAGGGTCACAGGGGTGGG - Exonic
1006463393 6:34176978-34177000 CAGTTCAGTGTCCCTGAGGCAGG - Intergenic
1006792835 6:36714892-36714914 CACTGCAGGGGCCCTGAGGCAGG - Intronic
1006921142 6:37627967-37627989 CCCCTCCTGGGCCCTGAGTCTGG + Intergenic
1006923400 6:37640748-37640770 CCCATCAGTGTCCTTGGGGCAGG + Intronic
1007665559 6:43510884-43510906 CCCCATAGGGTCCCTAGGGCAGG + Intronic
1007706113 6:43792441-43792463 CCCCTGACGGTCCCTGGGTCTGG + Intergenic
1008042881 6:46820500-46820522 CCCATCTGCCTCCCTGAGGCAGG - Intronic
1010229458 6:73521661-73521683 CCCCTCGGGGTCCCCGGGCCTGG - Intronic
1014724785 6:124962036-124962058 TCCCCCAGGGGCCCTGCGGCTGG + Intergenic
1016829619 6:148420970-148420992 CTACTCAGGGTGGCTGAGGCAGG + Intronic
1017284477 6:152658451-152658473 GCCCTCAGGGAGGCTGAGGCAGG + Intergenic
1017494559 6:154972089-154972111 CACCTCAGCCTCCCAGAGGCTGG + Intronic
1018720602 6:166569216-166569238 CCCCGCAGGGGCCTTGAGACTGG + Intronic
1018935097 6:168269139-168269161 CCTCTCACTGTCCCTGGGGCTGG - Intergenic
1019195947 6:170283262-170283284 CCCCTGAGGAGCCCTGGGGCTGG + Exonic
1019427474 7:984341-984363 CCCCTTAGGTCCCCTCAGGCCGG - Intronic
1019428144 7:986970-986992 TCCCTCAGCGTCCCCGAGGCAGG - Intronic
1019500578 7:1362504-1362526 CCCCTCAGCGTCCCTTGGGCGGG - Intergenic
1019918234 7:4147086-4147108 TCCCACAGGGTCCCTGGGTCTGG - Intronic
1023017450 7:35982275-35982297 CACCTCAGTGTCCCTGGGCCTGG + Intergenic
1023205590 7:37746006-37746028 CTCCTGAGGGTGCCAGAGGCTGG - Intronic
1023296444 7:38719864-38719886 CTCCTCAGGGTCCCAGATGTGGG + Intergenic
1023310590 7:38882398-38882420 CCCCTCAGGGTCCAGGAATCAGG + Intronic
1023879710 7:44311611-44311633 CCCCTCTGGGTACCCGGGGCTGG - Intronic
1029461355 7:100695493-100695515 CTACTCAGGGTGCTTGAGGCAGG - Intergenic
1032011968 7:128352611-128352633 CCCCGAAGGGTTCCCGAGGCTGG + Exonic
1033241379 7:139682534-139682556 CTCCTCTGGGTCCCTGTGGTGGG + Intronic
1034275176 7:149820868-149820890 CCCCACAGGGTCCCTGGAGCAGG + Intergenic
1034469359 7:151247356-151247378 CCCCCAGGGGTCCCTGGGGCTGG + Intronic
1034965602 7:155388858-155388880 CCCCGAAGGCTCACTGAGGCCGG - Intronic
1035468242 7:159093702-159093724 CCCCGCAGCGTCCCTGGGTCCGG + Intronic
1035468253 7:159093735-159093757 CCCCGCAGCGTCCCTGGGTCCGG + Intronic
1035468264 7:159093768-159093790 CCCCGCAGCGTCCCTGGGTCCGG + Intronic
1035643568 8:1201344-1201366 CCGCTCAGGGGCCGTGGGGCAGG + Intergenic
1035751871 8:2002122-2002144 CCCCCGAGGGGCTCTGAGGCCGG - Exonic
1037039677 8:14215963-14215985 CCCCTCACAGACCCTGAGGAGGG + Intronic
1040294181 8:46140766-46140788 CCCCTCTGAGTCCCTGTGGCCGG + Intergenic
1040977997 8:53215233-53215255 ACCCTCTGGGCCACTGAGGCTGG + Intergenic
1045702476 8:104882518-104882540 CCACTCTGGGAGCCTGAGGCAGG - Intronic
1046004735 8:108464962-108464984 TCCTTCTGGGTCCCTGAGTCTGG + Intronic
1047406598 8:124590511-124590533 CCCCTCAGTAACCCCGAGGCTGG - Intronic
1049188127 8:141270086-141270108 GCCCTCAGGGTCTGTGGGGCAGG - Intronic
1049215372 8:141405378-141405400 AACCTCCGGGTCCCTGAGGTCGG + Intronic
1049343210 8:142124816-142124838 CCCCTGGGGTCCCCTGAGGCTGG + Intergenic
1049488138 8:142876979-142877001 CACTCCAGGGTCTCTGAGGCTGG + Intronic
1049661071 8:143819998-143820020 CCCCTCAGGATCCCCGAGATGGG + Intronic
1049805022 8:144534809-144534831 CCCCTCAGGGACCCTGCTGTCGG - Intronic
1052278542 9:26706310-26706332 CCCATCAGAGTCCAGGAGGCAGG - Intergenic
1053428018 9:38023794-38023816 CCCCTCAGGGCCCTGGATGCTGG - Intronic
1055196300 9:73598661-73598683 CCCCTCAGGGTACCTGTAACTGG + Intergenic
1057207963 9:93184622-93184644 TCCCTGAGGGCCCCGGAGGCCGG - Intergenic
1057880279 9:98787954-98787976 CCCCACAGCAGCCCTGAGGCGGG + Intronic
1058101144 9:100918873-100918895 CTCCTCAGTGTCCTAGAGGCAGG + Intergenic
1060590684 9:124814458-124814480 CCCCCCAGGAGCCCCGAGGCCGG + Exonic
1060699999 9:125742415-125742437 CTACTCAGGAGCCCTGAGGCAGG + Intergenic
1061386839 9:130295482-130295504 CCCCTGGGGATCCCTGAGGGTGG + Intronic
1061907026 9:133704076-133704098 CCCCGCAGGGTTCATGAGGACGG + Intronic
1062117016 9:134814921-134814943 CACCTCAGGGGCCCTGCAGCAGG + Intronic
1062177849 9:135174263-135174285 CAGCTCAGGGTCCCTGTGCCTGG + Intergenic
1062489871 9:136799889-136799911 CCCCACAGGGAACCTGGGGCTGG - Intronic
1203761150 EBV:13405-13427 CCCCACCGGGTCCATCAGGCCGG + Intergenic
1203762079 EBV:16477-16499 CCCCACCGGGTCCATCAGGCCGG + Intergenic
1203763008 EBV:19549-19571 CCCCACCGGGTCCATCAGGCCGG + Intergenic
1203763937 EBV:22621-22643 CCCCACCGGGTCCATCAGGCCGG + Intergenic
1203764866 EBV:25693-25715 CCCCACCGGGTCCATCAGGCCGG + Intergenic
1203765795 EBV:28765-28787 CCCCACCGGGTCCATCAGGCCGG + Intergenic
1203766724 EBV:31837-31859 CCCCACCGGGTCCATCAGGCCGG + Intergenic
1203767653 EBV:34909-34931 CCCCACCGGGTCCATCAGGCCGG + Intergenic
1187249520 X:17584255-17584277 CCCCTCAGAGGCTCTGAGGAGGG + Intronic
1187921180 X:24203430-24203452 CTCATCAGAGTCCCAGAGGCAGG + Intronic
1189349563 X:40266624-40266646 CCCATCAGGGGGCTTGAGGCTGG + Intergenic
1190728962 X:53212015-53212037 GCACTCAAGGCCCCTGAGGCAGG + Intronic
1191229361 X:58081924-58081946 CCCCTAAGAGTGCCTGAGGTCGG - Intergenic
1191856161 X:65628505-65628527 CAGCTCAGGGACCCTGGGGCTGG + Intronic
1192910038 X:75593615-75593637 CCCCTGAGCTTCCCTGTGGCTGG - Intergenic
1196707274 X:118727482-118727504 CGGCTCAGGTTACCTGAGGCCGG + Intergenic
1198079240 X:133223547-133223569 CCCTTCAGGGTACATGAGGGAGG + Intergenic
1200147092 X:153931998-153932020 CCCATCAGGGCACCTGAGACCGG - Intronic
1200216808 X:154371698-154371720 CCCCGCAGGGGCCCTGGGGAAGG - Intronic